DNA Structure and Replication PDF

GENE221 DNA Structure and Replication LESSON 8 Recitation Explain clearly how sex is determined. Use the examples about special cases where there are unusual chromosome combinations. Recitation Differentiate X-linked traits in males and in females, Recitation Differentiate sex-lim...

GENE221 DNA Structure and Replication LESSON 8 Recitation Explain clearly how sex is determined. Use the examples about special cases where there are unusual chromosome combinations. Recitation Differentiate X-linked traits in males and in females, Recitation Differentiate sex-limited traits and sex-influenced traits and give an example for each. Recitation Explain Mendelian, polygenic, and multifactorial traits. Give an example for each and explain why it is a Mendelian, polygenic, or multifactorial trait. Recitation Why are identical twins, with almost similar genome, have different fingerprint patterns? Recitation What can we get from twin studies? How do they analyze a trait if it is genetic or multifactorial?  GENE221 DNA Structure and Replication LESSON 8  LESSON 8 DNA deoxyribonucleic acid molecule that carries genetic information in living organisms  LESSON 8 Roles of the genetic material “A genetic material must carry out two jobs: duplicate itself and control the development of the rest of the cell in a specific way.” - Francis Crick  LESSON 8 History of DNA Gregor Mendel, 1860s foundation of genetics through pea plant experiments, establishing the laws of inheritance led to the idea of “heritable factors” Friedrich Miescher, 1871 isolated nuclei from pus and identified nuclein later called nucleic acid  LESSON 8 History of DNA Walter Sutton and Theodor Boveri, 1902 chromosomes as carriers of genetic information set the stage for DNA’s role in inheritance Frederick Griffith discovered that a "transforming principle" could pass genetic information from one bacteria to another transforming principle = nucleic acid later DNA  LESSON 8 History of DNA Avery, MacLeod, and McCarty (1944) & Hershey and Chase (1952) their experiments provided strong evidence that DNA is the carrier of genetic information and DNA is the molecule of heredity Phoebus Levene discovered the structure of DNA  LESSON 8 Structure of DNA Phoebus Levene identified ribose (5-carbon sugar) as part of some nucleic acids discovered similar sugar, deoxyribose in other nucleic acids major distinction between DNA and RNA: RNA contains ribose, and DNA contains deoxyribose discovered that the three parts of nucleic acid: sugar, nitrogen- containing base, and a phosphorus-containing component are present in equal proportions  LESSON 8 one nucleotide is composed of: sugar (deoxyribose) phosphate group (a phosphorus atom bonded to 4 oxygen atoms) nitrogenous base (one of four types: adenine, thymine, cytosine, and guanine) DNA IS A CHAIN OF NUCLEOTIDES.  LESSON 8 PURINE a type of organic molecule with a two-ring structure adenine and guanine PYRIMIDINE ‫‏‬a type of organic molecule with a single-ring structure cytosine and thymine (and uracil)  LESSON 8 DNA consists of two chains of nucleotides. The two opposing orientation of the two nucleotide chains in a DNA molecule is called antiparallelism (the strands running in an opposite head-to-toe-manner). one strand runs in a 5' to 3' direction while the other strand runs in a 3' to 5' direction  LESSON 8 DNA bases pair via hydrogen bonds Erwin Chargaff’s rule: no. of adenine = no. of thymine no. of guanine = no. of cytosine hydrogen bonds hold the base pairs together complementary DNA base pairs: Adenine (A) is always paired with Thymine (T) Cytosine (C) is always paired with Guanine (G)  LESSON 8 Sample Exercise 1 A DNA sample has 30% adenine (A). Calculate the percentages of thymine (T), cytosine (C), and guanine (G) in the sample.  LESSON 8 Sample Exercise 2 In a DNA sample, cytosine (C) makes up 15% of the nucleotides. Calculate the percentages of adenine (A), thymine (T), and guanine (G) in this sample.  LESSON 8 Sample Exercise 3 A double-stranded DNA molecule contains 600 adenine (A) nucleotides. Calculate the number of thymine (T), cytosine (C), and guanine (G) nucleotides in this molecule if there are 2,000 nucleotides in total.  LESSON 8 DNA exists as a double helix “X-ray diffraction indicated DNA has a repeating structure.” - Maurice Wilkins and Rosalind Franklin “DNA is double-stranded molecules wound in a double helix.” - James Watson and Francis Crick  LESSON 8 DNA exists as a double helix A sugar and phosphate “backbone” connects nucleotides in a chain Two nucleotide chains together wind into a helix. DNA strands are antiparallel. DNA has directionality. Hydrogen bonds between paired bases hold the two DNA strands together.  