Biochemistry by Stryer PDF

Dedication About the authors Preface Tools and Techniques Clinical Applications Molecular Evolution Supplements Supporting Biochemistry, Fifth Edition Acknowledgments I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function 1.2. Biochemical Unity Underlies Biological Diversity 1.3. Chemical Bonds in Biochemistry 1.4. Biochemistry and Human Biology Appendix: Depicting Molecular Structures 2. Biochemical Evolution 2.1. Key Organic Molecules Are Used by Living Systems 2.2. Evolution Requires Reproduction, Variation, and Selective Pressure 2.3. Energy Transformations Are Necessary to Sustain Living Systems 2.4. Cells Can Respond to Changes in Their Environments Summary Problems Selected Readings 3. Protein Structure and Function 3.1. Proteins Are Built from a Repertoire of 20 Amino Acids 3.2. Primary Structure: Amino Acids Are Linked by Peptide Bonds to Form Polypeptide Chains 3.3. Secondary Structure: Polypeptide Chains Can Fold Into Regular Structures Such as the Alpha Helix, the Beta Sheet, and Turns and Loops 3.4. Tertiary Structure: Water-Soluble Proteins Fold Into Compact Structures with Nonpolar Cores 3.5. Quaternary Structure: Polypeptide Chains Can Assemble Into Multisubunit Structures 3.6. The Amino Acid Sequence of a Protein Determines Its Three-Dimensional Structure Summary Appendix: Acid-Base Concepts Problems Selected Readings 4. Exploring Proteins 4.1. The Purification of Proteins Is an Essential First Step in Understanding Their Function 4.2. Amino Acid Sequences Can Be Determined by Automated Edman Degradation 4.3. Immunology Provides Important Techniques with Which to Investigate Proteins 4.4. Peptides Can Be Synthesized by Automated Solid-Phase Methods 4.5. Three-Dimensional Protein Structure Can Be Determined by NMR Spectroscopy and X- Ray Crystallography Summary Problems Selected Readings 5. DNA, RNA, and the Flow of Genetic Information 5.1. A Nucleic Acid Consists of Four Kinds of Bases Linked to a Sugar-Phosphate Backbone 5.2. A Pair of Nucleic Acid Chains with Complementary Sequences Can Form a Double- Helical Structure 5.3. DNA Is Replicated by Polymerases that Take Instructions from Templates 5.4. Gene Expression Is the Transformation of DNA Information Into Functional Molecules 5.5. Amino Acids Are Encoded by Groups of Three Bases Starting from a Fixed Point 5.6. Most Eukaryotic Genes Are Mosaics of Introns and Exons Summary Problems Selected Readings 6. Exploring Genes 6.1. The Basic Tools of Gene Exploration 6.2. Recombinant DNA Technology Has Revolutionized All Aspects of Biology 6.3. Manipulating the Genes of Eukaryotes 6.4. Novel Proteins Can Be Engineered by Site-Specific Mutagenesis Summary Problems Selected Reading 7. Exploring Evolution 7.1. Homologs Are Descended from a Common Ancestor 7.2. Statistical Analysis of Sequence Alignments Can Detect Homology 7.3. Examination of Three-Dimensional Structure Enhances Our Understanding of Evolutionary Relationships 7.4. Evolutionary Trees Can Be Constructed on the Basis of Sequence Information 7.5. Modern Techniques Make the Experimental Exploration of Evolution Possible Summary Problems Selected Readings 8. Enzymes: Basic Concepts and Kinetics 8.1. Enzymes Are Powerful and Highly Specific Catalysts 8.2. Free Energy Is a Useful Thermodynamic Function for Understanding Enzymes 8.3. Enzymes Accelerate Reactions by Facilitating the Formation of the Transition State 8.4. The Michaelis-Menten Model Accounts for the Kinetic Properties of Many Enzymes 8.5. Enzymes Can Be Inhibited by Specific Molecules 8.6. Vitamins Are Often Precursors to Coenzymes Summary Appendix: Vmax and KM Can Be Determined by Double-Reciprocal Plots Problems Selected Readings 9. Catalytic Strategies 9.1. Proteases: Facilitating a Difficult Reaction 9.2. Making a Fast Reaction Faster: Carbonic Anhydrases 9.3. Restriction Enzymes: Performing Highly Specific DNA-Cleavage Reactions 9.4. Nucleoside Monophosphate Kinases: Catalyzing Phosphoryl Group Exchange between Nucleotides Without Promoting Hydrolysis Summary Problems Selected Readings 10. Regulatory Strategies: Enzymes and Hemoglobin 10.1. Aspartate Transcarbamoylase Is Allosterically Inhibited by the End Product of Its Pathway 10.2. Hemoglobin Transports Oxygen Efficiently by Binding Oxygen Cooperatively 10.3. Isozymes Provide a Means of Regulation Specific to Distinct Tissues and Developmental Stages 10.4. Covalent Modification Is a Means of Regulating Enzyme Activity 10.5. Many Enzymes Are Activated by Specific Proteolytic Cleavage Summary Problems Selected Readings 11. Carbohydrates 11.1. Monosaccharides Are Aldehydes or Ketones with Multiple Hydroxyl Groups 11.2. Complex Carbohydrates Are Formed by Linkage of Monosaccharides 11.3. Carbohydrates Can Be Attached to Proteins to Form Glycoproteins 11.4. Lectins Are Specific Carbohydrate-Binding Proteins Summary Problems Selected Readings 12. Lipids and Cell Membranes 12.1. Many Common Features Underlie the Diversity of Biological Membranes 12.2. Fatty Acids Are Key Constituents of Lipids 12.3. There Are Three Common Types of Membrane Lipids 12.4. Phospholipids and Glycolipids Readily Form Bimolecular Sheets in Aqueous Media 12.5. Proteins Carry Out Most Membrane Processes 12.6. Lipids and Many Membrane Proteins Diffuse Rapidly in the Plane of the Membrane 12.7. Eukaryotic Cells Contain Compartments Bounded by Internal Membranes Summary Problems Selected Readings 13. Membrane Channels and Pumps 13.1. The Transport of Molecules Across a Membrane May Be Active or Passive 13.2. A Family of Membrane Proteins Uses ATP Hydrolysis to Pump Ions Across Membranes 13.3. Multidrug Resistance and Cystic Fibrosis Highlight a Family of Membrane Proteins with ATP-Binding Cassette Domains 13.4. Secondary Transporters Use One Concentration Gradient to Power the Formation of Another 13.5. Specific Channels Can Rapidly Transport Ions Across Membranes 13.6. Gap Junctions Allow Ions and Small Molecules to Flow between Communicating Cells Summary Problems Selected Readings II. Transducing and Storing Energy 14. Metabolism: Basic Concepts and Design 14.1. Metabolism Is Composed of Many Coupled, Interconnecting Reactions 14.2. The Oxidation of Carbon Fuels Is an Important Source of Cellular Energy 14.3. Metabolic Pathways Contain Many Recurring Motifs Summary Problems Selected Readings 15. Signal-Transduction Pathways: An Introduction to Information Metabolism 15.1. Seven-Transmembrane-Helix Receptors Change Conformation in Response to Ligand Binding and Activate G Proteins 15.2. The Hydrolysis of Phosphatidyl Inositol Bisphosphate by