Biology 107 Pre-Midterm Notes PDF

Biology 107-Section A2, 2023 Lecturer: E-mail: Office: Office Hours: Biology 107: Dr. Srayko Dr. Martin Srayko [email protected] G514A, Biological Sciences Building Thursday from 3:00 to 5:00 pm (or by appointment) Laboratory! Lab Coordinator: Dr. Carla Starchuk In-person Labs begin the week of...

Biology 107-Section A2, 2023 Lecturer: E-mail: Office: Office Hours: Biology 107: Dr. Srayko Dr. Martin Srayko [email protected] G514A, Biological Sciences Building Thursday from 3:00 to 5:00 pm (or by appointment) Laboratory! Lab Coordinator: Dr. Carla Starchuk In-person Labs begin the week of September 11-15. You must purchase a new copy of the most recent version of the lab manual for Biology 107 (2023-2024 edition). Lab coats and safety glasses are mandatory. Full-length pants, full coverage shoes are required. (zero tolerance policy) Biology 107: Dr. Srayko Required Textbook Campbell Biology 3rd Canadian Edition by Urry et al. (2021) published by Pearson Canada Any recent version of this text book is also acceptable e.g., 3rd or 4th Custom Edition for University of Alberta by Reece et al. - it does not have to be Canadian edition, but should be relatively recent (within ~ 5 years of current book) eText is also an option (cheaper) Biology 107: Dr. Srayko Course Content Introduction to cell structure and function Prokaryotic and eukaryotic cell biology Energy conversions Compartmentalization of biochemical functions Genetic control of cell activities Replication of DNA Expression of information in DNA Biology 107: Dr. Srayko Grading of Course Your total grade in the course will be determined as follows: Midterm Exam 17 % Final Exam 35 % Lab Mark 40 % Active Learning online Quizzes (eClass) 5 % ePoll (in class) 3 % 100 % total The final exam will consist of: ~ 30% pre-midterm material: ~70% post-midterm material. - so that all the material in the course is given equal weight over the mid-term and final exam. Biology 107: Dr. Srayko Determination of final grades FINAL LETTER GRADE assigned based on each student’s performance as evaluated by his/her overall mark out of 100. Not based on a predetermined distribution of marks. Marks over 80% will be A- to A+, over 70% (B- to B+), over 60% (C- to C+), over 50% (D to D+). It is likely, though not guaranteed, that the above % are higher than required. For example, it is conceivable that 67% could end up as a B- or even B. It depends on student performance and degree of exam difficulty. Biology 107: Dr. Srayko How to Succeed in Biology 107 - attend labs and do all assignments - you are responsible for all material presented in class - take good notes (download and annotate slides during lectures) - read the relevant chapters and do practice questions Biology 107: Dr. Srayko Introduction to Living Organisms and Their Components Biology 107: Dr. Srayko Some Properties of Life: Reproduction Order Growth and Development Energy Processing Response to Environment Evolutionary Adaptation Biology 107: Dr. Srayko Why Classify Life? 1) Social, dietary, cultural, medical, economic reasons 2) To measure and monitor the diversity of life e.g., South China Tiger Panthera tigris amoyensis Critically Endangered since 1996. No individual has been recorded in the wild since the early 1990s https://en.wikipedia.org/wiki/South_China_tiger Conservation biology (management of nature and biodiversity on Earth) requires a detailed record of all forms of life - which species are extant, close to extinction, or already extinct Biology 107: Dr. Srayko Classification of Living Things (Taxonomy) 1) Physical structures similarities/differences in physical characteristics of organisms - not always reliable; analogous vs. homologous structures e.g. Bat and bird wing designs arose independently, and are analogous. Owls and magpies have homologous wing structures because they were derived from a common ancestral structure. Homologous structures Analogous structures Similar in anatomy Similar or dissimilar function Inherited from a common ancestor Not similar in anatomy Similar in function Not inherited from a common ancestor A dolphin’s flipper, bat’s wing, bird’s wing, and a human arm are considered homologous forelimb structures (Fig 22.15) Classification of Living Things (Taxonomy) 2) Fossil record Fossils can help establish ancestry, - not available for every organism - difficult/impossible to obtain DNA evidence from most fossils 3) Genetic similarities – much more accurate DNA and protein sequences change over time - When two organisms evolve from a common ancestor they slowly accumulate sequence differences - The number of sequence differences can reveal how related two organisms are Pick a specific gene or region of DNA , and compare the sequence. e.g. Biology 107: Dr. Srayko A & B = 3 sequence differences B & C = 9 sequence differences A & C = 10 sequence differences 3) Genetic similarities (continued) Genomic DNA sequencing can reveal how related two organisms are: agtcgctagctagctgactgcatgcagtcgactgactg C ccccgctagctagctgactgcatgcagtcgactgacaa agtcactagctagctgacttcatgcattcgactaactg B agtcactaactaggtgactgcatgcattcgactaactg A Red = Differences between A and B Blue = Differences between A and C Biology 107: Dr. Srayko Black = Differences between B and C Phylogram: a representation of relatedness where branch lengths are proportional to change (e.g. DNA differences) Cladogram: a representation of relatedness (“family tree”) 2 examples: C C C B B A A A B Only shows the branching order, so you can draw it in many different ways Biology 107: Dr. Srayko In this example, height reflects the evolutionary distance Classification of Living Things = Taxonomy Carolus Linneaeus (1707-1778): - developed a hierarchy of groups, each one is a “taxon” binomial system based on similarities/differences in physical characteristics of organisms. o o o o o o o o Domain Kingdom Phylum Class Order Family Genus Species Written as: Genus species (or Genus species) e.g., Saccharomyces cerevisiae (brewer’s yeast) Three domains of life (Woese, 1990) EUKARYA Land plants Green algae Cellular slime molds Dinoflagellates Forams Ciliates Diatoms Red algae Amoebas Euglena Trypanosomes Leishmania Animals Fungi Sulfolobus Green nonsulfur bacteria Thermophiles (Mitochondrion) Spirochetes Chlamydia Halophiles Green sulfur bacteria Methanobacterium ARCHAEA COMMON ANCESTOR OF ALL LIFE BACTERIA Cyanobacteria (Plastids, including chloroplasts) Whole-genome sequencing data suggests that in the early evolution of the three domains, there was a lot of DNA exchanged between organisms Several possible mechanisms: -infectious elements bringing DNA from one organism to another -possible fusion of organisms Lateral transfer -uptake of DNA released from dead organisms Therefore, clear branches leading from one organism to another cannot always be established Biology 107: Dr. Srayko An alternative model to the ”tree” to explain the early history of life “Ring” of Life No single common ancestor, but a community of primitive cells that exchanged DNA Archaea Eukarya Bacteria Biology 107: Dr. Srayko Early evolution gave rise to Archae and Bacteria, and a fusion of these gave rise to Eukaryotes Bacteria - small cells (1-10 μm) most forms are singular prokaryotic = lack a nuclear membrane surrounding their DNA one chromosome (forms a nucleoid) chromosome is circular no membrane-bound organelles most have a cell wall outside the cell membrane cell wall contains peptidoglycan membranes composed of unbranched fatty acid chains attached to glycerol by ester linkages - asexual reproduction common (binary fission) e.g. bacteria: E. coli, Salmonella Most known pathogenic prokaryotic organisms are bacteria. e.g., Spirochaetes = Gram-negative bacteria that include those causing syphilis and Lyme disease Biology 107: Dr. Srayko Nucleoid Eukarya - large cells (100 - 1000 μm) most forms are multicellular* eukaryotic = DNA bounded by nuclear membrane genome consists of several chromosomes chromosomes are linear cell contains membrane-bound organelles (e.g., mitochondria) have a cytoskeleton not all have a cell wall, but for those that do, that wall contains no peptidoglycan. membranes composed of unbranched fatty acid chains attached to glycerol by ester linkages sexual reproduction common, divide by mitosis and meiosis *there are some single-celled Eukarya, (e.g., yeasts) Biology 107: Dr. Srayko Archaea - relatively small cells (1-15 μm) most forms singular prokaryotic = lack a nuclear membrane surrounding their DNA one chromosome (forms a nucleoid) chromosome is circular no membrane-bound organelles most have a cell wall outside the cell membrane cell wall does not contain peptidoglycan membranes composed of unusual lipids, e.g., branched hydrocarbon chains attached to glycerol by ether linkages. - asexual reproduction common (binary fission) - often live in extreme environments (e.g., extreme halophiles, and hyperthermophiles). Biology 107: Dr. Srayko Classification of Living Things o Domain - Archaea, Bacteria, Eukarya o Kingdom - Plantae, Animalia, Fungi, Protista, Eubacteria, Archaebacteria o Phylum o Class o Order o Family o Genus o Species – the most specific level. These organisms are so similar that they can mate and reproduce with each other. Biology 107: Dr. Srayko Summary of Three Domains of Life Bacteria Nuclear Envelope Membrane -enclosed organelles Peptidoglycan in cell walls Circular Chromosome(s) Biology 107: Dr. Srayko Archaea Eukarya Chemistry and Macromolecules In this section, we look at the basic building blocks of life and the chemical bonds that stabilize them. As we move forward, we will describe macromolecules, and it will be important to note the types of bonds and the monomers that make up macromolecules as well as the role(s) that different macromolecules play in the cell. Biology 107. Dr. Srayko All organisms are composed of matter. Matter is composed of elements. Of the 92 elements known, about ¼ are required for organisms to survive. C, H, O, P, S, N – these elements make up >96% of living matter Biology 107. Dr. Srayko Elements in the Human Body Biology 107. Dr. Srayko Review of Chemical Bonds The discrete shells that electrons can occupy, have a specific capacity. The closest shell can only hold 2 electrons. The second shell can hold 8 electrons. 1st shell = 1s orbital = 2 electrons 2nd shell = 2s, 2p, 2p, 2p orbitals = 8 electrons The properties of the atom are determined primarily by the number of electrons in the outermost shell (these are the valence electrons). Atoms with the same number of valence electrons behave similarly in chemical reactions. An atom with a “full” valence shell will be unreactive (inert). Biology 107. Dr. Srayko The atomic number defines the number of protons present in that particular element. Because electrons are negatively charged, when an element is in its neutral state, it will have the same number of protons as electrons. e.g., Atomic Number Boron has 5 protons 5 electrons Atomic weight Boron has (11-5) = 6 neutrons Note: Every atom of boron contains 5 protons. Biology 107. Dr. Srayko 6n 5p Covalent bond: sharing of a pair of valence electrons by two atoms Two or more atoms held together by covalent bonds = a molecule If one pair of electrons are shared, it is a single bond. e.g. H-H H-H 1p 1p Single pair of electrons shared O=O 8p 1p 8p 8p Biology 107. Dr. Srayko Two pairs are shared between two atoms: = double bond Covalent bonds can be Nonpolar or Polar (determined by the electronegativity of the atom, i.e., the attraction strength of an atom for electrons of the other atom in the covalent bond). Non-polar when it is equal (H-H, O=O,) and polar if it is not equal. In H2O, oxygen pulls electrons more than H, so the distribution of charges changes, with O becoming negative and H becoming positive. 8p 1p 1p 1p 2.2 2.2 Single bond, non-polar dd- 1p 8p 1p 2.2 3.4 Electronegativity Biology 107. Dr. Srayko Single bond, polar d+ d+ Molecules with multiple atoms can have complicated shapes, determined by the orbitals. The formation of covalent bonds results in a rearrangement of orbitals in the valence shell. e.g., Carbon’s electrons would be dispersed in a “6-pointed structure, but when bound to H, four pairs of electrons are shared and the s and p orbitals rearrange to occupy 4 equidistant regions, which form a tetrahedron H H C H H Biology 107. Dr. Srayko Ionic bond: When two atoms with a very different affinity for valence electrons combine, the electron is transferred from one to the other, leaving the two atoms with a net change in their charge. The oppositely charged cations and anions form an ionic bond. 0.9 3.2 11p 17p Na Cl 17p 11p - + +- Na+ + + - + + + + + + + + Cl- - + + + + Dr. Srayko - NaCl anion + + Biology 107. + Cl- cation + + Ionic bonds are relatively weak in aqueous environments. Salts dissolve in water, i.e., the ions separate and become surrounded by water molecules Na+ + + These compounds are called salts (or ionic compounds) + + The change in charge forms the bond. Electronegativity Weak chemical bonds are also very important in biology, as these interactions can be reversible, or modified by changes to the molecule. Hydrogen bond: when hydrogen forms covalent bond with an electronegative atom (like oxygen or nitrogen), it will have a positive charge, which allows it to interact with another negatively charged atom. d- d+ 1p 8p 1p d+ e.g., H2O Biology 107. Dr. Srayko d8p 6p 1p 6p e.g., some large molecule with a carbonyl group exposed to water Van der Waals interactions: Because of the random positioning of electrons in the orbitals, net displacements can occur, creating brief charge differences. This dynamic charge distribution allows molecules to stick to each other if they are very close. Different molecules can exhibit different “stickiness” depending on the arrangement of respective atoms. d- d+ d+ d- The distribution of electrons changes over time. d+ dd+ d- d+ dOne dipole can also induce a dipole in a neighboring atom. Although these attractions are often very weak, they can have a large cumulative effect. Biology 107. Dr. Srayko Gecko feet contain millions of tiny hairs which “stick” to many different types of surfaces via van der Waals interactions! Photos by Kellar Autumn Biology 107. Dr. Srayko Review of chemical bonds and interactions Type Basis of interaction Example Bond strength Covalent Ionic Hydrogen van der Waals interaction Biology 107. Dr. Srayko Attraction between H (d+) and a strongly electronegative atom H + d