Lecture 2- Final- Genetic Variation, Polymorphisms, and Hardy-Weinberg Equilibrium PDF

Genetic Variation, Polymorphisms, and Hardy- Weinberg Equilibrium Prof. Mourad ASSIDI, Eng, MSc, PhD Center of Excellence in Genomic Medicine research (CEGMR) King Abdulaziz University...

Genetic Variation, Polymorphisms, and Hardy- Weinberg Equilibrium Prof. Mourad ASSIDI, Eng, MSc, PhD Center of Excellence in Genomic Medicine research (CEGMR) King Abdulaziz University Email: [email protected] Course MLTF 636: Population Genetics 14 / 09 / 2024  Expected Learning Outcomes 1- Understand the sources and types of genetic variation. 2- Learn how to measure genetic diversity in populations. 3- Explore the Hardy-Weinberg Principle and its applications.  The cell  The cell is the functional basic unit of life  There are two types of cells: eukaryotic and prokaryotic. Prokaryotic cells are usually independent, while eukaryotic cells are often found in multicellular organisms. Prokaryotes Eukaryotes Small ribosomes large ribosomes no nuclear membrane nuclear membrane DNA circular DNA linear no histones histones present binary fission mitotic division no membrane-bound systems ER, Golgi, vacuoles, etc. antibiotic sensitive antibiotic resistant continuous DNA synthesis DNA synthesis occurs only during S phase no sterols sterols present  Sexual Reproduction Organisms that reproduce Sexually are made up of two different types of cells: 1. Somatic Cells are “body” cells and contain the normal number of chromosomes ….called the “Diploid” number (the symbol is 2n). Examples would be … skin cells, brain cells, etc. 2. Gametes are the “sex” cells and contain only ½ the normal number of chromosomes…. called the “Haploid” number (the symbol is n)….. Sperm cells and ova are gametes.  The Male Gamete is the Sperm and is produced in the male gonad the Testis.  The Female Gamete is the Ovum (ova = pl.) and is produced in the female gonad the Ovaries. (n)  The fusion of a sperm and egg to form a zygote.  A zygote is a fertilized egg (n) (2n)  Cell Division: Mitosis Interphase: The Cell spends the majority of its life here, growing and functioning. During the S Phase of the Cell Cycle, the DNA replicates, in anticipation of Mitosis 1-Prophase: The Cell begins the division process: 1. The nucleolus disappears, 2. The nuclear membrane breaks apart 3. The chromosomes become visible, 4. The spindle apparatus forms and attaches to the centromeres of the chromosomes 2-Metaphase: 1. The Nuclear Membrane is completely gone 2. duplicated chromosomes line up across center of the cell (equator/Metaphase plate).  Cell Division: Mitosis 3.Anaphase: The third phase of Mitosis. Diploid sets of daughter chromosomes separate. They move apart and travel to opposite poles of the cell by the spindle fibers. The centromere cleaves. 4. Telophase: The nucleoli (nucleus) reform. An envelope surrounds each set of chromatids to form the new nucleus and the cytoplasm starts to divide 5.Cytokinesis:The final (5th)stage of Mitosis, takes place when the Cytoplasm divides. The cytoplasm, organelles, and nuclear material are evenly split and two new cells are formed.  Mitosis Quick Review – Place Cells in Mitosis Order A B C D E Interphase Quick Review: Identify What happens in each Prophase phase of Mitosis: Metaphase Anaphase Telophase  Cell Division: Meiosis is the process by which ”gametes” (sex cells) , with half the number of chromosomes, are produced. During Meiosis diploid cells are reduced to haploid cells Diploid (2n) → Haploid (n) If Meiosis did not occur the chromosome number in each new generation would double…. The offspring would die. Meiosis includes two (2) successive cell divisions (meiosis I & meiosis II) with only one duplication of chromosomes. Meiosis in males is called spermatogenesis and produces sperm. Meiosis in females is called oogenesis and produces ova.  Cell Division: Meiosis I Meiosis II Meiosis I = Cell division that reduces the chromosome number by one-half.  Interphase I: Similar to mitosis interphase: 1. Chromosomes replicate (S phase). 