LESSON 8 The double-stranded, helical structure of DNA gives it great strength --50 times the strength of single-stranded DNA, which would not form helix. The many negative charges of the phosphate groups on the outside of the molecule attract positively charged DNA binding proteins, whose interactions are critical to using genetic information.  LESSON 8 Orientation of DNA The carbon atoms on the sugar ring are numbered for reference. The 5’ and 3’ hydroxyl groups are used to attach phosphate groups. The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone.  LESSON 8 DNA molecules are incredibly long. The DNA of the smallest human chromosome if stretched is 14 millimeters long. During cell division it is packed into a chromosome that is 2 micrometers long. Various types of proteins compress the DNA without damaging or tangling it. Scaffold proteins form frameworks that guide DNA strands.  LESSON 8 The Gene: molecular definition a segment of DNA molecule whose sequence of building blocks specifies the sequence of amino acids in a particular protein The protein (or functional RNA) creates the phenotype. Information is conveyed by the sequence of the nucleotides. Malfunctioning or inactive proteins, which reflect genetic defects, can devastate health. Most of the amino acids that assemble into proteins ultimately come from the diet; the body synthesize the others.  LESSON 8 DNA Replication Maintaining Genetic Information  LESSON 8 Replication the process of making new copies of the DNA molecules potential mechanisms: CONSERVATIVE - old/old + new/new SEMICONSERVATIVE - old/new + new/old DISPERSIVE - mixed old and new on each strand  LESSON 8 Test Meselson and Stahl grew E. coli in media with heavy nitrogen and then in media with lighter nitrogen. Nitrogen becomes part of the DNA molecule as replication occurs.  LESSON 8 Meselson and Stahl Experiment Conclusion: Replication is semiconservative.  LESSON 8 Replication as a process (overview) 1. Parent DNA molecule. 2. Parental strands unwinds and separate at several points. The junction of the unwound molecules is a replication fork. 3. Each parental strand provides template that attracts and binds complementary bases, A with T and G with C. A new strand is formed by pairing complementary bases with the old strand. 4. Sugar-phosphate backbones of daughter strands close. 5. Two molecules are made. Each has one new and one old DNA strand.  LESSON 8 Step 1. Unwinding the DNA Enzyme: Helicase Helicase unwinds and separates the two DNA strands, creating a replication fork (a Y-shaped structure) by breaking the hydrogen bonds between the base pairs.  LESSON 8 Step 2. Adding RNA Primers Enzyme: Primase Primase attaches RNA primers to the DNA strands. These primers serve as starting points for DNA synthesis.  LESSON 8 Step 3. Building the New DNA Strands Enzyme: DNA Polymerase (DNAP) DNA polymerase attaches to the RNA primer and starts adding complementary nucleotides (A with T, C with G) to each original strand in the 5’ to 3’ direction. Leading Strand - built continuously toward the replication fork. Lagging Strand - built in small sections called Okazaki fragments away from the fork, as DNA polymerase can only work in the 5’ to 3’ direction.  LESSON 8 Step 4. Replacing RNA Primers Enzyme: DNA Polymerase I The RNA primers are removed, and DNA polymerase I fills the gaps with DNA nucleotides. Step 5. Sealing the DNA Fragments Enzyme: DNA Ligase DNA ligase seals the gaps between Okazaki fragments on the lagging strand, creating a continuous strand.  LESSON 8 Step 6. Proofreading and Finalizing Enzyme: DNA Polymerase (Proofreading Function) DNA polymerase checks and corrects errors to ensure accuracy in the new DNA strands. By proofreading means excising mismatched bases and inserting correct ones, and removes the RNA primer and replaces it with the correct DNA bases.  LESSON 8 Result Two identical DNA molecules -- each with one original strand and one newly synthesized strand (semiconservative model).  LESSON 8 Exercise: Which enzyme..? 1. Seals the gaps between Okazaki fragments on the lagging strand. 2. Adds short RNA primers to the DNA strands to provide a starting point for DNA polymerase. 3. Adds nucleotides to each strand, following base-pairing rules. 4. Unwinds the DNA strands at the origin of replication. 5. Checks and corrects errors to ensure accurate replication. 6. Replaces RNA primers with DNA nucleotides.  LESSON 8 Exercise: Base Pairing Original Strand: ATGCCATGGCTACGTATCGACGTACGGCCTTACTG Complementary Strand:  GENE221 END OF PPT LESSON 8