Lecture 2: Enzyme PDF

CH3104 Biochemical Engineering PART2 Lecture 2: Enzyme Asst. Prof. CHEN Lin 1 Outline Introduction Activation mode Applications Kinetics Engineering 2 3 4 Rate Law (General Chemical Reactions) Scope: The rate law applies to any chemi...

CH3104 Biochemical Engineering PART2 Lecture 2: Enzyme Asst. Prof. CHEN Lin 1 Outline Introduction Activation mode Applications Kinetics Engineering 2 3 4 Rate Law (General Chemical Reactions) Scope: The rate law applies to any chemical reaction, not just those involving enzymes. Definition: The rate law expresses the rate of a reaction as a function of the concentration of reactants and the rate constant. It is derived empirically, meaning it is based on experimental data, and its form depends on the reaction mechanism. Order of Reaction: The rate law can describe reactions of various orders (e.g., first-order, second-order, or mixed-order reactions). Key Focus: The rate law focuses on how the concentration of reactants influences the speed of a chemical reaction. It does not generally consider complex mechanisms or intermediates. 5 6 7  Enzyme Kinetics Enzyme kinetics – quantitative measurement of the rates of enzyme catalyzed reactions & the systematic study of factors that affect these rates Enzyme kinetics began in 1902 when Adrina Brown reported an investigation of the rate of hydrolysis of sucrose as catalyzed by the yeast enzyme inveratase. Brown demonstrated – when sucrose concentration is much higher than that of the enzyme, reaction rate becomes independent of sucrose concentration 8 Scope: Enzyme kinetics specifically deals with reactions catalyzed by enzymes, which are biological catalysts that increase the rate of biochemical reactions. Mechanism: Enzyme kinetics involves the study of the rates of reactions where an enzyme (E) binds to a substrate (S) to form an enzyme-substrate complex (ES), which then converts into a product (P) while regenerating the enzyme. 𝐸 + 𝑆 ⇋ 𝐸𝑆 ՜ 𝑃 + 𝐸 Key Focus: The focus in enzyme kinetics is on understanding how enzymes accelerate reactions, how substrate concentration influences the rate of reaction, and how to model the catalytic efficiency of enzymes. This includes terms like Km​, Vmax, and the catalytic constant kcat. 9  Question Time The rate of unimolecular reaction is proportional to the concentration of the reactant. Thus rate is linearly dependent on reactant. But if this reaction is catalyzed by an enzyme, the rate shows saturation behavior. Why? 10 Enzyme-catalyzed reactions show a hyperbolic dependence of V on [S] 1. At very low [S]: V is proportional to [S]; doubling [S] → double V. 2. In mid-range of [S], V is increasing less as [S] increases (where V is around 1/2 Vmax). Km = [S] that gives V = 1/2 Vmax. 3. At very high [S], V is independent of [S]: V = Vmax. 11 12  Michealis-Menten Analysis Michaelis–Menten kinetics is one of the simplest and best-known models of enzyme kinetics. The model serves to explain how an enzyme can cause kinetic rate enhancement of a reaction and why the rate of a reaction depends on the concentration of substrate present. It co-relates velocity with enzyme and substrate concentration. 13 Enzyme Kinetics Overall reaction is composed of two elementary reactions in which the substrate forms a complex with the enzyme that subsequently decomposes to products and enzymes. 