Genetics of Muscular Dystrophies - Student Notes PDF

Genetics of the Muscular Dystrophies Dean J Burkin, PhD Professor of Pharmacology & Pediatrics [email protected] Muscular Dystrophies and Myopathies Group of inherited, progressive muscle diseases in which there is necrosis of muscle tissue Muscular dystrophies are caused by distinct mutations in...

Genetics of the Muscular Dystrophies Dean J Burkin, PhD Professor of Pharmacology & Pediatrics [email protected] Muscular Dystrophies and Myopathies Group of inherited, progressive muscle diseases in which there is necrosis of muscle tissue Muscular dystrophies are caused by distinct mutations in genes affecting proteins found in the cell membrane (sarcolemma), muscle nuclei, ECM, muscle enzymes and contractile proteins. Normal Dystrophic Muscle structure Davies and Nowak, Nature Reviews 2006 Bradley's Neurology in Clinical Practice, 6th ed Chapter 79: Disorders of Skeletal Muscle, Anthony Amato and Michael Brooke Diagnosis flowchart Patient Ancillary tests – CK MRI Clinical Features Family History Pattern of weakness Calf hypertrophy: Dystrophinopathies Sarcoglycanopathies FKRP Calf wasting: LGMD2B (dysferlin) Duchenne and Becker Muscular Dystrophies These are X-linked recessive diseases related to dystrophin The major forms are Duchenne Muscular Dystrophy (DMD) and Becker’s Muscular Dystrophy (BMD) DMD is the most common form of muscular dystrophy with an incidence of ~1/3,500 live male births. The mutation rate is about 1/3 of the incidence of the disease in males, or about 1/10,000. The reported incidence of BMD is 1/18,000 to 1/31,000 male births. Other dystroglycanopathies occurring at lower incidence include: - X-linked dilated cardiomyopathy - Isolated quadriceps myopathy - Muscle cramps with myoglobinuria - Asymptomatic elevation of muscle enzymes - Manifesting DMD and BMD carrier females Molecular genetics and pathogenesis of the DMD and BMD Dystrophin is a structural protein which provides integrity to the sarcolemma The dystrophin gene is located on Xp21 and covers 2.4 megabases of genomic DNA, and includes 79 exons which code for a 14Kb transcript. Mutations primarily occur in the center of the gene (80%) and near the amino terminal end (20%) Mutations that cause dystrophinopathies: - 66% patients show large deletions (>1 million base pairs) - 5-10% have point mutations, - 5% with duplications Duchenne and Becker Muscular Dystrophy Duchenne’s description of DMD was published in the 1861 X-linked recessive muscle disease 1/3 are the result of spontaneous mutations Incidence is 1 in 3,500 male births with a prevalence reaching 1 per 18,000 males. DMD Clinical features Most male children appear normal at birth Most achieve initial milestones including sitting and standing with a slight delay Careful inspection of neck flexors in infants and toddlers usually reveals so degree of weakness A wide-base, waddling gait is noted between 2-6 years of age Tendency to be toe walkers Calf hypertrophy is often present Progressive leg weakness leads to increasing falls from 2-6 years of age Exhibit Gower sign DMD Clinical Features Weakness is characteristically worse proximally than distally and more so in the lower compared to upper limbs Usually by 8 years of age children have difficulty climbing stairs Affected children confined to a wheelchair by 12 years of age Development of kyphoscoliosis and joint contractures The biceps brachii, triceps and quadriceps reflexes diminish and are absent in 50% of children by 10 years of age Respiratory function gradually declines and leads to death in most patients in their early twenties Cardiac dysrhythmias and congestive heart failure can occur late in the disease Central nervous system involvement is involved in DMD. DMD Laboratory features Serum creatine kinase (CK) markedly elevated (50-100X normal or greater) at birth and peaks around 3 years of age. Often elevated ALT and AST while other liver enzymes are normal Electrodiagnostic testing of limited value particularly if there is a family history of the disorder. Diagnosis requires genetic screening for identifiable mutations in the dystrophin gene