2. Each duplicated chromosome consist of two identical sister chromatids attached at their centromeres. 3. Centriole pairs also replicate. 1- Prophase I: Longest and most complex phase. 90% of the meiotic process is spent in Prophase I. 1. Chromosomes condense. 2. Synapsis occurs (homologous chromosomes come together to form a tetrad). Tetrad: is two chromosomes or four chromatids (sister and non-sister chromatids).  Prophase I - Synapsis Cell Division: Meiosis I… Non-sister chromatids Tetrad Homologous chromosomes Tetrad sister chromatids sister chromatids chiasmata: variation Site of crossing over Recombination: During Prophase I “Crossing Over” occurs Crossing Over is one of the Two major occurrences of Meiosis. Crossing Over is an engine of diversity. It creates variation (diversity) in the offspring’s traits. During Crossing over segments of non-sister chromatids break and reattach to the other chromatid. The Chiasmata (chiasma) are the sites of crossing over. 2-Metaphase I Cell Division: Meiosis I…  Shortest phase  Tetrads align on the metaphase plate.  INDEPENDENT ASSORTMENT OCCURS: 1. Orientation of homologous pair to poles is random. OR 2. Variation 3. Formula: 2n Example: 2n = 4 metaphase plate metaphase plate then n = 2 thus 22 = 4 combinations 3-Anaphase I  Homologous chromosomes separate and move towards the poles.  Sister chromatids remain attached at their centromeres. 4-Telophase I & Cytokinesis  Each pole now has haploid set of chromosomes.  Cytokinesis occurs and two haploid daughter cells are formed.  Cell Division: Meiosis II Meiosis II  Meiosis II : No interphase II (no more DNA replication) Remember: Meiosis II is similar to mitosis 5. Prophase II: same as prophase in mitosis 6. Metaphase II: same as Metaphase in mitosis 7. Anaphase II: same as Anaphase in mitosis: Sister Chromatids separate (centromere division) 8. Telophase II & Cytokinesis: same as Telophase in mitosis: 1.Nuclei formation; & 2. Cytokinesis occurs.  Cell Division: Meiosis - Summary Spermatogenesis versus Oogenesis Four haploid daughter cells produced. Two main forces of genetic variation: (i) recombination , (ii) random segregation Gametes = sperm or egg Cellular organelles for zygote come mainly from the mother side (the oocyte)  Mitosis vs. Meiosis Mitosis Meiosis Results in 2 diploid cells (2n) 4 haploid cells (1n) Cells are Genetically identical Genetically different Occurs in Somatic (body) Cells Sex Cells  Question:  A cell containing 20 chromosomes (diploid) at the beginning of meiosis would, at its completion, produce cells containing how many chromosomes?  10 chromosomes (haploid)  Terminology  Trait - any characteristic that can be passed from parent to offspring  Heredity - passing of traits from parent to offspring  Genetics - study of heredity  Monohybrid cross - cross involving a single trait; e.g. flower color  Dihybrid cross - cross involving two traits e.g. flower color & plant height ❑ Genes—are the factors that control traits. ❑ Genes consist of pairs of alleles. One that comes from the mother parent and one that comes from the father parent.  Image result for images of genome Terminology Genetics scrutinizes the function and composition of the single gene. Image result for images of genetics versus genomics Genome: An organism's complete set of DNA, including all of its genes. Genomics addresses all genes and their inter relationships in order to identify their combined influence on the growth and development of the organism. Terminology: Genotype vs. Phenotype ❑ Genotype - gene combination for a trait (e.g. RR, Rr, rr) ❑ Phenotype - the physical feature resulting from a genotype (e.g. red, white)  Example: Genotype of alleles in flowers: R = red flower ; r = yellow flower  All genes occur in pairs, so 2 alleles affect a characteristic  Possible combinations are:  Dominant and Recessive Alleles ❑ Alleles - two forms of a gene such as tall or short, wrinkled or smooth (dominant & recessive) ❑ Dominant - stronger of two genes expressed in the hybrid; represented by a capital