Phospholipase C Generates Two Messengers 15.3. Calcium Ion Is a Ubiquitous Cytosolic Messenger 15.4. Some Receptors Dimerize in Response to Ligand Binding and Signal by Cross- phosphorylation 15.5. Defects in Signaling Pathways Can Lead to Cancer and Other Diseases 15.6. Recurring Features of Signal-Transduction Pathways Reveal Evolutionary Relationships Summary Problems Selected Readings 16. Glycolysis and Gluconeogenesis 16.1. Glycolysis Is an Energy-Conversion Pathway in Many Organisms 16.2. The Glycolytic Pathway Is Tightly Controlled 16.3. Glucose Can Be Synthesized from Noncarbohydrate Precursors 16.4. Gluconeogenesis and Glycolysis Are Reciprocally Regulated Summary Problems Selected Readings 17. The Citric Acid Cycle 17.1. The Citric Acid Cycle Oxidizes Two-Carbon Units 17.2. Entry to the Citric Acid Cycle and Metabolism Through It Are Controlled 17.3. The Citric Acid Cycle Is a Source of Biosynthetic Precursors 17.4. The Glyoxylate Cycle Enables Plants and Bacteria to Grow on Acetate Summary Problems Selected Readings 18. Oxidative Phosphorylation 18.1. Oxidative Phosphorylation in Eukaryotes Takes Place in Mitochondria 18.2. Oxidative Phosphorylation Depends on Electron Transfer 18.3. The Respiratory Chain Consists of Four Complexes: Three Proton Pumps and a Physical Link to the Citric Acid Cycle 18.4. A Proton Gradient Powers the Synthesis of ATP 18.5. Many Shuttles Allow Movement Across the Mitochondrial Membranes 18.6. The Regulation of Cellular Respiration Is Governed Primarily by the Need for ATP Summary Problems Selected Readings 19. The Light Reactions of Photosynthesis 19.1. Photosynthesis Takes Place in Chloroplasts 19.2. Light Absorption by Chlorophyll Induces Electron Transfer 19.3. Two Photosystems Generate a Proton Gradient and NADPH in Oxygenic Photosynthesis 19.4. A Proton Gradient Across the Thylakoid Membrane Drives ATP Synthesis 19.5. Accessory Pigments Funnel Energy Into Reaction Centers 19.6. The Ability to Convert Light Into Chemical Energy Is Ancient Summary Problems Selected Readings 20. The Calvin Cycle and the Pentose Phosphate Pathway 20.1. The Calvin Cycle Synthesizes Hexoses from Carbon Dioxide and Water 20.2. The Activity of the Calvin Cycle Depends on Environmental Conditions 20.3 the Pentose Phosphate Pathway Generates NADPH and Synthesizes Five-Carbon Sugars 20.4. The Metabolism of Glucose 6-Phosphate by the Pentose Phosphate Pathway Is Coordinated with Glycolysis 20.5. Glucose 6-Phosphate Dehydrogenase Plays a Key Role in Protection Against Reactive Oxygen Species Summary Problems Selected Readings 21. Glycogen Metabolism 21.1. Glycogen Breakdown Requires the Interplay of Several Enzymes 21.2. Phosphorylase Is Regulated by Allosteric Interactions and Reversible Phosphorylation 21.3. Epinephrine and Glucagon Signal the Need for Glycogen Breakdown 21.4. Glycogen Is Synthesized and Degraded by Different Pathways 21.5. Glycogen Breakdown and Synthesis Are Reciprocally Regulated Summary Problems Selected Readings 22. Fatty Acid Metabolism 22.1. Triacylglycerols Are Highly Concentrated Energy Stores 22.2. The Utilization of Fatty Acids as Fuel Requires Three Stages of Processing 22.3. Certain Fatty Acids Require Additional Steps for Degradation 22.4. Fatty Acids Are Synthesized and Degraded by Different Pathways 22.5. Acetyl Coenzyme A Carboxylase Plays a Key Role in Controlling Fatty Acid Metabolism 22.6. Elongation and Unsaturation of Fatty Acids Are Accomplished by Accessory Enzyme Systems Summary Problems Selected Readings 23. Protein Turnover and Amino Acid Catabolism 23.1. Proteins Are Degraded to Amino Acids 23.2. Protein Turnover Is Tightly Regulated 23.3. The First Step in Amino Acid Degradation Is the Removal of Nitrogen 23.4. Ammonium Ion Is Converted Into Urea in Most Terrestrial Vertebrates 23.5. Carbon Atoms of Degraded Amino Acids Emerge as Major Metabolic Intermediates 23.6. Inborn Errors of Metabolism Can Disrupt Amino Acid Degradation Summary Problems Selected Readings III. Synthesizing the Molecules of Life 24. The Biosynthesis of Amino Acids 24.1. Nitrogen Fixation: Microorganisms Use ATP and a Powerful Reductant to Reduce Atmospheric Nitrogen to Ammonia 24.2. Amino Acids Are Made from Intermediates of the Citric Acid Cycle and Other Major Pathways 24.3. Amino Acid Biosynthesis Is Regulated by Feedback Inhibition 24.4. Amino Acids Are Precursors of Many Biomolecules Summary Problems Selected Readings 25. Nucleotide Biosynthesis 25.1. In de Novo Synthesis, the Pyrimidine Ring Is Assembled from Bicarbonate, Aspartate, and Glutamine 25.2. Purine Bases Can Be Synthesized de Novo or Recycled by Salvage Pathways 25.3. Deoxyribonucleotides Synthesized by the Reduction of Ribonucleotides Through a Radical Mechanism 25.4. Key Steps in Nucleotide Biosynthesis Are Regulated by Feedback Inhibition 25.5. NAD+, FAD, and Coenzyme A Are Formed from ATP 25.6. Disruptions in Nucleotide Metabolism Can Cause Pathological Conditions Summary Problems Selected Readings 26. The Biosynthesis of Membrane Lipids and Steroids 26.1. Phosphatidate Is a Common Intermediate in the Synthesis of Phospholipids and Triacylglycerols 26.2. Cholesterol Is Synthesized from Acetyl Coenzyme A in Three Stages 26.3. The Complex Regulation of Cholesterol Biosynthesis Takes Place at Several Levels 26.4. Important Derivatives of Cholesterol Include Bile Salts and Steroid Hormones Summary Problems Selected Readings 27. DNA Replication, Recombination, and Repair 27.1. DNA Can Assume a Variety of Structural Forms 27.2. DNA Polymerases Require a Template and a Primer 27.3. Double-Stranded DNA Can Wrap Around Itself to Form Supercoiled Structures 27.4. DNA Replication of Both Strands Proceeds Rapidly from Specific Start Sites 27.5. Double-Stranded DNA Molecules with Similar Sequences Sometimes Recombine 27.6. Mutations Involve Changes in the Base Sequence of DNA Summary Problems Selected Readings 28. RNA Synthesis and Splicing 28.1. Transcription Is Catalyzed by RNA Polymerase 28.2. Eukaryotic Transcription and Translation Are Separated in Space and Time 28.3. The Transcription Products of All Three Eukaryotic Polymerases Are Processed 28.4. The Discovery of Catalytic RNA Was Revealing in Regard to Both Mechanism and Evolution Summary Problems Selected Readings 29. Protein Synthesis 29.1. Protein Synthesis Requires the Translation of Nucleotide Sequences Into Amino Acid Sequences 29.2. Aminoacyl-Transfer RNA Synthetases Read the Genetic Code 29.3. A Ribosome Is a Ribonucleoprotein Particle (70S) Made of a Small (30S) and a Large (50S) Subunit 29.4. Protein Factors Play Key Roles in