d N H... O=C Weak Water: a polar molecule with some unique properties There are 4 main properties of water that are important for life on Earth: 1) Cohesion of water molecules: d+ H d+ d- O d- Biology 107. Dr. Srayko H d+ d- + + 2) Moderation of temperature by water: + + + + vapor + + + + + + … + + - +… + + + … … + + i) Water has a high heat of vaporization: + + Because of the high density of hydrogen bonds, liquid ii) Water contributes to evaporative cooling: as liquid evaporates from the surface, the liquid that remains behind, cools down. Biology 107. Dr. Srayko 3) Water (solid) is less dense than Water (liquid). … +- ++ - … + + + + - … + + + + solid + + - + + Cl Cl Cl Cl C Cl Cl Cl + + C Cl Cl - + + - + + + + Cl Cl … … + + + + C + + + + + + Cl … + + Cl + + + + … Dr. Srayko … + Biology 107. + + Salts dissolve in water + … + + Cl- + + + + + + + + - + + + + + + Na+ - + + - … + - - … + + + + … 4) Water is an important solvent - + + liquid + + - +… + … This arrangement makes ice about 10% less dense than liquid (ice floats on water) + + + + + + … … … + + + + At 0 ºC, water molecules form a crystalline lattice, with each molecule participating in 4 hydrogen-bonds with 4 other molecules. + + Polar molecules are soluble in water Non-Polar molecules are not soluble in water “hydrophilic” “hydrophobic” Carbon is the backbone of life Hydrocarbons: - organic molecules consisting of only H and C Methane CH4 Ethane C2H6 Ethene C2H4 - hydrocarbons are not prevalent in most living organisms, but some organic molecules contain regions that have only C and H. e.g. fats, (lipids) - hydrocarbons like gasoline and animal fat, contain a lot of potential energy that can be released (igniting gas in the engine of our car, or, catabolising fats in our bodies to provide energy). Biology 107. Dr. Srayko Molecular Diversity Arises from Carbon Skeleton Variation Carbon chains can vary in: Length H H H C C H H H H H H H C C C H H H H H Propane Ethane H Branching H H Presence of rings H H H H C C C C H H H H C H H H H H H H C C C C 1-Butene Biology 107. Dr. Srayko H H C H C C C H H H H H C H H H H C C C C H 2-Butene H H C H C H H H H H H C H C Cyclohexane H H C H Double bond position H C 2-Methylpropane Butane H H H H H H H C C H C C H H Benzene Isomers 1) Structural (or constitutional) isomers: e.g. C4H10 can have a different bond order of atoms H H butane vs. 2-methylpropane H H H H H C C C C H H H H C H H H H H C C C H H H H 2) Stereoisomers a) Geometric isomers: e.g., cis vs trans isomers trans A double bond restricts H X rotation of the two atoms C C with respect to each other H X cis X H C C X H b) Enantiomers: When 4 different atoms (or groups of atoms) bind to Carbon, an asymmetric arrangement occurs. If the two molecules are mirror images, and cannot be superimposed on each other, they are enantiomers. X X Y C Biology 107. Dr. Srayko Z W W C Z Y Pharmacological Importance of Enantiomers Figure 4.8 Biology 107. Dr. Srayko A few chemical groups are very important in biological molecules Carbon frequently forms covalent bonds with H, O, and N. Symbol hydroxyl carbonyl Seven functional groups that are most important for biological molecules are: carboxyl amino sulfhydryl Refer to Figure 4.10 Biology 107. Dr. Srayko phosphate methyl Macromolecules are large molecules that make up living cells: Many form by the addition of small monomeric subunits, to make polymers Carbohydrates Proteins Nucleic acids Lipids Biology 107. Dr. Srayko polymers polys = many meros = part Polymers form via dehydration reactions Monomers are attached through the formation of a covalent bond and the simultaneous removal of a water molecule (dehydration reaction). HO 1 2 3 H Short polymer HO Unlinked monomer Dehydration removes a water molecule, forming a new bond HO 1 2 3 Longer polymer Biology 107. Dr. Srayko H H2O 4 H Polymers are disassembled into monomers by the reverse reaction, or hydrolysis. HO 1 2 3 4 Hydrolysis adds a water molecule, breaking a bond HO 1 2 3 H H H2O HO H Adding different monomers together allows for the formation of polymers with distinct properties: e.g., proteins are made from an “alphabet” of 20 different amino acids. Many proteins are over 200 amino acids long; the potential for variety is huge. Biology 107. Dr. Srayko Carbohydrates: Fuel and Building material Monosaccharides (mono = single, sacchar = sugar) added to build disaccharides and polysaccharides Most common biological monosaccharides contain either 3, 5, or 6 carbon atoms. e.g., glyceraldehyde C3H6O3 e.g., ribose C5H10O5 Molecular formulas for monosaccharides are usually multiples of CH2O e.g., glucose, galactose, fructose C6H12O6 Monosaccharide names end with “-ose”, and can be grouped into general categories based on the number of Carbons. e.g., trioses, pentoses, hexoses. Simple monosaccharides have a linear structure with a carbonyl group (C=O) and multiple hydroxyl groups. Glucose is a hexose Many monosaccharides change dynamically between linear molecules and and rings. Glucose: chemical equilibrium between linear and ring structures greatly favors ring formation. Only about 6% of molecules are in the linear form. Biology 107. Dr. Srayko Monosaccharides like glucose are a major nutrient for cells. Cells can extract energy from glucose via cellular respiration (breaking them down in a series of reactions). In addition, the carbon from sugars that are broken down can be reused to form other molecules (like fats and proteins). Biology 107. Dr. Srayko Disaccharide forms when a dehydration reaction joins two monosaccharides glycosidic linkage maltose Storage polysaccharides trans 1) Starch: glucose polymers, each monomer is joined by 1-4 glycosidic linkages (like maltose), with all monomers in the alpha configuration. A simple starch, Amylose, is unbranched and helical. a-glucose a 1-4 linkage Amylose forms helical polymers. Amylopectin is a branched starch. It branches via alpha 1-6 linkages. The structure of amylopectin is not as helical because of the branching of the chain. Biology 107. Dr. Srayko a 1-4 linkage CH2OH CH2OH O O OH O HO OH a 1-6 linkage O OH 2) Glycogen: Animals store glucose in this polysaccharide form, which is structurally similar to amylopectin, but with more frequent a 1-6 linkages (i.e. more branching). a 1-4 linkage CH2OH CH2OH O O OH O HO Biology 107. Dr. Srayko a 1-6 linkage OH O OH Structural polysaccharides Cellulose: Like starch, it is a polymer of glucose, but the covalent 1-4 linkages involve the beta form of glucose ring. Cellulose forms straight polymers that never branch. It is very strong because some OH groups are free to hydrogen-bond between different polymers lying parallel (microfibrils) cis b-glucose b 1-4 linkage HO CH2OH O OH O O OH O HO CH2OH HO CH2OH O OH O OH O HO O CH2OH Most animals cannot digest cellulose. Cows and other ruminants (as well as termites) can digest cellulose only because they have special cellulose-digesting bacteria and/or protists in their guts. Biology 107. Dr. Srayko Chitin: This is a structural polysaccharide used by arthropods (insects, spiders, crustaceans), to build their exoskeletons. CH3 b 1-4 linkage O CH2OH O OH O O NH O OH O NH CH3 CH2OH CH2OH O O OH O NH CH3 acetyl amine group instead of OH - this allows for increased hydrogen