letter (R). It always shows up when the allele is present. ❑ Recessive - gene that shows up less often in a cross; represented by a lowercase letter (r). It is masked (or covered up) when the dominant allele is present. Recessive alleles only show up if a dominant allele is not present. Mendelian Genetics: Assumptions ❑ Random Mating of individuals from same population ❑ Equal survival of all genotypes. ❑ Mendel's Law of Segregation states individuals possess two alleles, and a parent passes only one allele to his/her offspring ❑ The genotype is independent of other factors (Law of Independent Assortment) (one gene, one trait). RR rr Parents YY yy Parental Gametes R r Y y Rr F1 Offspring Yy R R r r F1 Offspring’s Gametes Y y Y y  Terminology: Homozygous Genotype vs. Heterozygous genotype ❑ Homozygous genotype - gene combination involving 2 dominant or 2 recessive identical alleles (e.g. RR or rr); also called pure ❑ Heterozygous genotype - gene combination of one dominant & one recessive allele (e.g. Rr); also called hybrid  Terminology: P, F1, and F2 generations ▪ The P generation is the original pair of parents at the start of a genetic cross experiment. ▪ The first generation that is produced by the p generation is called the F1 generation. ▪ The generation that is produced by crossbreeding the F1 generation (F1X F1) is called the F2 generation.  Punnett Square The Punnett square is a table in which all the possible outcomes for a genetic cross between two individuals with known genotypes are given Used to help solve genetics problems. It helps scientists predict the possible genotypes and phenotypes of the offspring Complete Dominance Complete Dominance Incomplete Dominance (Co-dominance)  Population Genetics  Population: is any group of members of the same species living in a given geographical area who are potentially capable of mating and producing fertile offsprings  Population Genetics: is the study of genetic variation within a population. It is a branch of genetics that considers all the alleles in a population. It enables us to trace our beginnings as well as understand our diversity today, and even predict the future  The “gene pool” in refers to all the alleles in a population  Alleles can move between populations when individuals migrate and mate. This movement, termed gene flow, underlies evolution  Population Genetics  What is a population?  A population is a subdivision of a species  A population shares a common gene pool  Genetic structure of a population  Allele frequency  Genotype frequency  Phenotype frequency  Genetic change on an individual level takes the form of mutations and genetic variations (DNA sequence)  Genetic change occurs in populations in the form of allele frequencies, which provide a different type of information than that yielded from DNA sequences  Genetic Polymorphism  Genetic Polymorphism generally refers to the gene/allele differences (DNA) between individual members of a population or among populations  The multiple sources of genetic variation (genetic diversity) include mutation and genetic recombination  Genetic variation is important for the survival and adaptation of species, as it helps in terms of natural selection and evolution.  Phenotypic Variation is caused by underlying heritable genetic variation. It is a fundamental prerequisite for evolution by natural selection.  Polymorphisms: Variation between individuals in a population (within species).  Sources of Genetic Variation ▪ Mutation, gene duplication, or other processes can produce new genes and alleles and increase genetic variation. ▪ New genetic variation can be created within generations in a population, so a population with rapid reproduction rates will probably have high genetic variation. ▪ However, existing genes can be arranged in new ways from chromosomal crossing over (recombination) and random segregation during in sexual reproduction. ▪ Overall, the main sources of genetic variation are the formation of new alleles, the altering of gene number or position, rapid reproduction, and sexual reproduction.  