Lecture7 (cloning DNA) slides.pdf

BIOL 366 Lecture 6. Cloning DNA Lecture objectives. To learn about: - Restriction enzymes - Cloning of DNA fragments in plasmids - Transforming recombinant plasmids into bacterial cells - Different bacterial and eukaryotic vectors Text Section: 7.1. 20.1 Additional reading material on Canvas...

BIOL 366 Lecture 6. Cloning DNA Lecture objectives. To learn about: - Restriction enzymes - Cloning of DNA fragments in plasmids - Transforming recombinant plasmids into bacterial cells - Different bacterial and eukaryotic vectors Text Section: 7.1. 20.1 Additional reading material on Canvas 1 Cloning DNA / Gene - A Clone is an identical copy - Originally described production of identical cells from a single mother cell DNA/gene cloning involves: - Separating a specific gene / DNA fragment from a larger DNA (e.g., a chromosome) - Inserting it to a vector (plasmid/carrier DNA) - Introducing the “construct” into a host cell - Replicating the DNA in the cell Fig 7-1 DNA cloning. 2 Restriction endonucleases (RE) REs recognize specific nucleotide sequences and cut the DNA There are three types: Type I: cut DNA at a random site that is different and away (hundreds of bases) from their recognition site. Recognition site is asymmetrical & contains two portions: one with 3–4 nucleotides, and another with 4–5 nucleotides Type II: - recognition sites are palindromic - recognition sites are 4–8 nucleotides long - cleave DNA within the recognition site - are commonly used in DNA work Type III: - recognize two inversely oriented non-palindromic sequences - cut DNA about 20-30 base pairs after the recognition site Table 7-2 A few RE cleavage sites 3 Some examples of Restriction Endonucleases A AGCTT TTCGA A CAG GTC CTG GAC Some restriction endonucleases produce sticky ends that can base-pair with each other or with the complementary sticky ends. Other restriction endonucleases produce blunt ends. REs most often used in molecular biology are 6 base cutters 4 How often does an RE cut DNA? The RE cutting frequency depends on sequence composition. Assuming that the sequences of a DNA molecule is RANDOM at every position and all four nucleotides are EQUALLY PRESENT cut frequency can be calculated via the equation: Y = 4n, where: Y = The expected number of cuts; n = the # of bases in the recognition site. Therefore: • A 6 bp cutter would cut, on average, once every 46 (4,096) bp. • A 4 bp cutter would cut, on average, once every 44 (256) bp. 5 Cloning DNA / gene: In general the following seven steps are involved including: • Selection of a vector (Fig 7-4) • Selection of appropriate restriction enzymes Text Fig 7-4. A typical plasmid vector (Res) on the target gene and vector • Digestion of the vector and the target gene • Ligation of target gene to the vector • Transformation in bacteria • Selection of transformed cells 6 Step 1. Selecting a cloning vector Cloning vectors: DNA “vehicles” capable of self-replication used for DNA delivery. Most commonly used cloning vectors are modified versions of naturally occurring plasmids (small DNA molecules found in bacteria) or small viral DNA. Main features of cloning vectors: 1. Origin of replication (ori), where replication is initiated (see Chapter 11). 2. Selectable marker (e.g., TetR or AmpR) 3. Screenable marker (e.g., GFP and LacZ) 4. Multiple Cloning Site (MCS): RE sites (PstI, EcoRI, BamHI) for inserting DNA. 5. A relatively small size (4.361 kb). This facilitates its entry into cells and the biochemical manipulation of the DNA. 7 The pUC19 vector is ideal for gene cloning and maintenance. (Image from New England BioLabs Inc.) MCS: Multiple Cloning Site of pUC19 https://www.neb.com/products/n3041-puc19-vector#Product%20Information 8 There are three classes of vectors: i) Housekeeping vectors - pBR322, pUC18/19, etc. ii) Expression vectors - pET and pGEX expression vectors iii) Delivery (transformation) vectors - pCAMBIA (for plant transformation) 9 Step 2: Selecting RE sites on the DNA to be cloned This can be done by: a) Locating existing RE sites on the DNA, and selecting suitable REs. i. The REs in a DNA fragment can be found using various software, for example those available at the website: http://molbiol-tools.ca/ Example: Find Res in the below sequence. GAATTCGCGAGTAATCCAAGTGTTGAAAAATTTTCTTCCTATTCCAACTACTAA AAACATACACGGATCC b) Creating RE sites by other means (e.g., by PCR) 10 Step 3. Digesting the vector and target DNA with same REs. 11 Step 4. Ligation Ligation is catalyzed by enzymes called DNA ligases, which join DNA ends at strand breaks, or nicks. Note: The 5′ terminus must be phosphorylated and the 3′ terminus must have a free OH group. Notes: 1. If one RE is used, self-ligation of vector may take place 2. Sometime target DNA may form a concatemer (see next few slides) 12 Notes: If one RE is used, some issues may arise. Below is the “expected” results (good) DNA ligases 13 Notes: If one RE is used target DNA may form a concatemer. DNA ligases AATTCCNNNNNGGGAATTCCNNNNNGGGAATTCCNNNNNGGG GGNNNNNCCCTTAAGGNNNNNCCCTTAAGGNNNNNCCCTTAA 14 Notes: If one RE is used, self-ligation of vector may take place DNA ligases 15 In class activity (Unmarked): In Fig 7-2, can the chromosomal DNA fragment be cloned in the vector using EcoRI/PvuI RE sites if there is another EcoRI site present in the middle of the