bonding between adjacent polymers, giving chitin increased strength. Chitin contains N-acetylglucosamine monomers, a derivative of glucose (2-(acetylamino)-2-deoxy-D-glucose) O NH CH3 Biology 107. Dr. Srayko Summary starch -made of glucose monomers -used by plants to store surplus glucose glycogen -made of glucose monomers -more highly branched structure than starch -used by animals to store glucose cellulose -made of glucose monomers, but a different anomeric form of glucose than in starch -major component of plant cell walls chitin -made of N-acetylglucosamine monomers -component of arthropod exoskeletons Lipids Lipids are hydrophobic because they consist mostly of hydrocarbons, which are nonpolar Classes: Fats, phospholipids and steroids Fats are not polymers, but they are built from monomers that are added by dehydration reactions: Glycerol is an alcohol, each of the 3 Cs has a hydroxyl group H2O Fatty acid (in this case, palmitic acid) A fatty acid has a long chain of 16-18 carbons, with a carboxyl group on the end (hence it is an acid). Biology 107. Dr. Srayko In a fat, three fatty acids are joined to glycerol by an ester linkage, creating a triacylglycerol, or triglyceride Biology 107. Dr. Srayko Fatty acids vary in length, and the number and location of double bonds Saturated fatty acids do not have double bonds. If no double bonds exist between Cs of a chain, and all Cs are bonded to H, then it is saturated with hydrogen, and thus a saturated fat. Solid at room temperature Biology 107. Dr. Srayko Unsaturated fatty acids have one or more double bonds Plant fats and fish fats are usually unsaturated. O H H C-(CH2)7-C=C-( CH 2) 7 -C OH H 3 Cis double bond causes bending Liquid at room temperature Biology 107. Dr. Srayko Major function of fat is energy storage but it can also serve as insulation: - Humans and other mammals store their fat in adipose cell - Adipose tissue cushions vital organs and insulates the body Fats are essential, but… A diet rich in saturated fats may contribute to cardiovascular disease Trans fats may contribute more than saturated fats to cardiovascular disease Biology 107. Dr. Srayko What are “trans” fats? -they are unsaturated fats -vast majority consumed by humans are produced by the food processing industry Partially hydrogenated plant oils by chemical process many double -makes plant oils solid at room temp bonds are -increases shelf life saturated by -can be used as butter substitutes adding H atoms -BUT, the process also creates a lot of trans fat as a by-product i.e., some cis double bonds in the plant oil become rearranged rather than saturated: H H H C CH2 H H H atoms in cis H H -CH2-C H -CH2-C -C -CH2 -CH2 saturated (straight) H -CH2-C H atoms in trans Biology 107. Dr. Srayko C H CH2-CH2- (unsaturated, but also straight) Phospholipids e.g., Phosphatidylcholine Phospholipid = two fatty acids and a phosphate group attached to glycerol Phosphate group is hydrophilic Two fatty acid tails are hydrophobic Phospholipids are amphipathic molecules (having both a hydrophilic polar end and a hydrophobic non-polar end. Figure 5.11 + + - - + + v + + lipid bilayer liposome + + + + + + + + + + … + + + + + + hydrophobic tails interact with each other, away from H2O - … + + + + … + + + + - … + + hydrophilic head groups interact with H2O + + - + + - + + … + + + + micelle + + + + + + + + + + + + Because of their amphipathic nature, when phospholipids are added to water, they can rearrange into various structures - = spherical lipid bilayer (cross-section is shown) + + Phospholipids are the major component of all cell membranes Steroids Steroids are lipids with a carbon skeleton consisting of four fused rings Cholesterol is a component in animal cell membranes Cholesterol provides strength and flexibility to animal cell membranes Although cholesterol is essential in animals, high levels in blood may contribute to cardiovascular disease This steroid example is cholesterol. Other types include cortisol and testosterone. Proteins Proteins are involved in every biological task - polymers of amino acids (there are 20 biologically relevant amino acids) - they vary extensively in their structure (each one has a unique 3D shape) e.g., enzymes, antibodies, storage proteins, hormones, transporters, structural cytoskeletal proteins, intracellular machines side chain Amino Acid General structure: H R H3N+ amino C H COOcarboxyl H R N+ C H H O C O- Also drawn like this Amino acids can exist as different enantiomers, but all proteins use L-enantiomers. Biology 107. Dr. Srayko Amino acids can be grouped according to the characteristics of their side chain (R group) Nonpolar side chains Glycine (Gly or G) Methionine (Met or M) Biology 107. Dr. Srayko Alanine (Ala or A) Valine (Val or V) Phenylalanine (Phe or F) Leucine (Leu or L) Tryptophan (Trp or W) Isoleucine (Ile or I) Proline (Pro or P) Polar side chains Serine (Ser or S) Biology 107. Threonine (Thr or T) Dr. Srayko Cysteine (Cys or C) Tyrosine (Tyr or Y) Asparagine (Asn or N) Glutamine (Gln or Q) Electrically charged Basic (positively charged) Acidic (negatively charged) Aspartic acid (Asp or D) Biology 107. Dr. Srayko Glutamic acid (Glu or E) Lysine (Lys or K) Arginine (Arg or R) Histidine (His or H) Amino Acids are linked by peptide bonds Peptide bond A polypeptide is a polymer of amino acids Side chains Peptide bond Backbone Amino end (N-terminus) Biology 107. Dr. Srayko Carboxyl end (C-terminus) Four levels of protein structure: Primary, Secondary, Tertiary, Quaternary Primary = the linear sequence of amino acids. NH3+-Ala-Lys-Arg-Arg-Asn-Met- …. –COONH3+-Met-His-Ser-Ala-Gly-Ala- …. –COOPolypeptides have an NH3+ (amino) end, and a COO- (carboxyl) end and they can be composed of a few to more than a thousand monomers. Each polypeptide can have a unique linear sequence of amino acids, with an amino end (N-terminus) and a carboxyl end (C-terminus) Biology 107. Dr. Srayko Primary (1º) structure is determined by inherited genetic information. Biology 107. Dr. Srayko Secondary (2º) structure = the formation of a-helices or bpleated sheets due to hydrogen bonding between the O of carbonyl group and the H of the amino group. Depending on how the amino acids line up, different structures will form. b-pleated sheet forms when peptide sequences lie next to each other in antiparallel orientation (shown here) or parallel orientation Biology 107. Dr. Srayko Tertiary (3º) structure = the arrangement of the peptide chain due to interactions between R groups, that gives the protein its distinctive shape. Transthyretin polypeptide This can involve: - hydrophobic interactions (pockets that exclude water and push other amino acids to the outside) - van der Waals interactions - ionic bonds, - hydrogen bonds - disulphide bonds (a type of covalent bond between two S atoms from two different side chains (e.g., two cysteines). Biology 107. Dr. Srayko Some proteins also exhibit Quaternary (4º) structure = results from the aggregation of two or more polypeptide subunits. e.g. Transthyretin (4 identical polypeptides) e.g. Hemoglobin (2 a and 2 b subunits) Hemoglobin Protein (carries O2 in blood) Fig 5.18 Biology 107. Dr. Srayko A change in primary structure can affect a protein’s function One form of sickle-cell