Sources of Genetic Variation ▪ mutation ▪ random mating between organisms ▪ random fertilization ▪ crossing over (or recombination) between chromatids during meiosis  Mutations & Genetic polymorphisms ❖ Genetic polymorphism is a term used in genetics to describe multiple forms of a single gene that exist among a population ❖ Cause of genetic polymorphisms: mutations, random segregation ❖ A mutation is a permanent change in DNA sequence. It can be an insertion or deletion of genetic information, or an alteration in the original genetic information. ❖ A mutation is also the consequence of a failure of DNA repair. ❖ Mutations can either be harmless (neutral), helpful (beneficial), or even hurtful (harmful or lethal).  Classification of Mutations Genome mutations - loss or gain of whole chromosomes, giving rise to monosomy or trisomy (numerical chromosomal mutations) Chromosome mutations - translocations or rearrangement of chromosomal material (structural chromosomal mutations) Gene mutations - most common cause of genetic disorders, point mutations, single nucleotide substitutions Types of structural chromosomal mutations  Classification of mutations Somatic mutations: occurs in somatic cells and can produce cells with reduced viability or impaired function. They accumulate with age and contribute to normal aging. The most dangerous somatic mutations ✓ Based on where are those that cause the cell to grow out of control (the they occur principal cause of cancer). Germline mutations:arise in the gametes or their diploid ancestors in the gonads. They are transmitted to the offspring and can cause genetic diseases. Can be transmitted from one generation to the other ✓ Based on the length (size) of Gene-level mutations the nucleotide sequences they affect Chromosomal mutations Genetic variation: gene-level mutations  Genetic Variation Genetic variations are the different DNA sequences among individuals, groups, or populations. Genetic variation at the DNA level is caused mainly by a wide range of mutations from single base pair change, many base pairs, and repeated sequences: 1) Single nucleotide polymorphisms (SNPs) 2) Small-scale insertions/deletions (Indels) 3) Microsatellite variation 4) Haplotypes 5) Polymorphic repetitive elements  1- Single nucleotide polymorphisms (SNPs) ~ 97 % of the genome between any two individuals is identical < 1% of the differences are single nucleotide variations (SNPs) ~2% Other changes – copy number variations, deletions, rearrangements Between 11-12 million SNPs have been identified.  1- Single nucleotide polymorphisms (SNPs)  Single-nucleotide differences between DNA sequences.  Majority SNPs have no biological effect  Small amplicon size  As small as 45–55 bp - the length of the two PCR primers  Very useful for severely degraded samples  Low discriminating power (forensics)  SNPs: ABO blood groups Single base deletion: altered reading frame  Deleterious SNPs Mendelian genetic disorders caused by genetic variations (such as SNPs) Most of these deleterious variations affect the function of the encoded protein eg: Sickle cell anemia Val to Glu codon 6 http://www.orgsites.com/va/pasca/ Normal HbA ATGGTGCACCTGACTCCTGTGGAGAAGTC Disease HbS ATGGTGCACCTGACTCCTGAGGAGAAGTC Normal HbA MVHLTPVEKSAVTA Disease HbS MVHLTPEEKSAVTA biologycorner.com  SNPs use in Forensics  Supplement tool in forensics  Two alleles at a single locus → low discriminating power  Types of applications  Ancestry Informative SNPs - High probability of an individual’s geographical ancestry  Phenotype Informative SNPs - High probability that the individual has particular phenotype, such as skin color, hair color, eye color, etc.  2- Insertions/ Deletions (Indels) Deletion of ATA Insertion of TGTG (Orange) 3- Microsatellite variation (short tandem repeat (STR) of 1 – 4bp)  4- Haplotypes A haplotype is a group/set of alleles (SNPs) that are arranged closely together on a chromosome and are inherited as a biologic unit.  5- Polymorphic repetitive elements ▪ Variable Number of Tandem Repeats (VNTRs) includes: ❑ Microsatellites (1 to ~10 bp repeats) distributed along all chromosomes. Microsatellite patterns are individual specific and can be informative to perform paternity testing or to identify a crime perpetrator ❑ Minisatellites (10 to 100 bp repeats) are characterized by high mutation rates and high diversity in populations. ▪ Polymorphic repetitive elements Alu: Alu is a small area of DNA sequence with 300 base pairs that is a repetitive element in human genome. Alu exists in large copy number across all chromosomes of primate genomes.  