Protein Synthesis 29.5. Eukaryotic Protein Synthesis Differs from Prokaryotic Protein Synthesis Primarily in Translation Initiation Summary Problems Selected Readings 30. The Integration of Metabolism 30.1. Metabolism Consist of Highly Interconnected Pathways 30.2. Each Organ Has a Unique Metabolic Profile 30.3. Food Intake and Starvation Induce Metabolic Changes 30.4. Fuel Choice During Exercise Is Determined by Intensity and Duration of Activity 30.5. Ethanol Alters Energy Metabolism in the Liver Summary Problems Selected Readings 31. The Control of Gene Expression 31.1. Prokaryotic DNA-Binding Proteins Bind Specifically to Regulatory Sites in Operons 31.2. The Greater Complexity of Eukaryotic Genomes Requires Elaborate Mechanisms for Gene Regulation 31.3. Transcriptional Activation and Repression Are Mediated by Protein-Protein Interactions 31.4. Gene Expression Can Be Controlled at Posttranscriptional Levels Summary Problems Selected Readings IV. Responding to Environmental Changes 32. Sensory Systems 32.1. A Wide Variety of Organic Compounds Are Detected by Olfaction 32.2. Taste Is a Combination of Senses that Function by Different Mechanisms 32.3. Photoreceptor Molecules in the Eye Detect Visible Light 32.4. Hearing Depends on the Speedy Detection of Mechanical Stimuli 32.5. Touch Includes the Sensing of Pressure, Temperature, and Other Factors Summary Problems Selected Readings 33. The Immune System 33.1. Antibodies Possess Distinct Antigen-Binding and Effector Units 33.2. The Immunoglobulin Fold Consists of a Beta-Sandwich Framework with Hypervariable Loops 33.3. Antibodies Bind Specific Molecules Through Their Hypervariable Loops 33.4. Diversity Is Generated by Gene Rearrangements 33.5. Major-Histocompatibility-Complex Proteins Present Peptide Antigens on Cell Surfaces for Recognition by T-Cell Receptors 33.6. Immune Responses Against Self-Antigens Are Suppressed Summary Problems Selected Readings 34. Molecular Motors 34.1. Most Molecular-Motor Proteins Are Members of the P-Loop NTPase Superfamily 34.2. Myosins Move Along Actin Filaments 34.3. Kinesin and Dynein Move Along Microtubules 34.4. A Rotary Motor Drives Bacterial Motion Summary Problems Selected Readings Appendix A: Physical Constants and Conversion of Units Appendix B: Acidity Constants Appendix C: Standard Bond Lengths Glossary of Compounds Answers to Problems Common Abbreviations in Biochemistry Dedication TO OUR TEACHERS AND OUR STUDENTS About the authors JEREMY M. BERG has been Professor and Director (Department Chairperson) of Biophysics and Biophysical Chemistry at Johns Hopkins University School of Medicine since 1990. He received his B.S. and M.S. degrees in Chemistry from Stanford (where he learned X-ray crystallography with Keith Hodgson and Lubert Stryer) and his Ph.D. in Chemistry from Harvard with Richard Holm. He then completed a postdoctoral fellowship with Carl Pabo. Professor Berg is recipient of the American Chemical Society Award in Pure Chemistry (1994), the Eli Lilly Award for Fundamental Research in Biological Chemistry (1995), the Maryland Outstanding Young Scientist of the Year (1995), and the Harrison Howe Award (1997). While at Johns Hopkins, he has received the W. Barry Wood Teaching Award (selected by medical students), the Graduate Student Teaching Award, and the Professor's Teaching Award for the Preclinical Sciences. He is co-author, with Stephen Lippard, of the text Principles of Bioinorganic Chemistry. JOHN L. TYMOCZKO is the Towsley Professor of Biology at Carleton College, where he has taught since 1976. He currently teaches Biochemistry, Biochemistry Laboratory, Oncogenes and the Molecular Biology of Cancer, and Exercise Biochemistry and co-teaches an introductory course, Bioenergetics and Genetics. Professor Tymoczko received his B.A. from the University of Chicago in 1970 and his Ph.D. in Biochemistry from the University of Chicago with Shutsung Liao at the Ben May Institute for Cancer Research. He followed that with a post-doctoral position with Hewson Swift of the Department of Biology at the University of Chicago. Professor Tymoczko's research has focused on steroid receptors, ribonucleoprotein particles, and proteolytic processing enzymes. LUBERT STRYER is currently Winzer Professor in the School of Medicine and Professor of Neurobiology at Stanford University, where he has been on the faculty since 1976. He received his M.D. from Harvard Medical School. Professor Stryer has received many awards for his research, including the Eli Lilly Award for Fundamental Research in Biological Chemistry (1970) and the Distinguished Inventors Award of the Intellectual Property Owners' Association. He was elected to the National Academy of Sciences in 1984. Professor Stryer was formerly the President and Scientific Director of the Affymax Research Institute. He is a founder and a member of the Scientific Advisory Board of Senomyx, a company that is using biochemical knowledge to develop new and improved flavor and fragrance molecules for use in consumer products. The publication of the first edition of his text Biochemistry in 1975 transformed the teaching of biochemistry. Preface For more than 25 years, and through four editions, Stryer's Biochemistry has laid out this beautiful subject in an exceptionally appealing and lucid manner. The engaging writing style and attractive design have made the text a pleasure for our students to read and study throughout our years of teaching. Thus, we were delighted to be given the opportunity to participate in the revision of this book. The task has been exciting and somewhat daunting, doubly so because of the dramatic changes that are transforming the field of biochemistry as we move into the twenty-first century. Biochemistry is rapidly progressing from a science performed almost entirely at the laboratory bench to one that may be explored through computers. The recently developed ability to determine entire genomic sequences has provided the data needed to accomplish massive comparisons of derived protein sequences, the results of which may be used to formulate and test hypotheses about biochemical function. The power of these new methods is explained by the impact of evolution: many molecules and biochemical pathways have been generated by duplicating and modifying existing ones. Our challenge in writing the fifth edition of Biochemistry has been to introduce this philosophical shift in biochemistry while maintaining the clear and inviting style that has distinguished the preceding four editions.Figure 9.44 A New Molecular Evolutionary Perspective How