DNA Repair, PCR, & DNA Sequencing Lecture Notes PDF

DNA Repair, PCR, & DNA Sequencing Section 5.2; Section 3.3 Learning Objectives Compare and contrast the different types of excision repair Explain why many types of cancer exhibit defects in DNA repair mechanisms Summarize the mechanisms cells use to repair double-strand breaks...

DNA Repair, PCR, & DNA Sequencing Section 5.2; Section 3.3 Learning Objectives Compare and contrast the different types of excision repair Explain why many types of cancer exhibit defects in DNA repair mechanisms Summarize the mechanisms cells use to repair double-strand breaks From Section 3.3 Describe how DNA is sequenced with dideoxynucleosides Predict the sizes of DNA fragments cleaved by restriction endonucleases with a known recognition sites Summarize how a fragment of host DNA is cloned in a plasmid vector DNA Repair Key Concepts Most types of DNA damage are repaired by excision of the damaged DNA. The resulting gap is filled in by newly synthesized DNA using the undamaged, complimentary strand as a template. Mismatch repair specifically removes mismatched bases from newly synthesized DNA. Mutations in genes that code for proteins involved in DNA repair are frequently found in cancer cells. Double strand breaks can be repaired by the error-prone mechanism of NHEJ or by the more accurate HDR that uses undamaged homologous DNA as a template. DNA is easily damaged by the environment DNA can be damaged in a variety of ways Cells possess a variety of excision mechanisms for repairing DNA – Same basic steps: _____________________ by ____________________ Resynthesis by a repair DNA polymerase uses __________________ as template Sealing the backbone with ________________ – Different functions! – Different mechanisms! Base-excision repair corrects _____________ damaged bases Nucleotide-excision repair corrects damage that _____________________ Mismatch repair corrects ___________________ bases Double-strand break repair mechanism 1: nonhomologous end joining Double-strand break repair mechanism 2: homologous recombination  Note Check Which of these correctly pairs a DNA repair mechanism with a problem that it would be used to fix? a) Nonhomologous end joining repair – base mismatches b) Mismatch repair – double stranded break c) Base-excision repair – a long stretch of damaged bases distorting the DNA d) Nucleotide-excision repair – a thymine dimer NOTE CHECK Join.nearpod.com pin = Molecular Cloning & DNA Sequencing Key Concepts Restriction endonucleases cleave specific DNA sequences, yielding defined fragments of DNA molecules. DNA fragments can be ligated into a plasmid vector that is able to be replicated in an appropriate host cell and isolated as molecular clones. The nucleotide sequences of cloned DNA fragments can be readily determined using Sanger sequencing (or other sequencing techniques). What is molecular cloning and why is it useful? Molecular cloning is the set of experimental techniques used to generate a population of organisms carrying the same molecule of recombinant DNA. 4 main steps in experimental process DNA sequencing Characterize and study function of genes Characterize and study function of genomic regulatory regions Production of transgenic animal models of human diseases Production of recombinant proteins Transgenic plants and animals for agricultural, pharmaceutical, and nutritional enhancements Gene therapy delivery Molecular Cloning Overview 1) Digest DNA with restriction endonucleases 2) Ligate DNA fragments into plasmid vectors 3) Transform E. coli with recombinant DNA plasmids 4) Select and characterize recombinant clones. Restriction Endonucleases Enzyme a Source Recognition site Enzymes that cleave DNA at BamHI Bacillus 5′-G⏷GATCC-3′ _______________________ amyloliquefaciens H 3′-CCTAG⏶G-5′ of four to eight base pairs. EcoRI Escherichia coli 5′-G⏷AATTC-3′ RY13 3′-CTTAA⏶G-5′ HaeIII Haemophilus 5′-GG⏷CC-3′ May result in __________ or aegyptius 3′-CC⏶GG-5′ __________ ends. HpaII Haemophilus 5′-C⏷CGG-3′ parainfluenzae 3′-GGC⏶C-5′ NotI Nocardia otitidis- 5′-GC⏷GGCCGC-3′ First identified in bacteria caviarum 3′-CGCCGG⏶CG-5′ Natural function:  5′-G⏷AATTC-3′ EcoRI digestion and gel electrophoresis of DNA 3′-CTTAA⏶G-5′ The cut site for BamHI is shown below. NOTE CHECK 5′-G⏷GATCC-3′ 3′-CCTAG⏶G-5′ Join.nearpod.com pin = Based on this information, how many DNA fragments would result when the double-stranded DNA shown below is digested by BamHI. 5’ CTCGGATCCTCTTGGCGGATCCAGG 3’ 3’ GAGCCTAGGAGAACCGCCTAGGTCC 5’ The cut site for BamHI is shown below. NOTE CHECK 5′-G⏷GATCC-3′ 3′-CCTAG⏶G-5′ Join.nearpod.com pin = Would you expect the BamHI digested fragments to have blunt ends or sticky ends? 5’ CTCGGATCCTCTTGGCGGATCCAGG 3’ 3’ GAGCCTAGGAGAACCGCCTAGGTCC 5’ The cut site for BamHI is shown below. NOTE CHECK 5′-G⏷GATCC-3′ 3′-CCTAG⏶G-5′ Join.nearpod.com pin = Draw the ___ DNA fragments that result from BamHI digestion of this piece of DNA. 5’ CTCGGATCCTCTTGGCGGATCCAGG 3’ 3’ GAGCCTAGGAGAACCGCCTAGGTCC 5’ Plasmid Vectors Molecular Cloning – Step 1 Digest DNA with restriction endonucleases Digest genome of interest Digest plasmid vector Molecular Cloning – Step 2 Step 2 - Ligate genome fragments into plasmid vectors + Molecular Cloning – Step 3 Step 3 - Transform E. coli with recombinant DNA plasmids Molecular Cloning – Step 4 Step 4 - Select and characterize recombinant clones. DNA Sequencing Sanger Sequencing Based on DNA replication mechanisms and the in vitro replication technique PCR (polymerase chain reaction). Required components DNA polymerase RNA primer DNA template dNTPs (dATP, dTTP, dGTP, dCTP) Dideoxynucleotides (ddNTPs) Each labeled with a different colored fluorescent marker Sanger Sequencing – DNA fragments after 3 rounds of PCR 5’- ACTGCGA –3’ 5’- ACTGCGAACA –3’ 5’- AC –3’ 5’- ACTGCGAACAG –3’ 5’- ACTGCGAAC –3’ 5’- ACTGCG –3’ 5’- ACT –3’ 5’- ACT –3’ 5’- AC –3’ 5’- ACAGCG –3’ 5’- A –3’ 5’- ACTG –3’ 5’- ACTGCGAACAGT –3’ 5’- ACTGC –3’ 5’- ACTGCGA –3’ 5’- ACTG –3’ 5’- ACTGCGAACAG –3’ 5’- AGTGC –3’ Sanger Sequencing