𝑘1 𝑘2 𝐸 + 𝑆 ⇋ 𝐸𝑆 ՜ 𝑃 + 𝐸 𝑘−1 Here E, S, ES and P symbolize the enzyme, substrate, enzyme-substrate complex and products Rate Constant Reaction The binding of the enzyme to the substrate forming the enzyme substrate 𝑘1 complex. The dissociation of the enzyme-substrate complex to free enzyme and 𝑘−1 substrate. Catalytic rate; the catalysis reaction producing the final reaction product and 𝑘2 regenerating the free enzyme. This is the rate limiting step. The table below defines each of the rate constants in the above scheme. 14 Enzyme Kinetics According to this model ❖ When the substrate concentration becomes high enough to entirely convert the enzyme to the ES form, the second step of the reaction becomes rate limiting step. ❖ The overall reaction rate becomes insensitive to further increase in substrate concentration. The general expression of the velocity (rate) of this reaction is 𝑑𝑃 𝑣= = 𝑘2 𝐸𝑆 𝑑𝑡 15  Enzyme Kinetics The overall rate of production of [ES] – Difference between the rates of elementary reactions leading to its appearance and those resulting in its disappearance. 𝑘1 𝑘2 𝑑 𝐸𝑆 𝐸 + 𝑆 ⇋ 𝐸𝑆 ՜ 𝑃 + 𝐸 = 𝑘1 𝐸 𝑆 − 𝑘−1 𝐸𝑆 - 𝑘2 𝐸𝑆 𝑘−1 𝑑𝑡 At this point, an assumption is required to achieve an analytical solution. The rapid equilibrium assumption The quasi-steady-state assumption. 16 Rapid Equilibrium Approach Assumes a rapid equilibrium between the enzyme and substrate to form an 𝐸𝑆 complex. 𝑘1 𝐸 + 𝑆 ⇋ 𝐸𝑆 𝑘−1 𝑘1 𝐸 𝑆 = 𝑘−1 𝐸𝑆 The equilibrium constant 𝐾𝑚 can be expressed by the following equation in a dilute system. 𝑘−1 𝐸 𝑆 𝐾𝑚 = = 𝑘1 𝐸𝑆 17 Rapid Equilibrium Approach Since the enzyme is not consumed, the conservation equation on the enzyme yields 𝐸 = 𝐸0 − 𝐸𝑆 Then rearrange the equilibrium constant equation k −1 [ E ][ S ] 𝐸 𝑆 Km = = 𝐸𝑆 = k1 [ ES ] 𝐾𝑚 Substituting 𝐸 in the above equation with enzyme mass conservation equation ( 𝐸0 − 𝐸𝑆 ) 𝑆 𝐸𝑆 = 𝐾𝑚 18 Rapid Equilibrium Approach ( 𝐸0 − 𝐸𝑆 ) 𝑆 𝐸𝑆 = 𝐾𝑚 𝐸𝑆 𝐾𝑚 = 𝐸0 𝑆 − 𝐸𝑆 𝑆 𝐸𝑆 𝐾𝑚 + 𝐸𝑆 𝑆 = 𝐸0 𝑆 𝐸𝑆 (𝐾𝑚 + 𝑆 ) = 𝐸0 𝑆 𝐸0 𝑆 𝐸𝑆 = 𝐾𝑚 + 𝑆 19 Rapid Equilibrium Approach Then the rate of production formation v can be expressed in terms of 𝑆 , d [ P] k 2 [ E0 ][ S ] Vmax [ S ] v= = k 2 [ ES ] = = dt Km + [ S ] Km + [ S ] where 𝑉𝑚𝑎𝑥 = 𝑘2 𝐸0 = 𝑘2 𝐸𝑆 under saturation 20 Quasi-Steady-State Assumption (SSA) Except the transition phase of the reaction (before shaded block), 𝐸𝑆 remains constant until the substrate is nearly exhausted. Hence synthesis of 𝐸𝑆 must equal to its consumption over the course of reaction i.e. 𝐸𝑆 maintain steady state Progress curve for the components of a simple MM reaction 21 SSA and Rate Equation 𝑘1 𝑘2 𝐸 + 𝑆 ⇋ 𝐸𝑆 ՜ 𝑃 + 𝐸 𝑘−1 Now: Base on steady state assumption, d[ES]/dt = 0 d[ES]/dt = k1[E][S] –k-1[ES] – k2[ES] = 0 (steady state assumption) solve for [ES] (do some algebra) [ES] = [E][S] k1/(k-1 + k2) Define KM (Michealis Constant) KM = (k-1 + k2)/k1 => [ES] = [E][S]/KM rearrange to give KM = [E][S]/[ES] 22 SSA and Rate Equation Substitute 𝐸 = 𝐸0 − 𝐸𝑆 in 𝐾𝑀 = 𝐸 𝑆 / 𝐸𝑆 ([ E 0 ] − [ ES ])[ S ] Km = [ ES ] Km[ ES ] = ([ E0 ] − [ ES ])[ S ]; [ ES ]Km == [ E0 ][ S ] − [ ES ][ S ] [ ES ]Km + [ ES ][ S ] == [ E0 ][ S ] [ ES ]( Km + [ S ]) == [ E0 ][ S ] [ E0 ][ S ] [ ES ] == Km + [ S ] 23 SSA lead to Michaelis - Menten Then the rate of production formation v can be expressed in terms of [S] d [ P] k 2 [ E0 ][ S ] Vmax [ S ] v= = k 2 [ ES ] = = dt Km + [ S ] Km + [ S ] where Vmax = k 2 [ E0 ] Michaelis Menten Equation Vmax [ S ] v= Km + [ S ] 24 Michaelis Menten Equation It is a statement of the quantitative relationship between the initial velocity v, the maximum velocity Vmax, and the substrate concentration 𝑆 , all related through the Michaelis constant 𝐾𝑚 𝑉𝑚𝑎𝑥 𝑆 𝑣= 𝐾𝑚 + 𝑆 Numerical relationship emerges from the Michaelis-Menten equation in the special case when v is exactly one-half of 𝑉𝑚𝑎𝑥 𝑉𝑚𝑎𝑥 𝑉𝑚𝑎𝑥 𝑆 = 2 𝐾m + 𝑆 1 𝑆 On dividing by 𝑉𝑚𝑎𝑥 we obtained = 2 𝐾m + 𝑆 Solving for 𝐾𝑚 , we get 𝐾𝑚 + 𝑆 = 2 𝑆 1 𝐾𝑚 = 𝑆 when V = 𝑉 2 𝑚𝑎𝑥 25 The Michaelis-Menten approach is widely used in enzyme kinetics to calculate two critical parameters: Km (the Michaelis constant) and kcat (the turnover number). Understanding these parameters is essential for characterizing enzyme activity and efficiency. Definitions Km​: This constant represents the substrate concentration at which the reaction velocity is half of the maximum velocity (Vmax​). It provides insight into the affinity of the enzyme for its substrate; a lower Km indicates higher affinity. 𝑉𝑚𝑎𝑥 𝑆 𝑣= 𝐾𝑚 + 𝑆 26  Turnover number (kcat) Number of substrate molecules converted into product by one molecule of enzyme active site per unit time, when enzyme is fully saturated with substrate. It is calculated using the formula: 𝑉𝑚𝑎𝑥 𝑘𝑐𝑎𝑡 = 𝐸0 units of kcat is s–1 Lysozyme: kcat = 0.5 s–1 Catalase: kcat = 4 x 107 s–1 Catalytic Efficiency = kcat/Km is the criterion of substrate specificity, catalytic efficiency and "kinetic perfection”. 27 Step-by-Step Process 1.Data Collection: Measure the reaction velocities (v) at various substrate concentrations ([S]). 2.Plotting Data: Create a plot of reaction velocity (v) versus substrate concentration ([S]). The resulting curve typically exhibits a hyperbolic shape. 3.Fitting the Michaelis-Menten Equation: Fit the collected data to the Michaelis-Menten equation: 𝑉𝑚𝑎𝑥 𝑆 𝑣= 𝐾𝑚 + 𝑆 Using nonlinear regression techniques can help extract values for both Vmax and Km from this fit. 𝑉𝑚𝑎𝑥 Calculating kcat​: Once you have determined Vmax​, calculate the turnover number using 𝑘𝑐𝑎𝑡 = 𝐸0 28  Significance of MM equation It describes kinetic behaviors of enzymes different enzymes have different Km and Vmax. Km can be used as a relative measure of the affinity of the enzyme for each substrate (smaller Km means higher affinity) in a metabolic pathways, Km values may indicate the rate-limiting step (highest Km means slowest step). Vmax is independent of [S] at saturation. 29 Factors effecting enzyme reaction rate ✓The important factors that influence the enzyme reaction are: Concentration of Substrate The frequency with which molecules collide is directly proportionate to their concentrations Concentration of Enzyme Reaction velocity is directly proportional to concentration of enzyme 30  Temperature Velocity of an enzyme reaction increase with the increase in temperature up to a maximum and then declines Increase in temperature causes increases the kinetic energy of molecules Temperature coefficient Q10 : changes in enzyme velocity when the temperature is increased by 10 ℃ Optimum temperature for most of enzyme: 35 – 40 ℃ Beyond 45-50 ℃ there is denaturation of enzyme 31  pH Most enzymes exhibit optimal activity at pH values between 6–8. Balance between enzyme denaturation at high or low pH and effects on the charged state of the enzyme, the substrates, or both Exception: pepsin (1–2), acid phosphatase (4–5), alkaline phosphatase (10–11) 32  Activators Certain metallica cations – Mn, Mg, Zn, Ca, Co, Cu, Na, K. There are 2 categories of enzyme requiring metals for their activity Metal activated enzyme: Not tightly held by the enzyme and can be exchanged easily. Ex: ATPAase (Mg and Ca) and Enolase Metalloenzyme: Hold the metal tightly. Ex: alcohol dehydrogenase, carbonic anhydrase, alkaline