anemia results from an amino acid substitution in hemoglobin Figure 5.19 Biology 107. Dr. Srayko ~40 ºC What determines protein structure? In addition to primary structure, physical and chemical conditions can affect structure Alterations in pH, salt concentration, temperature, or other environmental factors can cause a protein to unravel Loss of a protein’s native structure is called denaturation A denatured protein is biologically inactive. Biology 107. Dr. Srayko ~60 ºC Protein Folding in the Cell ? Most proteins probably go through several stages on their way to a stable, properly folded structure Diseases such as Alzheimer’s, Parkinson’s, and “Mad cow disease” are associated with misfolded proteins Biology 107. Dr. Srayko Chaperonins are proteins that assist proper folding of other proteins Figure 5.21 A specific protein may or may not require a chaperonin to assist its folding. Regardless, proteins are not functional until they are completely folded. Biology 107. Dr. Srayko Nucleic acids Coded information that cells can transmit to future generations and the messages that determine protein production. There are two types: Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA) Each polynucleotide is made of monomers called nucleotides Figure 5.24 Biology 107. Dr. Srayko A nucleotide consists of 3 different molecules joined together phosphate 5 carbon sugar nitrogenous base O - O Nucleoside (e.g. cytidine) Biology 107. Dr. Srayko P OH O Nucleotide (e.g. cytidine monophosphate) phosphate 5 carbon sugar nitrogenous base In Ribonucleic acid (RNA), the sugar is ribose In Deoxyribonucleic acid (DNA), the sugar is deoxyribose Biology 107. Dr. Srayko Features of a Nucleotide: e.g., Cytidine monophosphate 5′ C- attaches to phosphate group “five-prime phosphate” 5 O HO P O O- 5′ 4 3 2 6 1 4′ 1′ 3′ 3′ C - OH important for polymer formation: “three-prime OH” 1′ C - attaches to the base 2′ 2′ C- OH in RNA “two-prime OH” 2′ C- H in DNA The Carbon atoms in the ribose sugar are numbered with a prime to distinguish them from the Carbons in the nitrogenous base ring. Biology 107. Dr. Srayko phosphate 5 carbon sugar nitrogenous base Two types of nitrogenous bases: Pyrimidines (single 6-sided ring) Cytosine Thymine Uracil) Cytosine Purines (6- and 5-sided rings fused) Adenine Guanine Thymine C T Adenine A Biology 107. Dr. Srayko Uracil U Guanine G Nucleotide monomers can be added together to form nucleic acid polymers via a dehydration reaction O - O e.g., RNA synthesis O P O O - O P O O 3′ Biology 107. Dr. Srayko Nucleotide monomers can be added together to form nucleic acid polymers via a dehydration reaction O - O e.g., RNA synthesis O P O O - O O P O O O Extra detail: The incoming nucleotide is a nucleotide triphosphate, but two phosphates get removed when it gets added (more about that later in course) Biology 107. Dr. Srayko P O O P O O O O P OH O A new nucleotide gets added to the free 3′ OH Nucleotide monomers can be added together to form nucleic acid polymers via a dehydration reaction O - O e.g., RNA synthesis O P O O - O O P O H2O Dehydration reaction O - O Biology 107. Dr. Srayko P O O Polynucleotide chains have a direction (5′ to 3′) or (5′ → 3′) O - O e.g., RNA synthesis O P O Phosphate group at this 5′ end O Sugar-phosphate backbone O Covalent bond formed is an ester bond The linkage between nucleotides is a phosphodiester linkage OH group at this 3′ end Biology 107. Dr. Srayko - O P O O - O P O O Structure of DNA 3′ 5′ DNA molecules have two polynucleotides spiraling around an imaginary axis, forming a double helix DNA double helix: two backbones run in opposite 5′→3′ directions from each other, an arrangement referred to as antiparallel 3′ Figure 5.25 Biology 107: Dr. Srayko 5′ Structure of DNA Complementary base pairing DNA bases pair by hydrogen bonding: adenine (A) always with thymine (T), guanine (G) always with cytosine (C) Biology 107: Dr. Srayko The Structure of RNA RNA molecules are usually a single polynucleotide chain But complementary base-pairing can occur between RNA and: - DNA - other RNAs - itself In RNA, thymine (T) is replaced by uracil (U) adenine (A) can pair with uracil (U), guanine (G) can pair with cytosine (C) Biology 107: Dr. Srayko Figure 5.25 Nucleic acids DNA: stores hereditary information transmits information to cell descendants mRNA: (messenger RNA) transmits information within the cell DNA mRNA Information Flow Protein The amino acid sequence of a polypeptide is programmed by a region of DNA, called a gene Figure 5.23 This is a table for your reference: It will help with the nomenclature DNA Sugar Deoxyribose Deoxyribose Deoxyribose Deoxyribose Base Guanine Adenine Cytosine Thymine Deoxycytidine Deoxythymidine Nucleoside Deoxyguanosine Deoxyadenosine Nucleotide Deoxyguanosine MP Deoxyadenosine MP Deoxycytidine MP Deoxythymidine MP Nucleotide abbreviation dGMP dAMP dCMP dTMP RNA Sugar Ribose Ribose Ribose Ribose Base Guanine Adenine Cytosine Uracil Nucleoside Guanosine Adenosine Cytidine Uridine Nucleotide Guanosine MP Adenosine MP Cytidine MP Uridine MP Nucleotide abbreviation GMP AMP CMP UMP MP = monophosphate Nucleotides also can have di- or tri-phosphates attached: (e.g., GDP, GTP, dGDP, dGTP) Biology 107. Dr. Srayko Introduction to Membranes Plasma membrane is a boundary that separates living cell from its surroundings Plasma membrane exhibits selective permeability, allowing some substances to cross it more easily than others Biology 107. Dr. Srayko Introduction to Membranes The spherical phospholipid bilayer is the basic structure of all biological membranes cell liposome = spherical lipid bilayer (cross-section is shown) Biology 107. Dr. Srayko Membranes are made of proteins and lipids Phospholipids are the most abundant lipid in the plasma membrane Figure 7.2 “Fluid Mosaic Model” (Singer and Nicholson, 1972) - membrane is a fluid structure with a ”mosaic” appearance because it contains different types of proteins embedded in it - different membranes can contain different proteins Biology 107. Dr. Srayko Proteins of the bilayer can be classified into two main groups: 1) integral (or intrinsic) membrane proteins - embedded in the bilayer due to at least one portion of the protein being hydrophobic Water hydrophilic Integral membrane proteins Extracellular (outside) hydrophobic hydrophilic Intracellular (inside) Water 2) peripheral (or extrinsic) membrane proteins - attached loosely to the surface of the membrane (usually by interacting with an integral protein) Peripheral membrane proteins In addition to phospholipids and proteins, membranes can contain other components: Glycoproteins - membrane proteins that have a sugar attached - important function in cell recognition Glycolipids - membrane lipids that have a sugar attached Cholesterol - inserts between phospholipid molecules - influences membrane permeability and fluidity Figure 7.3 Variability in the type and number of these different components gives different membranes specific properties Biology 107. Dr. Srayko Biological membranes are fluid at physiological temperature Phospholipids and some proteins in the membrane can move Phospholipids drift laterally Phospholipids rarely flip-flop transversely Biology 107. Dr. Srayko High temperature will cause an