Electrodiagnostic may be of value in sporadic cases or in BMD where CK is only mildly elevated MRI reveals fat and connective tissue replacement DMD Histopathology Normal DMD Reduced or absent dystrophin by immunohistochemistry Muscle biopsies reveal scattered necrotic and regenerating myofibers Variability in myofiber size, increased connective tissue and addition of small rounded regenerating myofibers Inflammatory infiltrate in muscle including cytotoxic T-cells (2/3) and marcophages (1/3) are present. Immunoblot can be used to assess the quantity and size of dystrophin present Histology of dystrophic muscle Control tissue Hematoxylin & Eosin Stains Dystrophic tissue Increased connective tissue Central nuclei Presence of regenerating and degenerating fibers Diagnosis flowchart Patient Ancillary tests – CK,MRI,PCR Clinical Features Family History Muscle pathology Immunohistochemistry Protein expression Western blot Immunohistochemistry = Fluorescent antibody staining Normal 1 Absent 2 Decreased 3 From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia Duchenne vs Becker MD Control DMD BMD Quantify the amount of protein in specific tissue Determine size of protein Spectrin Dys1 Dys2 Dys3 C1 DMD BMD C2 MHC (coomassie) From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia Diagnosis flowchart Patient Ancillary tests – CK,MRI,PCR Clinical Features Family History Muscle pathology Immunohistochemistry Protein expression Protein abnormalities Gene sequencing Western blot Confirmation gene sequencing Heterozygous A>G change From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia Becker Muscular Dystrophy (BMD) Milder form of dystrophinopathy and can be distinguished from DMD clinically by the slower rate of progression and analysis of dystrophin Incidence of BMD is 5 per 100,000 with approximately 10% of cases arising from spontaneous mutations Clinical features that help with diagnosis of BMD include: (1) Family history compatible with X-linked recessive inheritance (2) Ambulation past 15 years of age (3) Limb Girdle pattern of muscle weakness (4) Calf hypertrophy Cardiac abnormalities similar to DMD Reduced life expectancy BMD: Laboratory and Histopathology Serum CK levels are elevated (20-200X normal) EMG is abnormal MRI can show fatty tissue replacement of affected muscle groups Histopathology similar to DMD but less severe Immunostaining reveals the presence of dystrophin with N-terminal reactive antibodies but not C-terminal reactive antibodies (truncated dystrophin protein) in most BMD cases Immunoblot reveals abnormal quantity and reduced size of dystrophin protein. DMD and BMD Female Carriers Genetic counseling is important in caring for patients and families with dystrophinopathies Women who are carriers are normally non-symptomatic, but a few develop muscle weakness- explained by the Lyon hypothesis: skewed X-inactivation of the normal X-chromosome and dystrophin gene Females with translocations at the chromosomal Xp21 site or Turners syndrome may develop dystrophinopathy Manifesting carriers typically develop a mild limb-girdle phenotype similar to BMD Laboratory and histologic features of manifesting carriers are similar to DMD and BMD Treatment of DMD Prednisione - Prednisone 0.75 mg/kg/d has been shown to increase muscle strength and function since as early as 10 days and sustained for up to 3 years - Slows the rate of deterioration in children with DMD - The MOA not thought to involve immunosuppression but alteration in muscle metabolism (mechanism not really known) - Side affects of high dose treatments: weight gain, excessive hair growth, irritability, stunted growth and hyperactivity, increased chance of infection, glucose intolerance, cataract formation, oestoporosis, osteonecrosis - Preclinical (mdx mouse and GRMD dog) studies indicates serious negative affects of Prednisone treatment on cardiac function Treatment of DMD Deflazacort Boys ages 5 to 15 received deflazacort 0.9 mg/ kg/day, 1.2 mg/kg/day or prednisone 0.75 mg/ kg/day, or placebo. Results indicated both doses of deflazacort and prednisone were superior to placebo at 12 weeks in improving muscle strength. The two