phosphatase, carboxypeptidase 33  Other Factors Product concentration: Accumulation of reaction products generally decreases the enzyme velocity Light and radiation: exposure to UV, beta-gamma and X-rays inactivates certain enzyme Formation of peroxides, ex: UV rays inhibit salivary amylase activity 34  Enzyme Regulation Regulation of enzyme occurs in following ways Allosteric regulation Activation of Latent Enzyme Compartmentation Control of enzyme synthesis Enzyme Degradation Isoenzyme 35  Allosteric regulation Additional sites other than active sites – Allosteric enzymes Types of allosteric enzyme: K-class: effectors changes Km V-class: effectors changes Vmax Most of allosteric enzymes are oligomeric in nature Binding of effector molecule at the allosteric sites – conformational change in the active site of enzyme 36  Activation of Latent Enzyme Some enzymes remain inactive, they get activated at the site of action by the breakdown of one or more peptide bonds Ex: chymotrypsin, pepsinogen and plasminogen Certain enzymes keeps interconverting from active to inactive and vice-versa depending on the need Ex: Glycogen phosphorylase, Phosphorylase b 37  Compartmentation The enzyme remains confined to particular area of cell/body which makes it exclusive For instance: fatty acid synthesis takes place in cytosol whereas fatty acid oxidation takes in mitochondria Organelle Enzyme/metabolic pathway Cytoplasm Aminotransferase, peptidases, glycolysis, HMP shunt Mitochondria Fatty acid oxidation, Kreb’s Cycle, Urea Cycle, ETC Nucleus Biosynthesis of DNA and RNA Endoplasmic Reticulum Protein Biosynthesis, Triacylglycrol and phospholipid synthesis Lysosomes Lysozyme, phosphatases, phospholipases, hydrolases, proteases Golgi Appartus Glucos-6 phosphatease, glucosyl and galactosyl transferase Peroxisomes Catalases, Urea oxidase, D-amino acid oxidase 38  Enzyme Degradation Enzymes have their self-destructing capabilities. But it is highly variable and in general The key and regulatory enzyme are most rapidly degraded Not so important enzyme have longer half life Ex: LDH4 – 5-6 days, LDH1 – 8-12 hrs, amylase – 3-5 hrs 39  Isoenzyme When same reaction is catalyzed by two or more different molecular forms of an enzyme, it is called isoenzyme It may occur in the same species, in the same tissue, or even in the same cell. The different forms of the enzyme generally differ in kinetic or regulatory properties Ex: hexokinase – 4, lactate dehydrogenase (LDH) – 5, creatinine phosphate (CPK) – 3 , creatinine kinase (CK) – 3, alkaline phosphate (ALP) – 6, alcohol dehydrogenase (ADH) – 2 40  Enzyme engineering The process of improving the efficiency of an already available enzyme or the formulation of an advanced enzyme activity by altering its amino acid sequence through the genetic engineering techniques. 41 Application/objective of enzyme engineering 42 Strategies for enzyme engineering 43 44  Site-directed mutagenesis Alteration of gene sequence to modify properties of gene product (protein/enzyme) Amino acid replacement Change codon nucleotides to give different amino acid Deletion mutant Delete an amino acid by removing triplet codon Addition mutant Insert new amino acid by adding triplet codon 45  Enzyme engineering by site-directed mutagenesis Enhance protein thermostability Usually by inserting new intramolecular interactions such as covalent disulphide (S-S) bonds or non-covalent salt bridges. Reduce oxidation sensitivity By deletion/replacement of oxidation sensitive