should these evolution-based insights affect the teaching of biochemistry? Often macromolecules with a common evolutionary origin play diverse biological roles yet have many structural and mechanistic features in common. An example is a protein family containing macromolecules that are crucial to moving muscle, to transmitting the information that adrenaline is present in the bloodstream, and to driving the formation of chains of amino acids. The key features of such a protein family, presented to the student once in detail, become a model that the student can apply each time that a new member of the family is encountered. The student is then able to focus on how these features, observed in a new context, have been adapted to support other biochemical processes. Throughout the text, a stylized tree icon is positioned at the start of discussions focused primarily on protein homologies and evolutionary origins. Two New Chapters. To enable students to grasp the power of these insights, two completely new chapters have been added. The first, "Biochemical Evolution" (Chapter 2), is a brief tour from the origin of life to the development of multicellular organisms. On one level, this chapter provides an introduction to biochemical molecules and pathways and their cellular context. On another level, it attempts to deepen student understanding by examining how these molecules and pathways arose in response to key biological challenges. In addition, the evolutionary perspective of Chapter 2 makes some apparently peculiar aspects of biochemistry more reasonable to students. For example, the presence of ribonucleotide fragments in biochemical cofactors can be accounted for by the likely occurrence of an early world based largely on RNA. The second new chapter, "Exploring Evolution" (Chapter 7), develops the conceptual basis for the comparison of protein and nucleic acid sequences. This chapter parallels "Exploring Proteins" (Chapter 4) and "Exploring Genes" (Chapter 6), which have thoughtfully examined experimental techniques in earlier editions. Its goal is to enable students to use the vast information available in sequence and structural databases in a critical and effective manner. Organization of the Text. The evolutionary approach influences the organization of the text, which is divided into four major parts. As it did in the preceding edition, Part I introduces the language of biochemistry and the structures of the most important classes of biological molecules. The remaining three parts correspond to three major evolutionary challenges namely, the interconversion of different forms of energy, molecular reproduction, and the adaptation of cells and organisms to changing environments. This arrangement parallels the evolutionary path outlined in Chapter 2 and naturally flows from the simple to the more complex. PART I, the molecular design of life, introduces the most important classes of biological macromolecules, including proteins, nucleic acids, carbohydrates, and lipids, and presents the basic concepts of catalysis and enzyme action. Here are two examples of how an evolutionary perspective has shaped the material in these chapters: Chapter 9 , on catalytic strategies, examines four classes of enzymes that have evolved to meet specific challenges: promoting a fundamentally slow chemical reaction, maximizing the absolute rate of a reaction, catalyzing a reaction at one site but not at many alternative sites, and preventing a deleterious side reaction. In each case, the text considers the role of evolution in fine-tuning the key property. Chapter 13 , on membrane channels and pumps, includes the first detailed three-dimensional structures of an ion channel and an ion pump. Because most other important channels and pumps are evolutionarily related to these proteins, these two structures provide powerful frameworks for examining the molecular basis of the action of these classes of molecules, so important for the functioning of the nervous and other systems. PART II, transducing and storing energy, examines pathways for the interconversion of different forms of energy. Chapter 15, on signal transduction, looks at how DNA fragments encoding relatively simple protein modules, rather than entire proteins, have been mixed and matched in the course of evolution to generate the wiring that defines signal-transduction pathways. The bulk of Part II discusses pathways for the generation of ATP and other energy-storing molecules. These pathways have been organized into groups that share common enzymes. The component reactions can be examined once and their use in different biological contexts illustrated while these reactions are fresh in the students' minds. Chapter 16 covers both glycolysis and gluconeogenesis. These pathways are, in some ways, the reverse of each other, and a core of enzymes common to both pathways catalyze many of the steps in the center of the pathways. Covering the pathways together makes it easy to illustrate how free energy enters to drive the overall process either in the direction of glucose degradation or in the direction of glucose synthesis. Chapter 17, on the citric acid cycle, ties together through evolutionary insights the pyruvate dehydrogenase complex, which feeds molecules into the citric acid cycle, and the α-ketoglutarate dehydrogenase complex, which catalyzes one of the key steps in the cycle itself.Figure 15.34 Oxidative phosphorylation, in Chapter 18 , is immediately followed in Chapter 19 by the light reactions of photosynthesis to emphasize the many common chemical features of these pathways. The discussion of the light reactions of photosynthesis in Chapter 19 leads naturally into a discussion of the dark reactions that is, the components of the Calvin cycle in Chapter 20. This pathway is naturally linked to the pentose phosphate pathway, also covered in Chapter 20 , because in both pathways common enzymes interconvert three-, four-, five-, six-, and seven-carbon sugars. PART III, synthesizing the molecules of life, focuses on the synthesis of biological macromolecules and their components. Chapter 24, on the biosynthesis of amino acids, is linked to the preceding chapter on amino acid degradation by a family of enzymes that transfer amino groups to and from the carbon frameworks of amino acids. Chapter 25 covers the biosynthesis of nucleotides, including the role of amino acids as biosynthetic precursors. A key evolutionary insight emphasized here is that many of the enzymes in these pathways are members of the same family and catalyze analogous chemical