increase in fluidity - gaps in the membrane will form if temperature goes high enough (membrane can become more permeable at high temperatures) Biology 107. Dr. Srayko All membranes will turn solid if temperature goes low enough - called phase transition Liquid Solid Temperature at which phase transition occurs depends on the composition of the membrane: 1. Length of fatty acids in the phospholipid Long fatty acids Short fatty acids Solid at X ºC Solid at colder than X ºC Short chains have less stable interactions with each other - therefore, a lower temp required to keep them in a solid structure Biology 107. Dr. Srayko 2. “Shape” of fatty acids in the phospholipid (influenced by double bonds) Unsaturated hydrocarbon tails with kinks Solid at X ºC Solid at colder than X ºC Double bonds cause structural kinks, decreasing ability of chains to pack together (as discussed previously) Biology 107. Dr. Srayko 3. Cholesterol also has an effect on membrane fluidity Cholesterol acts as a “fluidity buffer” to maintain membrane fluidity at a greater range of temperatures. - It interferes with the lateral movement of phospholipids (reducing membrane fluidity at moderate temperatures) - It prevents close packing of phospholipids at lower temperatures (solidification occurs at a lower temperature) Cholesterol is very important (and prevalent) in animal cell membranes (e.g. As much as 25% of the lipid in some nerve cells is cholesterol) - Cholesterol is not in prokaryote membranes, and plant cells have very little, if any. Biology 107. Dr. Srayko What are the proteins doing in the membrane? Six major functions for membrane proteins: Transport of molecules into or out of cell Biology 107. Dr. Srayko Enzymatic reactions near the membrane Signaling via receptors What are the proteins doing in the membrane? Six major functions for membrane proteins: Cell-cell recognition e.g., blood groups A and B result from different glycoproteins on blood cells Biology 107. Dr. Srayko Intercellular attachment Attachment of the cell to extracellular matrix proteins Transport How is the movement of various molecules across the membrane achieved (or prevented)? Lipid bilayer is permeable to some substances, impermeable to others Main barrier is the Hydrophobic core of the bilayer 3 ways: Diffusion, Facilitated diffusion, Active transport Biology 107. Dr. Srayko 1) Diffusion (or Passive Transport) - occurs best with small hydrophobic molecules such as O2 - these are soluble in the bilayer and can pass through quite quickly - when such a molecule is more concentrated on one side of a membrane, diffusion occurs until equilibrium is reached * Figure 7.10 Biology 107. Dr. Srayko - i.e., molecules “diffuse down their concentration gradient” Only certain molecules can pass through the membrane via diffusion hydrophobic molecules e.g., very good small uncharged polar e.g., fair to poor large uncharged polar e.g., rarely, if ever, pass through charged (large or small) e.g., almost never pass through Osmosis: a special case of passive transport - diffusion of water across a selectively permeable membrane Water (solvent) follows the solute: Water molecules can pass through membrane, but sugar cannot Fewer solute molecules Figure 7.11 Water clusters around the solute More solute molecules Water moves from high to low free water concentration (or low to high solute concentration) Biology 107. Dr. Srayko Tonicity: the relative concentration of a solute in two solutions separated by a membrane that it cannot cross. If water can pass freely, the solute [conc.] difference determines whether cells gain or lose water. [solute] If outside solution is: Hypotonic H2O Animal cells In animal cells, an influx of water could cause osmotic lysis Lysed [solute] Isotonic H2O H2O H2O Normal H2O H2O Turgid (normal) Flaccid Plant cells Hypertonic Shriveled H2O H2O Figure 7.13 Biology 107. Dr. Srayko Plasmolyzed cell shrinks, membrane pulls away from the cell wall = plasmolysis 2) Facilitated Diffusion: Passive Transport Aided by Proteins - specific molecules that are impeded by the membrane but diffuse passively with the aid of a transport protein Two types of transport proteins are used for facilitated diffusion: 1) Channel proteins: A specific channel protein usually allows only one type of molecule or ion to pass through. Cellular conditions determine if the channel is open or closed Figure 7.15 Down the [conc.] gradient a “pore” or channel e.g., Aquaporins are a type of channel protein that facilitates osmosis. Water moves across the membrane faster if it goes through a channel. e.g., Ion channels allow specific ions through (i.e., usually a different protein for each ion) Channel proteins can be “gated”, turned on or off by different stimuli (voltage, ligands, etc.) Biology 107. Dr. Srayko Facilitated Diffusion: Passive Transport Aided by Proteins Figure 7.15 2) Carrier proteins: These undergo a subtle change in shape (conformational change) to translocate a solute across the membrane. - specific for the molecule being transported - solute also diffuses down its concentration gradient - protein has same affinity for target molecule on both sides of the membrane (i.e., movement can occur in either direction, but always down the concentration gradient) Biology 107. Dr. Srayko Down the [conc.] gradient 3) Active Transport: used to move a substance against the concentration gradient Why do cells do this? - To concentrate nutrients in the cell - To expel waste - To establish voltage/chemical gradients Proteins involved in this type of transport are all Carrier proteins. - specific carrier protein for each substance Biology 107. Dr. Srayko Compared to its surroundings, an animal cell maintains a high internal conc. of K+ and low Na+ Animal cell K+ Na+ ~130 mM 10 mM Blood plasma 4 mM ~150 mM Concentration of K+ and Na+ in cells (from Molecular Cell Biology. 4th edition. Lodish et al.) -to do this, a cell uses a “sodium-potassium pump” and energy stored in a molecule called ATP ATP = adenosine triphosphate -breaks down to ADP + Pi and releases energy ADP = adenosine diphosphate Pi = phosphate *more about ATP later in course Biology 107. Dr. Srayko Active transport allows cells to establish and maintain concentration gradients that might not occur naturally The sodiumpotassium pump is one type of active transport system Biology 107. Dr. Srayko EXTRACELLULAR FLUID [Na+] high [K+] low Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ CYTOPLASM Na+ [Na+] low [K+] high 1 Cytoplasmic Na+ binds to the sodium-potassium pump. P ADP 2 ATP Na+ binding stimulates phosphorylation by ATP. P 3 Phosphorylation causes the protein to change its shape. Na+ is expelled to the outside. K+ K+ + K+ K P K+ 6 K+ is released, and the cycle repeats. K+ 5 Loss of the phosphate restores the protein’s original shape P 4 K+ binds on the extracellular side and triggers release of the phosphate group. Start 3 Na+ (in) + 2 K+ (out) + ATP End 3 Na+ (out) + 2 K+ (in) + ADP + Pi 3 Na+ go out, and 2 K+ come in, creating an imbalance in charge across the membrane (inside is more negative than outside) Fewer “+” ions + + + Voltage + + + + + Biology 107. Dr. Srayko More “+” ions - + + + + ++ membrane + + + Voltage = difference in electric potential All