amino acid residues (e.g., cysteine) Alter enzyme substrate specificity By altering the size and shape of the active site (e.g., by removing bulky side chains) Increase catalytic activity By changing the environment of the active site (by random mutagenesis and selection) 46  Examples of simple mutations by site-directed mutagenesis mRNA codon Amino acid Mutated codon New amino acid Type of mutation/Result of mutation GCU Alanine GCC Alanine Degenerate codons/no change GCU Alanine GAU Aspartic acid Amino acid change/addition of charged group Insertion of cysteine (e.g., for S-S bond UCA Serine UGU Cysteine formation) UUG Leucine GGG Glycine Removal of bulky side chain GAU Aspartic acid GAA Glutamic acid Change side chain size with retention of charge 47  The characterization of fructose-1,6-bisphosphatase (FBP) from mung bean Substrate: F16BP Inhibitor: F26BP; AMP The enzyme fructose bisphosphatase (EC 3.1.3.11; systematic name D-fructose-1,6-bisphosphate 1-phosphohydrolase) catalyzes the conversion of fructose-1,6-bisphosphate to fructose 6-phosphate in gluconeogenesis and the Calvin cycle, which are both anabolic pathways. 48  bp 2000 PCR Recombinant (High fidelity Polymerase) 1000 Ligation plasmid TA cloning of VrFBP A-tailing mung bean cDNA library Sequencing and verification Predicted size: 1023 bp Recombinant plasmid: Enzyme digestion T4 ligase PET32-FBP Plasmid construction Gene fragment Recombinant plasmid Expression Vector DMT cell PCR Site-directed Dpn I digestion mutagenesis Mutation PET32-FBP Methylated plasmid primers Ion exchange chromatography & gel-filtration column Double Transformation Induction Protein expression digestion (IPTG) PET32-FBP Crude protein extract Purified protein PET32-FBP-BL21(DE3) (Chen, et al., 2019) 49  TA cloning of VrFBP gene bp 2000 cDNA library from mung bean (Vigna radiata) mRNA PCR 1000 (HF Pfu DNA Polymerase) A 5' 3' 3' 5' A-tailing A DNA strands Specific Primer (5' → 3') F: ATGGATCACAGTGCGGATGC R: TTCCAATTTTTGATCAGCAG Predicted size: 1023 bp Ligation Gene fragment A A Recombinant plasmid T4 ligase T Blue-white pGEM®-T selection Transformation T Sequencing and verification Vector Competent cell (DH5α) 50  α Helix β sheet AMP binding site Metal binding site Active site Vr-cFBPase: 341 aa, 8 helices and 16 β-strands. Substrate (F16BP) and AMP binding domains. 51 Expression plasmid construction Recombinant plasmid PCR (HF Pfu DNA Polymerase) 5' 3' 3' 5' Specific Primer (5' → 3') DNA strands F+Nde I: GGGAATTCCATATGGATCACAGTGCGGATGC R+BamH I: CGCGGATCCTCATTCCAATTTTTGATCAGCAG Nde I BamH I Protective base Restriction site Sticky ends Nde I Gene fragment pET-32a(+) 5' GGGAATTCCA TATG 3' 5900 bp 3' CCCTTAAGGTAT AC 5' Restriction enzyme Expression vector BamH I Vector 5' CGCG GATCC 3' 3' GCGCCTAG G 5' T4 ligase Recombinant plasmid: PET32-FBP 52 Site-directed mutagenesis PET32-FBP Nde I + FBP Transformation Mutation PET32-FBP-DMT Methylated plasmid primers PCR Alanine PET32-FBP Template …GCAGCTGCC… Primer …CGTCTACGG… PCR Purified protein PCR Aspartic acid Mutated Product …GCAGATGCC… PET32-FBP plasmid plasmid …CGTCTACGG… Purification Dpn I digestion Transformation Nde I + FBP Nde I + FBP Mutated-FBP- Mutated-FBP-DH5α BL21(DE3) 53 Protein expression bp Transformation Resistance screening 2000 Recombinant plasmid: 1000 PET32-FBP Colony PCR PET32-FBP-DH5α Enzyme digestion Predicted size: 1248 bp Sequencing Nde I + Supercoil Nde I BamH I BamH I Plasmid: bp PET32-FBP 8000 6000 Transformation Crude protein extract Nde I + FBP PET32-FBP-BL21(DE3) Ion exchange chromatography Expression induction & gel-filtration column (IPTG) Purified protein 54 Protein expression M: marker U: uninduced I: induced WT: wild-type 55  Michaelis-Menton constant (Km): 7.96 μM Turnover number (Kcat): 8.65 s-1 Catalytic Efficiency (Kcat/Km): 1.09 μM s-1 AMP inhibitory constant (Ki): 111.09 μM Metal ion requirement, temperature sensitive. 