reactions. The focus on enzymes and reactions common to these biosynthetic pathways allows students to understand the logic of the pathways, rather than having to memorize a set of seemingly unrelated reactions. Chapters 27, 28, and 29 cover DNA replication, recombination, and repair; RNA synthesis and splicing; and protein synthesis. Evolutionary connections between prokaryotic systems and eukaryotic systems reveal how the basic biochemical processes have been adapted to function in more-complex biological systems. The recently elucidated structure of the ribosome gives students a glimpse into a possible early RNA world, in which nucleic acids, rather than proteins, played almost all the major roles in catalyzing important pathways. PART IV, responding to environmental changes, looks at how cells sense and adapt to changes in their environments. Part IV examines, in turn, sensory systems, the immune system, and molecular motors and the cytoskeleton. These chapters illustrate how signaling and response processes, introduced earlier in the text, are integrated in multicellular organisms to generate powerful biochemical systems for detecting and responding to environmental changes. Again, the adaptation of proteins to new roles is key to these discussions. Integrated Chemical Concepts We have attempted to integrate chemical concepts throughout the text. They include the mechanistic basis for the action of selected enzymes, the thermodynamic basis for the folding and assembly of proteins and other macromolecules, and the structures and chemical reactivity of the common cofactors. These fundamental topics underlie our understanding of all biological processes. Our goal is not to provide an encyclopedic examination of enzyme reaction mechanisms. Instead, we have selected for examination at a more detailed chemical level specific topics that will enable students to understand how the chemical features help meet the biological needs. Chemical insight often depends on a clear understanding of the structures of biochemical molecules. We have taken considerable care in preparing stereochemically accurate depictions of these molecules where appropriate. These structures should make it easier for the student to develop an intuitive feel for the shapes of molecules and comprehension of how these shapes affect reactivity. Newly Updated to Include Recent Discoveries Given the breathtaking pace of modern biochemistry, it is not surprising that there have been major developments since the publication of the fourth edition. Foremost among them is the sequencing of the human genome and the genomes of many simpler organisms. The text's evolutionary framework allows us to naturally incorporate information from these historic efforts. The determination of the three-dimensional structures of proteins and macromolecular assemblies also has been occurring at an astounding pace. As noted earlier, the discussion of excitable membranes in Chapter 13 incorporates the detailed structures of an ion channel (the prokaryotic potassium channel) and an ion pump (the sacroplasmic reticulum calcium ATPase). Figure 9.21 Great excitement has been generated in the signal transduction field by the first determination of the structure of a seven-transmembrane-helix receptor the visual system protein rhodopsin discussed in Chapters 15 and 32 The ability to describe the processes of oxidative phosphorylation in Chapter 18 has been greatly aided by the determination of the structures for two large membrane protein complexes: cytochrome c oxidase and cytochrome bc 1. Recent discoveries regarding the three-dimensional structure of ATP synthase are covered in Chapter 18 , including the remarkable fact that parts of the enzyme rotate in the course of catalysis. The determination of the structure of the ribosome transforms the discussion of protein synthesis in Chapter 29. The elucidation of the structure of the nucleosome core particle a large protein DNA complex facilitates the description in Chapter 31 of key processes in eukaryotic gene regulation. Finally, each of the three chapters in Part IV is based on recent structural conquests. The ability to grasp key concepts in sensory systems ( Chapter 32 ) is aided by the structures of rhodopsin and the aforementioned ion channel. Chapter 33 , on the immune system, now includes the more recently determined structure of the T-cell receptor and its complexes. The determination of the structures of the molecular motor proteins myosin and kinesin first revealed the evolutionary connections on which Chapter 34 , on molecular motors, is based. New and Improved Illustrations The relation of structure and function has always been a dominant theme of Biochemistry. This relation becomes even clearer to students using the fifth edition through the extensive use of molecular models. These models are superior to those in the fourth edition in several ways. All have been designed and rendered by one of us (JMB), with the use of MOLSCRIPT, to emphasize the most important structural features. The philosophy of the authors is that the reader should be able to write the caption from looking at the picture. We have chosen ribbon diagrams as the most effective, clearest method of conveying molecular structure. All molecular diagrams are rendered in a consistent style. Thus students are able to compare structures easily and to develop familiarity and facility in interpreting the models. Labels highlight key features of the molecular models. Many new molecular models have been added, serving as sources of structural insight into additional molecules and in some cases affording multiple views of the same molecule. In addition to the molecular models, the fifth edition includes more diagrams providing an overview of pathways and processes and setting processes in their biological context. New Pedagogical Features The fifth edition of Biochemistry supplies additional tools to assist students in learning the subject matter. Icons. Icons are used to highlight three categories of material, making these topics easier to locate for the interested student or teacher. A caduceus signals the beginning of a clinical application. A stylized tree marks sections or paragraphs that primarily or exclusively explore evolutionary aspects of biochemistry. A mouse and finger point to references to animations on the text's Web site (www.whfreeman.com/ biochem5) for those students who wish to reinforce their understanding of concepts by using the electronic media. More Problems. The number of problems has increased by 50%. Four new