drugs were also superior to placebo at week 12 in timed functional tests, with boys in both deflazacort groups and in the prednisone group showing “significant improvement” over those in the placebo group. Continued benefit was seen over the 52 weeks of treatment. Both deflazacort dosing groups were significantly better than the prednisone group in a timed test of climbing four stairs, measured from baseline to week 52, but only the highest dose group showed a trend toward significance compared to prednisone in a test of running/walking 30 feet. Both deflazacort groups were also reported to have a lower incidence of cushingoid-type and psychiatric adverse events compared to prednisone. FDA approved for the treatment of DMD in 2017 Treatment of DMD ETEPLIRSEN (Sarepta), Exon 51, PMO These Drugs Can Treat ~13% of DMD patients How do exon-skipping drugs work? Exon skipping- ETEPLIRSEN Oligonucleotide Backbones Morpholine Ring PPMO – Peptide Conjugated PMO PMO = Phosphorodiamidate Morpholino Oligomer PNA = Peptide Nucleic Acid Treatment of the DMD and BMD Supportive therapy: - Multidisciplinary approach involving neurologists, physiatrists, physical therapists, speech therapists, respiratory therapists, dietitians, psychologists and genetic counselors. - Physical therapy is critical for DMD and BMD patients because of the contractures that develop early in the disease - Scoliosis is a common complication of DMD resulting in pain, aesthetic damage and sometimes ventilator compromise. -Spinal fusion is considered with patients exceeding 35° scoliosis and in significant discomfort often improves life quality but does not improve respiratory function. DMD and contiguous gene syndrome Genes encoding dystrophin, glycerol kinase (GKD) and Adrenal hypoplasia congenita (DAX1) can occur together as contiguous genes on Chr Xp21 Gene order is Xpter-DAX1-GKD-DMD-centromere Depending on the extent of the mutation patients may exhibit combined diseases e.g. children with DMD and GKD exhibit in addition to severe muscle weakness, severe pyschomoter delay, episodic nausea, vomiting and stupor associated with GKD deficiency. Children with mutations in DAX1 gene that is responsible for AHC can also have life threatening adrenal insufficiency Mutations encoding the 3’ carboxy terminus of the dystrophin protein usually span the GKD locus and should be evaluated for contiguous gene syndrome Limb-Girdle Muscular Dystrophy (LGMD) Heterogeneous group of disorders that clinically resemble dystroglycanopathies except genes are autosomal Prevalence ranges from 8-70 per million Disorders are inherited in autosomal recessive or autosomal dominant Autosomal dominant are classified as type 1 e.g. LGMD 1 while autosomal recessive are type 2 e.g. LGMD 2 Further classification has been applied to these disorders as the genetic cause of the disorder has been identified e.g. LGMD 2A, LGMD 2B Clinical, laboratory and histopathological features of LGMD’s are non-specific LGMD 1A LGMD 1A is caused by mutations in the myotilin gene on Chr. 5q22.3-31.3 Spontaneous mutations are common, so lack of family history should not exclude diagnosis Myotilin is a sarcomeric protein the colocalizes with a-actinin at the Z-disk Clinical features include: - Progressive weakness that may begin in early or late adult life - Distal leg and occasional arm weakness - Patients has associated cardiomyopathy Laboratory features - Serum CK normal or elevated (9X normal) - Muscle biopsies have rimmed vacuoles and occasional nemaline rod-like inclusions LGMD 1B LGMD 1B is caused by mutations in lamin A/C on Chr. 1q11-21 Lamin A/C are required for the nuclear cytoskeleton organization Clinical features include: - Weakness in the hip and shoulder girdle - Cardiac conduction abnormalities that can lead to sudden death requiring a pacemaker Histopathology - Myofiber size variation - Increased connective tissue deposition - On EM myonuclei exhibit loss of peripheral heterochromatin Laboratory features - Serum CK normal or elevated (25X normal) LGMD 1C LGMD 1C is caused by mutations in caveolin-3 on Chr. 3p25. Spontaneous mutations are common so lack of family history does