Effects of Genetic Polymorphisms in a Population ✓ May influence characteristics such as height and hair colour, ✓ some do contribute to disease susceptibility and can influence drug responses. ✓ Human blood groups: All the common blood types, such as the ABO blood group system, are genetic polymorphisms. An individual's susceptibility to cholera (and other diarrheal infections) is correlated with their blood type: those with type O blood are the most susceptible, while those with type AB are the most resistant. Between these two extremes are the A and B blood types, with type A being more resistant than type B.  Effects of Genetic Polymorphisms in a Population ✓ Sickle-cell anaemia (HgbS & HgbA) SS AA AS Life expectancy Short life expectancy Long life expectancy AS AA Susceptibility to Susceptible to malaria malaria infection Resistant to malaria infection infection  Functional Consequences of Mutations Failure to complete a metabolic pathway (albinism) Accumulation of unmetabolized substrate (PKU phenylketonuria) Storage of an intermediary metabolite (Tay-Sachs Disease) Formation of an abnormal end product (Sickle Cell Anemia) Defects associated with receptor proteins (Familial Hypercholesterolemia) Some Techniques used in Studying Polymorphisms 1) PCR 2) Restriction Fragment Length Polymorphism (RFLP) 3) Microarrays (SNP arrays) 4) NGS 5) …  Genetic structure of a population A genetic structure of a population can broadly be defined as the amount and distribution of genetic variation within and between populations. It is assessed mainly by: ▪ Allele frequency: the proportion of an allele in a population. Each diploid individual in the population has 2 copies (alleles) of each gene ▪ Genotype frequency ▪ Phenotype frequency  Hardy-Weinberg Equilibrium (HWE) The Hardy-Weinberg Principle: sates that the genetic variation (allele and genotype frequencies) in a population will remain constant from one generation to the next in the absence of disturbing factors  Hardy-Weinberg Equilibrium (HWE)  HWE Assumptions:  The population is infinitely large (frequency does not change)  All members of the population breed and produces same number of offspring  Random Mating:  No natural selection  No mutation occur  No migration occur If one or all of these assumptions occur in a population it will not evolve. This is not the case in naturally occurring populations Hardy-Weinberg Equilibrium (HWE) Law The law states that: “In an infinitely, random mating population, the frequency of genes and genotypes remains constant generation after generation, if there is no selection, mutation, migration and random genetic drift.’’ A mathematical relationship was developed to describe the equilibrium between alleles. The frequencies of three genotypes for a single locus with two alleles (A and a) are in the ratio of, p² for AA; Eggs 2pq for Aa; A a q² for aa, where p and q are the frequencies of A/A A/a alleles A and a respectively. A (p²) (pq) sperms p+q are always equal to 1. A/a a/a a (pq) (q²) p+q = 1 or p = 1-q or q = 1-p.  Hardy-Weinberg Equilibrium (HWE) The Hardy-Weinberg Principle can be used to :  Use of the Hardy-Weinberg law to determine the frequencies of multiple alleles.  Determine the allele frequencies in a population which indicates whether or not the population is in evolutionary equilibrium (not evolving).  Estimate the frequency of heterozygotes in a population.  Identify forces that cause evolution by specifying the conditions under which allele frequencies will not change.  