categories of problem have been created to develop specific skills. Mechanism problems ask students to suggest or elaborate a chemical mechanism. Data interpretation problems ask questions about a set of data provided in tabulated or graphic form. These exercises give students a sense of how scientific conclusions are reached. Chapter integration problems require students to use information from multiple chapters to reach a solution. These problems reinforce awareness of the interconnectedness of the different aspects of biochemistry. Media problems encourage and assist students in taking advantage of the animations and tutorials provided on our Web site. Media problems are found both in the book and on our Web site.Figure 15.23 New Chapter Outline and Key Terms. An outline at the beginning of each chapter gives major headings and serves as a framework for students to use in organizing the information in the chapter. The major headings appear again in the chapter's summary, again helping to organize information for easier review. A set of key terms also helps students focus on and review the important concepts.Figure 17.4 Preface Tools and Techniques The fifth edition of Biochemistry offers three chapters that present the tools and techniques of biochemistry: "Exploring Proteins" (Chapter 4), "Exploring Genes" (Chapter 6), and "Exploring Evolution" (Chapter 7). Additional experimental techniques are presented elsewhere throughout the text, as appropriate. Exploring Proteins (Chapter 4) Protein purification Section 4.1 Differential centrifugation Section 4.1.2 Salting out Section 4.1.3 Dialysis Section 4.1.3 Gel-filtration chromatography Section 4.1.3 Ion-exchange chromatography Section 4.1.3 Affinity chromatography Section 4.1.3 High-pressure liquid chromatography Section 4.1.3 Gel electrophoresis Section 4.1.4 Isoelectric focusing Section 4.1.4 Two-dimensional electrophoresis Section 4.1.4 Qualitative and quantitative evaluation of protein purification Section 4.1.5 Ultracentrifugation Section 4.1.6 Mass spectrometry (MALDI-TOF) Section 4.1.7 Peptide mass fingerprinting Section 4.1.7 Edman degradation Section 4.2 Protein sequencing Section 4.2 Production of polyclonal antibodies Section 4.3.1 Production of monoclonal antibodies Section 4.3.2 Enzyme-linked immunosorbent assay (ELISA) Section 4.3.3 Western blotting Section 4.3.4 Fluorescence microscopy Section 4.3.5 Green fluorescent protein as a marker Section 4.3.5 Immunoelectron microscopy Section 4.3.5 Automated solid-phase peptide synthesis Section 4.4 Nuclear magnetic resonance spectroscopy Section 4.5.1 NOESY spectroscopy Section 4.5.1 X-ray crystallography Section 4.5.2 Exploring Proteins (other chapters) Basis of fluorescence in green fluorescent protein Section 3.6.5 Time-resolved crystallography Section 8.3.2 Using fluorescence spectroscopy to analyze enzyme substrate interactions Section 8.3.2 Using irreversible inhibitors to map the active site Section 8.5.2 Using transition state analogs to study enzyme active sites Section 8.5.3 Catalytic antibodies as enzymes Section 8.5.4 Exploring Genes (Chapter 6) Restriction-enzyme analysis Sections 6.1.1 and 6.1.2 Southern and Northern blotting techniques Section 6.1.2 Sanger dideoxy method of DNA sequencing Section 6.1.3 Solid-phase analysis of nucleic acids Section 6.1.4 Polymerase chain reaction (PCR) Section 6.1.5 Recombinant DNA technology Sections 6.2-6.4 DNA cloning in bacteria Sections 6.2.2 and 6.2.3 Chromosome walking Section 6.2.4 Cloning of eukaryotic genes in bacteria Section 6.3.1 Examining expression levels (gene chips) Section 6.3.2 Introducing genes into eukaryotes Section 6.3.3 Transgenic animals Section 6.3.4 Gene disruption Section 6.3.5 Tumor-inducing plasmids Section 6.3.6 Site-specific mutagenesis Section 6.4 Exploring Genes (other chapters) Density-gradient equilibrium sedimentation Section 5.2.2 Footprinting technique for isolating and characterizing promoter sites Section 28.1.1 Chromatin immunoprecipitation (ChIP) Section 31.2.3 Exploring Evolution (Chapter 7) Sequence-comparison methods Section 7.2 Sequence-alignment methods Section 7.2 Estimating the statistical significance of alignments (by shuffling) Section 7.2.1 Substitution matrices Section 7.2.2 Sequence templates Section 7.3.2 Self-diagonal plots for finding repeated motifs Section 7.3.3 Mapping secondary structures through RNA sequence comparisons Section 7.3.5 Construction of evolutionary trees Section 7.4 Combinatorial chemistry Section 7.5.2 Other Techniques Sequencing of carbohydrates by using MALDI-TOF mass spectrometry Section 11.3.7 Use of liposomes to investigate membrane permeability Section 12.4.1 Use of hydropathy plots to locate transmembrane helices Section 12.5.4 Fluorescence recovery after photobleaching (FRAP) for measuring lateral diffusion in membranes Section 12.6 Patch-clamp technique for measuring channel activity Section 13.5.1 Measurement of redox potential Section 18.2.1 Functional magnetic resonance imaging (fMRI) Section 32.1.3 Animated Techniques: Animated explanations of experimental techniques used for exploring genes and proteins are available at www.whfreeman.com/biochem5 Preface Clinical Applications This icon signals the start of a clinical application in the text. Additional, briefer clinical correlations appear without the icon in the text as appropriate. Prion diseases Section 3.6.1 Scurvy and collagen stabilization Section 3.6.5 Antigen detection with ELISA Section 4.3.3 Vasopressin deficiency Section 4.4 Action of penicillin Section 8.5.5 Water-soluble vitamins Section 8.6.1 Fat-soluble vitamins in blood clotting and vision Section 8.6.2 Protease inhibitors Section 9.1.7 Carbonic anhydrase and osteopetrosis Section 9.2 Use of isozymes to diagnose tissue damage Section 10.3 Emphysema Section 10.5.4 Thromboses prevention Section 10.5.7 Hemophilia Section 10.5.8 Regulation of blood clotting Section 10.5.9 Blood groups Section 11.2.5 Antibiotic inhibitors of glycosylation Section 11.3.3 I-cell disease Section 11.3.5 Selectins and the inflammatory response Section 11.4.1 Influenza virus Section 11.4.2 Clinical uses of liposomes Section 12.4.1 Aspirin and ibuprofen Section 12.5.2 Digitalis and congestive heart failure Section 13.2.3 Multidrug resistance and cystic fibrosis Section 13.3 Protein kinase inhibitors as anticancer drugs Section 15.5.1 Cholera and whooping cough Section 15.5.2 Lactose intolerance Section 16.1.12 Galactose toxicity Section 16.1.13 Cancer and glycolysis Section 16.2.5 Phosphatase deficiency and lactic acidosis Section 17.2.1 Beriberi and poisoning