not exclude diagnosis. Caveolin-3 is located on the sarcolemma and is involved in cell signaling and regulation of sodium channels. Clinical features include: - Heterogenous phenotype - Present in childhood or adult life with proximal weakness and exertional myalgias - Calf hypertrophy maybe present - Rippling muscle disease and distal weakness Histopathology - non-specific myopathic changes - EM reveals decreased caveoli Laboratory features - Serum CK normal or elevated (25X normal) C171001 DYSF SpM C SpM 3dystrophin 3dysferlin CAV3 3b-DG 3Cav-3 3Actin (Coomassie) SPEC From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia LGMD 2A (Calpainopathies) LGMD 2A is caused by mutations in the calpain-3 gene The most common LGMD in eastern Europe, Spain, Italy and Brazil Clinical features include: - Affects pelvic-girdle muscles and posterior thigh muscles - 2-5 years later periscapular and humoral muscle weakness - Early contractures at elbows and calves - Approximately 50% of patients non-ambulatory by 20 years of age - Life expectancy is normal Histopathology - Myofiber size variation - Endomysial connective tissue Laboratory features - Serum CK normal or elevated (20X normal) - MRI scans demonstrate fat and connective tissue replacement Calpain 3 Routinely screen on Western blot – sensitivity and specificity less than perfect Gold standard: sequencing Patients abnormal on WB should be sequenced Full length Degradation prod 1 Degradation prod 2 CAPN3 sequencing Compound heterozygous mutations 1: T1505C: previously reported missense mutation Wild type: ttcaccattggcttc F Mutation: T I G 2: 2258del3[ACG]: novel mutation Wild type: gtcaacgacgcaggattccac F ttcaccactggcttc F T T G F V Mutation: N D A G F H gtcaacgcaggattccacctc V N S G F H L From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia LGMD 2A - Calpain From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia LGMD2B/ Miyoshi Myopathy Caused by mutations in the dysferlin gene on Chr 2p13 Dysferlinopathies account ~1% of LGMDs but ~60% of distal myopathies Clinical features include: - Typically present in adolescence or early adult life - Some patients exhibit a limb-girdle pattern of weakness - Other patients exhibit weakness and atrophy of calf muscles Miyoshi myopathy - Disease progression is usually slow, some patients lose ambulation in their 20s while others are able to walk late in life. Histopathology - Dystrophic muscle features - Non-myopathic features in affected muscles - Occasionally endomysial or perivascular inflammatory process is noted that can lead to an incorrect diagnosis of polymyositis. Laboratory features - Serum CK 35-200X normal DYSFERLIN (LGMD2B/MM) § Autosomal recessive § Adult-onset, slowly progressive § 2 distinct clinical phenotypes § § LGMD 2B - muscle weakness in proximal lower girdle muscles Miyoshi Myopathy (MM) - muscle weakness restricted to calf muscles LGMD 2B Miyoshi Myopathy Dysferlin Caveolin-3 Dysferlinopathy patients G1120C (ValàLeu) G3721C (GlyàArg) 5978_5979insA (GluàSTOP) G6669A (TyràSTOP) T5622C (PheàSer) G5636A (D1876N) 793_794delCT (T265fsx271) From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia Sarcoglycanopathies (LGMD2C-2F) Onset 1st-3rd decade Loss of ambulation 2nd-4th decade CK markedly ­ Cardiac involvement E.g. Ciel, 12 yo girl presented with progressive limbgirdle weakness, +ve Gowers’, calf hypertrophy CK = 50 x normal Sarcoglycanopathies Mutations in any of the four sarcoglycan genes can cause LGMD2C, LGMD2D, LGMD2E and LGMD2F. All are autosomal recessive The sarcoglycans are a tightly associated protein complex and loss of one member of the complex often results in loss or reduced levels of the others making exact diagnosis tricky. Sarcoglycanopathies account for >10% of patients with a limb-girdle pattern and positive dystrophin Approximately 6% of cases are α-sarcoglycanopathies, (LGMD2D), 3% are β-sarcoglycanopathies, (LGMD2E) 1% are γ-sarcoglycanopathies, (LGMD2C) and 1000U. Disease is variable but often DMD-like. Calf hypertrophy is observed, but cardiac findings are usually not prominent LGMD2C (γ-sarcoglycan deficiency) is associated with severe weakness and