cells exhibit a voltage across their plasma membranes. - + - + + + - + - + + + + The unequal distribution of anions and/or cations across the plasma membrane is called the membrane potential. e.g., cells typically have a membrane potential of -50 to -200 mV For ions, two forces drive their diffusion across the membrane - a difference in their concentration (chemical force) - a difference in total charge (electrical force) = electrochemical gradient So, charged molecules flow down their electrochemical gradient (Not simply their conc. gradient) Biology 107. Dr. Srayko The pumps that are responsible for creating electrochemical gradients are called electrogenic pumps. An important electrogenic pump in animal cells is the sodium-potassium pump. Plants, fungi and bacteria mainly use a proton pump. ATP – EXTRACELLULAR FLUID + – H+ H+ + H+ Proton pump H+ – CYTOPLASM – – H+ + + + H+ Another type of Active Transport: Cotransport (or coupled transport) Cotransporters couple the “downhill” transport of a solute to the “uphill” transport of a second substance against its own concentration gradient – + ATP – H+ Figure 7.18 H+ + H+ Proton pump H+ – H+ + – + H+ Diffusion of H+ Sucrose-H+ cotransporter Sucrose H+ H+ – – + + Sucrose This example depicts sucrose transport in a plant cell What if substances are too big for a transporter protein? Bulk Transport Big molecules (e.g. polysaccharides) must be transported using a bulk transport mechanism Involves formation of vesicles Membrane is flexible and can bend into different shapes including pinching off into vesicles. This requires energy. Exocytosis (secretion) – exporting substances out of the cell Golgi apparatus secretory vesicle Protein destined for secretion/exocytosis Biology 107. Dr. Srayko Endocytosis (importing substances) 3 main types: e.g., Food particles Two of these are general mechanisms 1) Phagocytosis (cell “eating”) Food vacuole Biology 107. Dr. Srayko 2) Pinocytosis (cell “drinking”) vesicle 3) receptor-mediated - a mechanism involving receptors to import specific things ligand receptor Inside the cell Outside the cell Response “A” Response “B” Recall that receptors are a specific type of membrane protein. Receptors receive chemical signals from outside the cell. This involves a physical interaction between ligand and receptor. Each receptor only binds to ligands of a particular structure (often, only one type of molecule will bind to a specific receptor). Biology 107. Dr. Srayko Receptor-mediated endocytosis Receptors bind to a substance (ligand) that the cell needs to uptake. Clathrin binds to these receptors on the inside of the cell, gathering them and the membrane into a “pit” shape that eventually forms a vesicle. Clathrin is then released, the particle (ligand) is used/consumed, and the receptors make their way back to the membrane. inside cell Clathrin is a coat protein that helps facilitate vesicle formation inside cell Clathrin-coated “pit” Biology 107. Dr. Srayko Triskelion shape (quaternary structure) An example of receptor-mediated endocytosis: fat delivery to cells Lipoproteins transport fats to cells via the blood stream. surface monolayer of phospholipid and cholesterol core consists of triacylglycerols and/or cholesterol cell e.g., LDL has Apolipoprotein B-100 specific proteins (called apolipoproteins) associate with the fat droplet - the proteins differ, depending on the lipoprotein - receptors on the recipient cell recognize the apoprotein and promote endocytosis (involving coated-pits) and uptake of the fats. Biology 107. Dr. Srayko Too much cholesterol can build up in arteries and form plaques Normal blood flow Fatty plaque restricts blood flow Blood tests: total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides LDL (low density lipoprotein), low in density, but highest in cholesterol. LDL cholesterol is often referred to as “bad” cholesterol HDL (high density lipoprotein), highest in density due to high protein/lipid ratio. These particles can remove excess cholesterol from blood vessels (and transport to it the liver for removal). HDL cholesterol is often referred to as “good” cholesterol. High levels of LDL vs. HDL can indicate higher risk of cardiovascular disease Biology 107. Dr. Srayko Transporter Definitions - systems that perform active transport using ATP directly mediate “primary active transport” (e.g., the Na+/K+ pump) - systems (such as sucrose-H+, above) that use carrier proteins driven by ion gradients are said to mediate “secondary active transport” - the carrier or transport proteins used in facilitated diffusion or active transport are sometimes described as: a) uniporters (those that transport only one type of molecule) A b) symporters (transport two different molecules in the same direction) c) antiporters (transport two different molecules in the opposite direction) A B A B Review of Membranes and Transport: - Cellular membranes are fluid mosaics of lipids and proteins - Membrane structure results in selective permeability - Passive transport is diffusion of a substance across a membrane with no energy investment - Active transport uses energy to move solutes against gradients - Bulk transport across plasma membranes uses exocytosis and endocytosis Biology 107. Dr. Srayko The cell membrane is a fluid barrier that separates cell interior from the exterior, but it is not very strong Cells typically have additional structures that reinforce the membrane Cell walls: Many types of cells contain cell walls Biology 107. Dr. Srayko Bacterial Cell Walls - provide shape, protection from bursting in hypotonic environments Bacterial cells, like animal cells, contain a much higher concentration of many molecules, compared with their environment Cell membrane Lysis due to osmosis Cell wall protects the cell Biology 107. Dr. Srayko Bacterial Cell Walls Almost all bacterial cell walls contain peptidoglycan. Most bacteria belong to one of two major classes, as defined by their cell wall structure The two types are distinguished by the Gram stain. A procedure developed by Hans Gram (late 1800s) Hans Gram He was trying to find a better way to see bacteria with the microscope (most bacteria have no colour, and are often transparent). Gram positive Staining Hard to see Biology 107. Dr. Srayko Gram negative Discovered that some bacteria stained more intensely than others (the colors come from a combination of different stains used) Figure 27.3 Biology 107. Dr. Srayko Lipopolysaccharides - large glycolipid Figure 27.3 Biology 107. Dr. Srayko Peptidoglycan - a thin sheet composed of: 1. Chains of a repeating disaccharide unit composed of two monosaccharides i) N-acetylglucosamine (NAG) ii) N-acetylmuramic acid (NAM) 2. Small peptides - attached to NAM subunits of the chains - bonds formed between peptides on adjacent chains cross-link the chains and gives strength to the structure Peptidoglycan is a polymer of NAG and NAM b 1-4 linkage O CH2OH O O N-acetylglucosamine (NAG) NH O O NH CH3 CH2OH ala glu DAP ala O CH2OH O OH O CH3 CH3 O O NH O OH O NH O CH3 Short Peptide O NAG-NAM…. CH2OH ala glu DAP ala N-acetylmuramic acid (NAM) (plus a short peptide that is added after to NAM) Diaminopimelic acid (DAP) is a derivative of the amino acid lysine. Biology 107. Dr. Srayko The