by mercury and arsenic Section 17.3.2 Mitochondrial diseases Section 18.6.5 Hemolytic anemia Section 20.5.1 Glucose 6-phosphate dehydrogenase deficiency Section 20.5.2 Glycogen-storage diseases Section 21.5.4 Steatorrhea in liver disease Section 22.1.1 Carnitine deficiency Section 22.2.3 Zellweger syndrome Section 22.3.4 Diabetic ketosis Section 22.3.6 Use of fatty acid synthase inhibitors as drugs Section 22.4.9 Effects of aspirin on signaling pathways Section 22.6.2 Cervical cancer and ubiquitin Section 23.2.1 Protein degradation and the immune response Section 23.2.3 Inherited defects of the urea cycle (hyperammonemia) Section 23.4.4 Inborn errors of amino acid degradation Section 23.6 High homocysteine levels and vascular disease Section 24.2.9 Inherited disorders of porphyrin metabolism Section 24.4.4 Anticancer drugs that block the synthesis of thymidylate Section 25.3.3 Pellagra Section 25.5 Gout Section 25.6.1 Lesch-Nyhan syndrome Section 25.6.2 Disruption of lipid metabolism as the cause of respiratory distress syndrome and Tay-Sachs disease Section 26.1.6 Diagnostic use of blood cholesterol levels Section 26.3.2 Hypercholesteremia and atherosclerosis Section 26.3.5 Clinical management of cholesterol levels Section 26.3.6 Rickets and vitamin D Section 26.4.7 Antibiotics that target DNA gyrase Section 27.3.4 Defective repair of DNA and cancer Section 27.6.5 Huntington chorea Section 27.6.6 Detection of carcinogens (Ames test) Section 27.6.7 Antibiotic inhibitors of transcription Section 28.1.9 Burkitt lymphoma and B-cell leukemia Section 28.2.6 Thalassemia Section 28.3.3 Antibiotics that inhibit protein synthesis Section 29.5.1 Diphtheria Section 29.5.2 Prolonged starvation Section 30.3.1 Diabetes Section 30.3.2 Regulating body weight Section 30.3.3 Metabolic effects of ethanol Section 30.5 Anabolic steroids Section 31.3.3 SERMs and breast cancer Section 31.3.3 Color blindness Section 32.3.5 Use of capsaicin in pain management Section 32.5.1 Immune system suppressants Section 33.4.3 MHC and transplantation rejection Section 33.5.6 AIDS vaccine Section 33.5.7 Autoimmune diseases Section 33.6.2 Immune system and cancer Section 33.6.3 Myosins and deafness Section 34.2.1 Kinesins and nervous system disorders Section 34.3 Taxol Section 34.3.1 Preface Molecular Evolution This icon signals the start of many discussions that highlight protein commonalities or other molecular evolutionary insights that provide a framework to help students organize information. Why this set of 20 amino acids? Section 3.1 Many exons encode protein domains Section 5.6.2 Catalytic triads in hydrolytic enzymes Section 9.1.4 Major classes of peptide-cleaving enzymes Section 9.1.6 Zinc-based active sites in carbonic anhydrases Section 9.2.4 A common catalytic core in type II restriction enzymes Section 9.3.4 P-loop NTPase domains Section 9.4.4 Fetal hemoglobin Section 10.2.3 A common catalytic core in protein kinases Section 10.4.3 Why might human blood types differ? Section 11.2.5 Evolutionarily related ion pumps Section 13.2 P-type ATPases Section 13.2.2 ATP-binding cassette domains Section 13.3 Secondary transporter families Section 13.4 Acetylcholine receptor subunits Section 13.5.2 Sequence comparisons of sodium channel cDNAs Section 13.5.4 Potassium and sodium channel homologies Section 13.5.5 Using sequence comparisons to understand sodium and calcium channels Section 13.5.7 Evolution of metabolic pathways Section 14.3.4 How Rous sarcoma virus acquired its oncogene Section 15.5 Recurring features of signal-transduction pathways Section 15.6 Why is glucose a prominent fuel? Section 16.0.1 A common binding site in dehydrogenases Section 16.1.10 The major facilitator (MF) superfamily of transporters Section 16.2.4 Isozymic forms of lactate dehydrogenase Section 16.4.2 Evolutionary relationship of glycolysis and gluconeogenesis Section 16.4.3 Decarboxylation of α-ketoglutarate and pyruvate Section 17.1.6 Evolution of succinyl CoA synthetase Section 17.1.7 Evolutionary history of the citric acid cycle Section 17.3.3 Endosymbiotic origins of mitochondria Section 18.1.2 Conservation of cytochrome c structure Section 18.3.7 Common features of ATP synthase and G proteins Section 18.4.5 Related uncoupling proteins Section 18.6.4 Evolution of chloroplasts Section 19.1.2 Evolutionary origins of photosynthesis Section 19.6 Evolution of the C4 pathway Section 20.2.3 Increasing sophistication of glycogen phosphorylase regulation Section 21.3.3 The α-amylase family Section 21.4.3 A recurring motif in the activation of carboxyl groups Section 22.2.2 Polyketide and nonribosomal peptide synthetases resemble fatty acid synthase Section 22.4.10 Prokaryotic counterparts of the ubiquitin pathway and the proteasome Section 23.2.4 A family of pyridoxal-dependent enzymes Section 23.3.3 Evolution of the urea cycle Section 23.4.3 The P-loop NTPase domain in nitrogenase Section 24.1.1 Recurring steps in purine ring synthesis Section 25.2.3 Ribonucleotide reductases Section 25.3 Increase in urate levels during primate evolution Section 25.6.1 The cytochrome P450 superfamily Section 26.4.3 DNA polymerases Section 27.2.1 Helicases Section 27.2.5 Evolutionary relationship of recombinases and topoisomerases Section 27.5.2 Similarities in transcriptional machinery between archaea and eukaryotes Section 28.2.4 Evolution of spliceosome-catalyzed splicing Section 28.2.4 Classes of aminoacyl-tRNA synthetases Section 29.2.5 Composition of the primordal ribosome Section 29.3.1 Evolution of molecular mimics Section 29.4.4 A family of proteins with common ligand-binding domains Section 31.1.4 Independent evolution of DNA-binding sites of regulatory proteins Section 31.1.5 CpG islands Section 31.2.5 Iron response elements Section 31.4.2 The odorant receptor family Section 32.1.1 Evolution of taste receptor mRNA Section 32.2.5 Photoreceptor evolution Section 32.3.4 The immunoglobulin fold Section 33.2 Relationship of actin to hexokinase and other prokaryotic proteins Section 34.2.2 Tubulins in the P-loop NTPase family Section 34.3.1 Preface Supplements Supporting Biochemistry, Fifth Edition The fifth edition of Biochemistry offers a wide selection of high-quality supplements to assist students and instructors. For the Instructor Print and Computerized Test Banks NEW Marilee Benore Parsons, University of Michigan-Dearborn Print Test Bank 0-7167-4384-1; Computerized Test Bank CD-ROM (Windows/Macintosh hybrid) 0-7167-4386-8 The test bank offers more than 1700 questions posed in multiple choice, matching, and short-answer formats. The electronic version