mimics DMD in its progression and loss of ambulation. LGMD2D (α-sarcoglycan deficiency) maybe severe or mild. Disease severity is dependent on with the protein is absent or reduced a-sarcoglycan g-sarcoglycan CONTROL PATIENT b-sarcoglycan CONTROL CONTROL PATIENT laminin a2 PATIENT CONTROL PATIENT From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia LGMD 2I - FKRP ! ! ! ! ! ! Onset variable Commonest form in UK and Germany. Clinical variability, Calf hypertrophy Cardiac involvement common CK 20-100 x ­ LGMD patients (LGMD2I) Onset 0.5 – 40 years – Duchenne like – Milder phenotype Calf / leg / tongue hypertrophy Facial weakness ↑ CK Cardiomyopathy Respiratory failure Homozygous for C826A more mildly affected than heterozygotes Mercuri E et al. Phenotypic spectrum Associated with Mutations in the Fukutin-Related Protein Gene. Ann Neurol 2003; 53: 537-542. Clinical Clues - AR LGMD Calf hypertrophy in all except 2B (dysferlin) Cardiac involvement - sarcoglycan and FKRP. - Rare in calpain and dysferlin deficiency DMD-like phenotype - sarcoglycan, calpain and FKRP Range of phenotypes wide with FKRP (CMD absence of symptoms in 4th decade) Congenital Muscular Dystrophies CONGENITAL MUSCULAR DYSTROPHIES Clinical: hypotonia, weakness, onset birth to 6 months, ­CK Pathology: dystrophic biopsy NO OR MINOR BRAIN ABNORMALITIES MEROSIN POSITIVE Distal laxity Rigid spine Syndrome MEROSIN DEFICIENT CMD linked to 1q42 ? Ullrich syndrome Collagen COL6A2 COL6A3 MAJOR BRAIN ABNORMALITIES CMD linked to 6q22 (MDC1A) merosin LAMA2 Selenoprotein N SEPN1 Alpha7 integrin ITGA7 Fukuyama CMD Muscle Eye Brain Disease Walker Warburg syndrome FKRP (MDC1C) ¯a-DYSTROGLYCAN ¯ MEROSIN Genes involved in glycosylation of adystroglycan: fukutin, FKRP, POMGnT1 Merosin deficient Congenital Muscular Dystrophy Type 1A (MDC1A) Caused by mutations in the LAMA2 gene on Chr 6 Complete or partial absence of laminin-211 and 221 (merosin) Clinical features include: - Severe weakness of the trunk and limbs and hypotonia at birth - Prominent contractures of the feet and hips are present - Although intelligence is normal, the incidence of epilepsy is 12% to 20% - Brain MRI can reveal increased signal in the white matter on T2-weighted images. Computed tomography (CT) of the head reveals lucencies of the white matter. Histopathology - Small muscle fibers - Inflammatory cells - Myofiber loss and fibrosis Laboratory features - Serum CK elevated Merosin deficient Congenital Muscular Dystrophy Type 1A (MDC1A) From: Gawlik and Durbeej (2011) Skeletal Muscle 1:9-22 Laminin a2 deficiency White matter changes on cerebral MRI (T2 weighted image) Selenoprotein N disorders Associated with two autosomal recessive conditions 1. Multi-mini core disease (MMCD; a congenital myopathy) 2. Rigid spine syndrome (a congenital muscular dystrophy). These share the same core clinical features. Histology is variable, - classical features of multi-mini core disease to - clear dystrophic changes without mini cores. The same mutations have been associated with both histological patterns Collagen VI muscular dystrophies Bethlem myopathy Mild Dominant Early childhood Muscle weakness and wasting Contractures Ullrich Congenital MD Severe and progressive Recessive From birth Contractures & distal laxity Respiratory muscles Abnormal scarring Collagen VI From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia Collagen VI staining Collagen VI Perlecan Overlay Control Patient SA Patient AF From: Kathryn North, MD, Children’s Hospital, Westmead, Sydney, Australia CONGENITAL MUSCULAR DYSTROPHIES Clinical: hypotonia, weakness, onset birth to 6 months, ­CK Pathology: dystrophic biopsy NO OR MINOR BRAIN ABNORMALITIES MEROSIN POSITIVE Distal laxity Rigid spine Syndrome MEROSIN DEFICIENT CMD linked to 1q42 ? Ullrich syndrome Collagen COL6A2 COL6A3 MAJOR BRAIN ABNORMALITIES CMD linked to 6q22 (MDC1A) merosin LAMA2 Selenoprotein N SEPN1 Alpha7 integrin ITGA7 Fukuyama CMD Muscle Eye Brain Disease Walker Warburg syndrome FKRP (MDC1C) ¯a-DYSTROGLYCAN ¯ MEROSIN Genes involved in glycosylation of adystroglycan: fukutin, FKRP, POMGnT1 Dystroglycanopathies Glycosylated a-DG Core a-DG Glycosylation