fragment? Explain! EcoRI Sub-cloning genes using PCR b) Strategy 2. Make sticky ends using PCR. WHY? - Desired RE might be present in the middle of the gene to be cloned - Suitable RE might not be available at desired locations (e.g., before and after ORF) Reference: Pham et al., 1998. Sticky-end PCR: new method for subcloning. Biotechniques 25:206-8. (https://www.future-science.com/doi/pdf/10.2144/98252bm05) 17 Generating sticky end by using standard PCR - Two pairs of PCR primers are designed - The target gene is amplified two times, in two separate reactions - PCR products are purified/cleaned (what does this mean?) - The two PCR products are mixed in equimolar ratio - PCR products are then denatured (95 oC) and re-natured (65 oC) - ~25% of the renatured products carry the desired RE site Reference: Pham et al., 1998. Sticky-end PCR: new method for subcloning. Biotechniques 25:206-8. (https://www.future-science.com/doi/pdf/10.2144/98252bm05) 18 Generating sticky end by using standard PCR BamHI: G/GATCC BglII: A/GATCT Reference: Pham et al., 1998. Sticky-end PCR: new method for subcloning. Biotechniques 25:206-8. (https://www.future-science.com/doi/pdf/10.2144/98252bm05) 19 G AATTC CTTAA G Create EcoRI site at the 5’ end of a DNA fragment. Same gene amplified in two reactions with 2 sets of primers C AATTC TTAAG Amplify by PCR (~30 cycle) C G AATTC C TTAAG G Single stranded Denature (95 oC) Mix both reactions & allow to anneal(65 oC) • You get four products (25% each). • One product has the right ends for EcoRI. C TTAAG AATTC G AATTC TTAAG C G 20 What happens after ligation??? Step 5. Transferring the recombinant DNA into a host organism (transforming the host organism). The host organism provides the enzymatic machinery for DNA replication and maintenance. Transformation can be done by: - Heat shock method - Electroporation - Conjugation, etc. - Biolistics (Gene Gun) The Helios Gene Gun System (BioRAd) The Gene Pulser system (BioRad) 22 Step 6. Identifying host cells harboring the vector; selectable and screenable markers. Selectable markers: The cloning vectors generally encode for “resistance genes” that allows selection of “transformed” cells. These markers are selectable markers. Text definition: A selectable marker is a gene introduced into a cell that either permits the growth of the cell or kills it under a defined set of conditions. - Common antibiotics used are ampicillin, kanamycin, and tetracycline. - Cells containing the vector become resistant to, and can survive the corresponding antibiotic. - Cells lacking the resistance gene do not grow in the presence of the antibiotic. 23 Step 6, continued: Screenable Markers. A screenable marker is a gene encoding a protein that causes a visible change in cell appearance, such as producing a color or making the cell fluoresce. Cells are not harmed whether the gene is present or not. The cells that carry the recombinant plasmid are easily identified by the colored or fluorescent colonies they produce. The LacZ gene as a screenable marker. When LacZ gene is intact it allows production of βGalactosidase in bacteria harboring pUC vectors. When LacZ gene is disrupted by a DNA fragment, it will not produce a functional LacZ protein. Thus bacteria harboring pUC with a disrupted LacZ gene stay white. 24 Step 6, continued • Following cloning, researchers often have to screen transformants for those with vectors that actually took in the DNA of interest. Sometimes the DNA is not inserted due to: i. Contamination with the undigested vector ii. Vector re-ligating to itself. The blue-white selection technology allows selecting for bacteria that harbor the vector WITH insert. • Bacteria harboring pUC vector containing (WITH) the insert DNA remain white in the presence of 5-bromo-4chloro-3-indolyl-β-D-galactopyranoside (X-Gal) • Bacteria harboring the empty pUC vector (i.e., WITHOUT the insert DNA) turn blue in the presence of X-Gal. How? See next two slides. 25 Step 6, continued Blue-white selection using pUC vectors Fig 20-6 Chemical structures of isopropyl 5-bromo-4-chloro-3-indolyl-βD-galactopyranoside (X-Gal ). β-Galactosidase cleaves X-gal to produce galactose and 5-bromo-4-chloro-3-hydroxyindole, which dimerizes and is oxidized to an insoluble blue compound, 5,5′-dibromo-4,4′-dichloro-indigo. This is an insoluble blue compound Bacterial colonies grown on agar plates containing X-gal and an inducer of βgalactosidase (usually IPTG) turn blue when they harbor a functional lacZ gene. 26 Step 7. Ensuring host cells harbor the recombinant DNA. To ensure cells carry the correct vector - grow resistant cells on antibiotic - extract plasmid from cells - digest the plasmid with RE - run digested DNA on a gel and look for the cloned gene by size - follow up with sequencing (if needed) Question: Are there other ways of identifying cells harboring the correct vector??? 27 2. Load each of your DNA samples on a separate lane 3. Load a DNA marker (a mix of DNA segments of knows sizes) on one lane 4. Subject the gel to electrophoresis at 50 – 100 volts for two hours 5. Stain and visualize DNA DNA marker Prepare a 0.8 – 1.2 % agarose gel Sample DNA 3 1. Sample DNA 2 Note: DNA fragments of the same size migrate on agarose gels at the same velocity when placed in an electric field. Sample DNA 1 Determining the size of a DNA fragment. 28