56  M251L WT D32E/F33L M251L; D32E/F33L: Binding energy Substrate affinity and activity Molecular distance 57  Asp32 plays a key role in maintaining the AMP binding conformation D32E Binding energy -1.03 kcal⋅mol-1 0.28 kcal⋅mol-1 Molecular distance 5.1 Å 8.0 Å WT R30T/D32E/F33L 58  The Vr-cFBPase exhibited metal ion requirement, and thermal instability. The replacement of Met251 by Leu improved the substrate affinity and activity. Asp32 plays a key role in maintaining the AMP binding conformation 59  Enzyme immobilization Enzymes are most extensively used in the food and beverage industries across the world to meet the increasing demand for nutritionally superb and high-value products. However, the predominant use of the enzymes has been limited by the fact that large number of these enzymes are unstable and the cost of isolation, purification and recovery of the active enzyme is high. In actual practice, the soluble enzymes engaged in batch operations is found to be uneconomical as the active enzyme is virtually lost (not recovered) after each viable reaction. Therefore, in order to overcome such non-productive, economically not feasible, and deleterious effects the enzymes have been ultimately immobilized and this process is termed as enzyme immobilization. 60 "Enzyme immobilization may be defined as confining the enzyme molecules to a distinct phase from the one where in the substrate and product are present.” An immobilized enzyme is an enzyme that is attached to an inert, insoluble material such as calcium alginate (produced by reacting a mixture of sodium alginate solution and enzyme solution with calcium chloride). This can provide increased resistance to changes in conditions such as pH, temperature and several environmental factors. It also allows enzymes to be held in place throughout the reaction, following which they are easily separated from the products and may be used again a far more efficient process and so is widely used in industry for enzyme catalyzed reactions. 61  Methods of immobilization 1. Carrier binding Physical adsorption Covalent bonding Ionic bonding 2. Cross linking 3. Entrapment Occlusion within a cross-linked gel Microencapsulation 62  Physical absorption This method is based on the physical adsorption of enzyme on the surface of water- insoluble carriers. Examples of suitable adsorbents are ion-exchange matrices, porous carbon, clay, hydrous metal oxides, glasses and polymeric aromatic resins. The bond between the enzyme and carrier molecule may be ionic, hydrogen, Van der Waals Forces or combination of any of these. Immobilization can be brought about by coupling an enzyme either to external or internal surface of the carrier. Advantages of adsorption: ❖ Little or no confirmation change of the enzyme. ❖ Simple and cheap. ❖ No reagents are required. ❖ Wide applicability and capable of high enzyme loading. Disadvantages of adsorption: ❖ Desorption resulting from changes in temperature, pH, and ionic strength. ❖ Slow method. 