defective a-dystroglycan Patients e-h: Mutations in FKRP Patients i-l: Mutations in LARGE Barresi R and Campbell K (2006) J Cell Sci 119:199 Godfrey et al., (2011) Current Opinion in Genetics & Development 21:278 Walker Warburg Syndrome – severe – detected on early antenatal ultrasound – encephalocoeles frequent – type II lissencephaly Gene= POMT1 = O-mannosyltransferase Glycosylation of alphadystroglycan Muscle-eye-brain disease - POMGnT1 – seen in all populations, heterogeneous – 2° merosin and aDG deficiency (abn glycosyln) – MRI - T2 abnormalities ¯ with time (as in FCMD) MDC1C - FKRP Severe phenotype clinically and histopathologically generalised leg hypertrophy, macroglossia ­­CK, (N) brain, (N) intellect, (N) NCS LGMD2I - allelic variant - most common LGMD in UK (>20%) dilated cardiomyopathy very common Fukuyama congenital muscular dystrophy Mutations in the Fukutin gene on Chr. 9q31-3. Autosomal recessive inheritance pattern Fukutin is glycosyl transferase and part of a pathway involved in the glycosylation of a-dystroglycan (laminin binding) Secondary loss of laminin-a2 and a-dystroglycan Clinical features include: - Normal at birth, some babies are floppy - Joint contractures with hip, knee and ankle - Skull asymmetry, Often severely mentally retarded Histopathology - Myofiber size variability, Myofiber loss and CLN - Muscle fibrosis and inflammation Laboratory features - Serum CK extremely elevated - Marked brain abnormalities by MRI and CT Fukuyama CMD – Patients of Japanese origin homozygous founder mutation die by average 16y heterozygotes for point mutation - 13% - severe no heterozygotes without founder mutation reported ?embryonic lethal – fukutin = putative glycosyl transferase Myotonic Dystrophy (DM1) Myotonic dystrophy type 1 (dystrophic myotonia type 1 or DM1) is characterized by progressive muscle wasting and weakness and myotonia Autosomal dominant inheritance with an incidence of ~1/8000 live births Caused by mutations myotonic dystrophy protein kinase (DMPK) gene located on chromosome 19q13.3 The mutation occurs in the untranslated region of the DMPK gene which normally contains 5 to 30 repeating CTG trinucleotide repeats. In DM1, CTG repeats expand into the hundreds or thousands. Mutation shows anticipation. Disease penetrance is dependent on repeat number which makes diagnosis problematic. Children with severe congenital myotonic dystrophy may have very large expansions (>750 repeats). Typical presentation is early teenage onset, weakness in hands and distal muscles and footdrop. Long face with mournful expression. Cardiac disease common Myotonic Dystrophy type 2 (DM2) Myotonic dystrophy type 2 (Myotonic Dystrophy type 2 or PROMM) is characterized by progressive muscle wasting and weakness and myotonia DM2 is an autosomal dominant inheritance. DM2 and PROMM are allelic disorders Caused by CCTG expansion in intron 1 of the zinc finger protein ZNF9. As with DM1 the transcribed mRNA with expanded CCTG repeats accumulates as focal collections in the nucleus and are toxic to cells. Most people with DM2 manifest the disease between 20-60 years of age. Initial symptoms are pain and stiffness in the thigh muscles. Myotonia may be proximal and distal muscles as well as facial muscles. Symptoms can vary within families however compared to DM1 anticipation is much milder. Elevated CK, insulin insensitivity in 75% of patients, low testosterone in 29% of patients. Non specific myopathic histology. Facioscapulohumeral dystrophy FSHD is an autosomal dominant muscular dystrophy Prevalence is 1-2/100,000 FSHD1 are caused by a deletion in a 3.3-kb repeating sequence termed D4Z4 on chromosome 4q35 ~5% of patients with FSHD do not have a deletion (FSHD2), but similar to FSHD1, the D4Z4 region is hypomethylated, and this causes myopathy due to pathological expression of the DUX4 gene. Expression of the DUX4 gene within the D4Z4 region appears to be responsible. Severity of FSHD1 depends on the size of the deletion. The disease can therefore show anticipation with increasing severity from one generation to the next. CK is normally elevated several fold and DNA tests are available for FSHD1