structure of NAM before peptide addition NA M M G NA M G NA G NA G NA M NA M NA NA NA M G NA NA G NA M NA M NA G NA NA G NA M Multiple strands of NAG and NAM get cross-linked to form thin sheets Biology 107. Dr. Srayko Two peptide side chains attach to each other via covalent bonds. This cross-linking reaction is called transpeptidation, and it adds strength to the layer. For both Gram-positive and Gram-negative bacteria, peptidoglycan is not a barrier to solutes. Peptidoglycan is synthesized only in growing cells. More peptidoglycan must be synthesized as cell grows Binary fission Biology 107. Dr. Srayko growth Antibiotics - There are many naturally occurring antibiotics - some are specific to certain types of bacteria: - based on their ability to target prokaryote-specific structures Two common targets are: 1) prokaryotic ribosomes (responsible for protein synthesis) 2) prokaryotic cell walls · a) Lysozyme = antimicrobial present in our bodily fluids (tears, milk, saliva, mucous) - Enzyme that catalyzes hydrolysis of b 1-4 linkages between NAG and NAM - (peptidoglycan falls apart, cells lyse) b) Penicillin Biology 107. Dr. Srayko Antibiotics: Penicillin Let bacteria grow Petri plate with solid agar media, streaked with bacteria (Staphylococcus) Zone of inhibited growth Mold growth on plate Staphylococcus aureus = gram-positive coccal bacterium Biology 107. Dr. Srayko Sir Alexander Fleming - won the Nobel Prize (Physiology or Medicine) in1945 (shared with Ernst Chain and Howard Florey). Bacteria (Staphylococcus) Antibiotics: How does Penicillin work? Transpeptidation reaction is catalyzed by a specific enzyme. - the enzyme is inhibited by penicillin (and derivatives) - inhibition leads to a weakened peptidoglycan - works best on Gram positive cells As the cell grows, new peptidoglycan is not formed - eventually the cell bursts (lysis) NA M NA G NA G NA M NA M NA G NA G NA M NA M NA G NA G NA M NA M As bacterial cell grows, it synthesizes more peptidoglycan Biology 107. Dr. Srayko Bacteria cell wall grown without penicillin Bacteria cell wall grown with penicillin Is there anything else outside the bacterial cell wall? Many bacteria also have a “capsule” surrounding the cell wall Capsule - mostly polysaccharides - further protects cell from environment - can be used to stick bacteria to surface - capsule is very rare in Archaea Biology 107. Dr. Srayko Pili (two types) - fimbriae (attach to surfaces or host cells) e.g., Neisseria gonorrhoeae, the causative agent of gonorrhea uses fimbriae to attach itself to mucus membranes. fimbriae Center for Disease control and prevention (Computer generated model) - sex pilus (for transfer of DNA between bacteria cells DNA is transferred to another bacteria (termed bacterial conjugation) pilus A plasmid can be transferred Plasmids are small circular DNA, distinct from the chromosome Biology 107. Dr. Srayko In a heterogeneous environment, many bacteria exhibit taxis, the ability to move toward or away from a stimulus Chemotaxis is the movement toward or away from a chemical stimulus Motile bacteria move in a series of “runs” and “tumbles”. “tumble” n” “ru ” “run “tumble” How do bacteria move? Biology 107. Dr. Srayko Duration of the run is longer if the concentration of the “attractant” increases during the run. Another external structure: Flagella (for movement) Flagella of bacteria, archaea, and eukaryotes are composed of different proteins and likely evolved independently flagellum Composed of 1000s of flagellin monomers Figure 27.6 Rotation can be clockwise or counterclockwise (to allow changes in direction) CCW = “run” CW = “tumble” Biology 107. Dr. Srayko Bacterial flagella motors are composed of many individual components! (you do not need to know these) E. coli uses a proton-based (H+) electrochemical gradient to power the motor (some other bacteria use a Na+ gradient) This is a type of ion channel that couples H+ influx to physical rotation of the rotor/flagellum (like a turbine). + + + + + + + + Inner plasma membrane + + Picture adapted from Berg et al., 2016. Protein Science + = H+ The overall rate of proton flow through the motor is around 200 000 H+ per second (when motor is not under load) ~600 H+ go through the motor per revolution Thus the motor can spin at about 300 Hz Biology 107. Dr. Srayko Archaea Cell Walls - no outer membrane - various coverings surrounding the plasma membrane (depends on species) no true peptidoglycan, but related molecules have been found in some species some Archaea are covered by Archaea-specific lipopolysaccharides In general, they have stronger membranes, due to a number of unique differences, e.g., an ether linkage, rather than ester in their triacylglycerols. ether link ester link O CH2 -O-C CH2 -O-C O CH2 -O-C CH2 -O-C CH2 -OH glycerol Biology 107. Dr. Srayko Bacteria and Eukarya CH2 -OH glycerol Archaea Other modifications that provide strength Eukaryotic Cell Walls Animal cells do not have cell walls, but plants and fungi do! Cell Wall function: - provides shape and function - strong cell walls of plants help hold them upright Plant cell Cell wall = cellulose chains embedded in a matrix of other polysaccharides and proteins Biology 107. Dr. Srayko Plant Cell walls Plant cell Plasma membrane - young plant cell secretes a thin cell wall outside the plasma membrane - the primary cell wall - as cell matures, cell wall is strengthened - some secrete hardening substances into the primary cell wall - others add a secondary cell wall - A cell may have many layers per secondary cell wall -made of a matrix of strong materials - e.g., cells in wood have many layers of cellulose, lignin, proteins Biology 107. Dr. Srayko Between primary cell walls of adjacent plant cells is the middle lamella The middle lamella is composed of: The middle lamella is composed of sticky polysaccharides called pectins (this effectively glues the adjacent cells together) Note: Pectin is not the same thing as amylopectin (described earlier). Pectin is a more general term referring to a mixture of polysaccharides that are more complex in structure, e.g., pectin typically has a 1-4 linked D-galacturonic acid (an oxidized form of galactose) as its monosaccharide. - you do not need to know this detail! Biology 107. Dr. Srayko Because of the thick cell wall and middle lamella, plant cells are isolated from each other. To allow “communication” between cells, plant cell walls contain pores (tunnels) between cells. Plasmodesmata (singular = plasmodesma) - allows passage of H2O and small solutes between cells Thus, the interior of all cells can be connected. These pores can open and close, depending on the environmental conditions or age of the plant. Biology 107. Dr. Srayko Electron micrograph of two plant cells, next to each other Plasma membrane Secondary cell wall Primary cell wall Middle lamella Fig. 6.27 1 µm Animal cells No cell wall, but they secrete proteins and polysaccharides = extra cellular matrix (ECM) Some cells attach to the ECM using additional specialized proteins - Biology 107. most common is fibronectin (interacts with collagen) Fibronectin also binds to a specific class of integral membrane proteins called integrins Dr. Srayko Animal cells ECM consists mostly of glycoproteins and protein fibre