It shows what will happen to the genotype and phenotype frequencies of a population under certain assumptions  Allele frequency Allele frequency is the proportion of an allele in a population. Each diploid individual in the population has 2 copies (alleles) of each gene Example:  In a population, you have the following typed 20 samples with genotypes:  4 samples with genotype AA  6 samples with genotype Aa  10 samples with genotype aa  Calculate allele frequency p= P(A) = 4 X 2 (AA) + 6 X 1(Aa) /(2×20) = 14/40 = 0.35 q= P(a) = 10X 2 (aa) + 6 X 1(Aa) /(2×20) = 26/40 = 0.65 p + q = 0.35 + 0.65 = 1  Genotype frequency Genotype frequency in a population is the number of individuals with a given genotype divided by the total number of individuals in the population The genotype frequencies are the proportions of heterozygotes and the two types of homozygotes in the population. Example:  In a population, you have the following typed 20 samples with genotypes:  4 samples with genotype AA  6 samples with genotype Aa  10 samples with genotype aa  Calculate genotype frequency P(AA) = 4 / 20 = 0.2 P(aa) = 10 / 20 = 0.5 P(Aa) = 6 / 20 = 0.3  Hardy-Weinberg Equilibrium (HWE) Genotype frequency Punnett Square: A a p= 0.8 q=0.2 allele frequencies: A = 0.8 a = 0.2 A AA Aa p=0.8 0.8 x 0.8 0.8 x 0.2 genotype frequencies: AA = 0.8 x 0.8 = 0.64 a aA aa Aa = 2(0.8 x0.2) = 0.32 q=0.2 0.2 x 0.8 0.2 x 0.2 aa = 0.2 x 0.2 = 0.04  Hardy-Weinberg Equilibrium (HWE) Genotype frequency  Two alleles are independent  P(AA)=P(A)×P(A) = p2  P(aa)=P(a)×P(a) = q2  P(Aa)=2×P(A)×P(a) = 2pq  The Hardy-Weinberg Equation: 1 = p2 + 2pq + q2  Because A and a are independent: P(Aa)=P(A)×P(a)= P(aA)  Hardy-Weinberg Equilibrium (HWE) Genotype frequency Calculations of allele frequencies and genotype frequencies Genotypes Counts Estimates genotype frequencies AA 224 D= f(AA) = 224/294 = 0.762 Aa 64 H= f(Aa) = 64/294 = 0.218 aa 6 R= f(aa) = 6/294 = 0.020 Total 294 D + H + R = 0.762 + 0.218 + 0.020 =1 Allele frequencies p(A) = (2224+64)/(2294)=0.871, q(a) = (26+64)/(2294)=0.129, p(A) + q(a) = 0.871 + 0.129 = 1 Expected genotype frequencies AA p2 = 0.8712 = 0.759 ≈ 0.762 Aa 2pq = 2  0.871  0.129 = 0.224 ≈ 0.218 aa q2 = 0.1292 = 0.017 ≈ 0.020  Hardy-Weinberg Equilibrium (HWE) Calculations of allele frequencies, genotype frequencies, and phenotype frequencies A random sample of 100 individuals from a random mating population of Mirabilis jalapa. Out of 100 plants, 30 were red, 40 were pink, 30 were white flowers. Allele frequency: R= red ; r= white f(R)= (2 X 30 (RR) + 1 X 40 (Rr) ) / 2 X 100 = 100 / 200 = 0.5 f(r)= (2 X 30 (rr) + 1 X 40 (Rr) ) / 2 X 100 = 100 / 200 = 0.5 Genotype frequency: f(RR)= 30 (RR) / 100 = 30 / 100 = 0.3 f(rr)= 30 (rr) / 100 = 100 / 100 = 0.3 f(Rr)= 40 (Rr) / 100 = 40 / 100 = 0.4 Phenotype frequency: f(red)= 30 (RR) / 100 = 30 / 100 = 0.3 f(white)= 30 (rr) / 100 = 100 / 100 = 0.3 f(pink)= 40 (Rr) / 100 = 40 / 100 = 0.4 Red colour are homozygous for dominant allele (RR). White colour are homozygous for recessive allele (rr). Each heterozygous individual pink colour will have dominant (R) and recessive (r) alleles in equal number. Genotype frequency Vs. Allele frequency Testing for HWE: Alleles: p+q=1 Genotype: p2 + 2pq + q2 =1 P and q stay constant over generations,  Environmental Effects Environmental Effects on gene expression: The degree to which an allele is expressed may depend on the environment factors. Some alleles are heat-sensitive, for example: such alleles are more sensitive to temperature than other alleles. The arctic foxes make fur pigment only when the weather is warm. Arctic fox in winter in summer  Environmental Effects Temperature Effects on Phenotype :  In Himalayan rabbits, Melanin is produced in cooler areas of body.  an enzyme of melanin production is cold-sensitive (Homozygous genotype). Factors influencing genetic diversity ❖Mutation  ❖ Genetic Polymorphisms  ❖ Genetic drift founder effect bottleneck effect ❖ Evolution ❖ Natural selection ❖ Migration