63  Covalent bonding Covalent binding is the most widely used method for immobilizing enzymes. The covalent bond between enzyme and a support matrix forms a stable complex. The functional group present on enzyme, through which a covalent bond with support could be established, should be non-essential for enzymatic activity. The most common technique is to activate a cellulose-based support with cyanogen bromide, which is then mixed with the enzyme. Cellulose-OH + CNBr → Cellulose-OCN Cellulose-OCN+Enzyme-NH2​ →Cellulose-OC-NH-Enzyme Advantages of covalent coupling: ❖ Strength of binding is very strong, little or no leakage from the support Disadvantages of covalent coupling: ❖ Enzymes are chemically modified and can denatured during immobilization 64  Cross linking This method is based on the formation of covalent bonds between the enzyme molecules, by means of multifunctional reagents, leading to three dimensional cross linked aggregates. The most common reagent used for cross-linking is glutaraldehyde. Advantages of cross linking: o Very little desorption (enzyme strongly bound) Disadvantages of cross linking: o May cause significant changes in the active site enzyme 65  Entrapment In entrapment, the enzymes or cells are not directly attached to the support surface, but simply trapped inside the polymer matrix. Entrapment is carried out by mixing the biocatalyst into a monomer solution, followed by polymerization initiated by a change in temperature or by a chemical reaction. Advantages of entrapment: ❖ Loss of enzyme activity upon immobilization is minimized. Disadvantages of entrapment: ❖ Substrate cannot diffuse deep into the gel matrix. 66  Table 1. Comparison between main enzyme immobilization methods Binding Enzyme Running Matrix Method Preparation Cost Force Leakage Problems Effect Physical Simple Low Weak High Moderate Variable Adsorption Covalent Complex Medium Strong Low Low Minimal Binding Cross- Moderate Medium Strong Low Low Moderate linking Entrapment Moderate Medium Physical Low High Variable 67  Advantages of immobilization Multiple or repetitive use of a single batch of enzymes Immobilized enzymes can be more stable Ability to stop the reaction rapidly by removing the enzyme from the reaction solution Easy separation of the enzyme from the product Increased functional efficiency of the enzyme Minimum reaction time and cost effective Less labor input in the process 68  Disadvantages of immobilization It may invariably affect the stability and catalytic activity of enzymes. Certain immobilization protocols offer serious problems with respect to the diffusion of the substrate to have access to the enzyme. Enzymes are inactivated by the heat generated in the system. Some enzymes became unstable after immobilization. 69  Applications of immobilization 1. Biomedical applications: Immobilized enzymes are widely used for diagnosis and treatment of many diseases such as inborn disorder. 2. Food industry: Enzymes like pectinases and cellulases immobilized on suitable carriers are successfully used in the production of jams, jellys and syrups from fruits and vegetables. 3. Research: The use of immobilized enzyme allow researcher to increase the efficiency of different enzymes such as different proteases for cell and organelle lysis. 5. Biodiesel production from vegetable oils. 6. Textile industry: Scouring, bio polishing and desizing of fabrics. 7. Wastewater management: Treatment of sewage and industrial effluents. 8. Detergent industry: Immobilization of lipase enzyme for effective dirt removal from cloths. 70 Key Takeaways Enzyme kinetics: MM equation Enzyme engineering 71