of the test bank allows instructors to easily edit and rearrange the questions or add their own material. Instructor's Resource CD-ROM NEW © W. H. Freeman and Company and Sumanas, Inc. 0-7167-4385-X The Instructor's Resource CD-ROM contains all the illustrations from the text. An easy-to-use presentation manager application, Presentation Manager Pro, is provided. Each image is stored in a variety of formats and resolutions, from simple jpg and gif files to preformatted PowerPoint slides, for instructors using other presentation programs. Overhead Transparencies 0-7167-4422-8 Full-color illustrations from the text, optimized for classroom projection, in one volume. For the Student Student Companion Richard I. Gumport, College of Medicine at Urbana-Champaign, University of Illinois; Frank H. Deis, Rutgers University; and Nancy Counts Gerber, San Fransisco State University. Expanded solutions to text problems provided by Roger E. Koeppe II, University of Arkansas 0-7167-4383-3 More than just a study guide, the Student Companion is an essential learning resource designed to meet the needs of students at all levels. Each chapter starts with a summarized abstract of the related textbook chapter. A comprehensive list of learning objectives allows students to quickly review the key concepts. A self-test feature allows students to quickly refresh their understanding, and a set of additional problems requires students to apply their knowledge of biochemistry. The complete solution to every problem in the text is provided to help students better comprehend the core ideas. Individual chapters of the Student Companion can be purchased and downloaded from www.whfreeman.com/biochem5 Clinical Companion NEW Kirstie Saltsman, Ph.D., Jeremy M. Berg, M.D., and Gordon Tomaselli, M.D., Johns Hopkins University School of Medicine 0-7167-4738-3 Designed for students and instructors interested in clinical applications, the Clinical Companion is a rich compendium of medical case studies and clinical discussions. It contains numerous problems and references to the textbook. Such topics as glaucoma, cystic fibrosis, Tay-Sachs disease, and autoimmune diseases are covered from a biochemical perspective. Lecture Notebook NEW 0-7167-4682-4 For students who find that they are too busy writing notes to pay attention in class, the Lecture Notebook brings together a black-and-white collection of illustrations from the text, arranged in the order of their appearance in the textbook, with plenty of room alongside for students to take notes. Experimental Biochemistry, Third Edition Robert L. Switzer, University of Illinois, and Liam F. Garrity, Pierce Chemical Corporation 0-7167-3300-5 The new edition of Experimental Biochemistry has been completely revised and updated to make it a perfect fit for today's laboratory course in biochemistry. It provides comprehensive coverage of important techniques used in contemporary biochemical research and gives students the background theory that they need to understand the experiments. Thoroughly classroom tested, the experiments incorporate the full range of biochemical materials in an attempt to simulate work in a research laboratory. In addition, a comprehensive appendix provides detailed procedures for preparation of reagents and materials, as well as helpful suggestions for the instructor. Also Available Through the W. H. Freeman Custom Publishing Program Experimental Biochemistry is designed to meet all your biochemistry laboratory needs. Visit http://custompub. whfreeman.com to learn more about creating your own laboratory manual. Student Media Resources This icon links materials from the book to our Web site. See the inside front cover for a complete description of the resources available at www.whfreeman.com/ biochem5. W. H. Freeman and Company is proud to present a weekly collection of abstracts and a monthly featured article from the Nature family of journals, including Nature, its associated monthly titles, and the recently launched Nature Review Journals. Please visit www.whfreeman.com/biochem5 for more information. Acknowledgments There is an old adage that says that you never really learn a subject until you teach it. We now know that you learn a subject even better when you write about it. Preparing the fifth edition of Biochemistry has provided us with a wonderful opportunity to unite our love of biochemistry and teaching and to share our enthusiasm with students throughout the world. Nonetheless, the project has also been a daunting one because so many interesting discoveries have been made since the publication of the fourth edition. The question constantly confronted us: What biochemical knowledge is most worth having? Answering this question required attempting to master as much of the new material as possible and then deciding what to include and, even harder, what to exclude. However, we did not start from scratch. We feel both fortunate and intimidated to be writing the fifth edition of Stryer's Biochemistry. Fortunate, because we had as our starting point the best biochemistry book ever produced. Intimidated, because we had as our starting point the best biochemistry book ever produced, with the challenge of improving it. To the extent that we have succeeded, we have done so because of the help of many people. Thanks go first and foremost to our students at Johns Hopkins University and Carleton College. Not a word was written or an illustration constructed without the knowledge that bright, engaged students would immediately detect vagueness or ambiguity. One of us (JMB) especially thanks the members of the Berg lab who have cheerfully tolerated years of neglect and requests to review drafts of illustrations when they would rather have been discussing their research. Particular thanks go to Dr. Barbara Amann and Kathleen Kolish who helped preserve some order in the midst of chaos. We also thank our colleagues at Johns Hopkins University and Carleton College who supported, advised, instructed, and simply bore with us during this arduous task. One of us (JLT) was graciously awarded a grant from Carleton College to relieve him of some of his academic tasks so that he could focus more fully on the book. We are also grateful to our colleagues throughout the world who served as reviewers for the new edition. Their thoughtful comments, suggestions, and encouragement have been of immense help to us in maintaining the excellence of the preceding editions. These reviewers are: Mark Alper University of California at Berkeley L. Mario Amzel Johns Hopkins University Paul Azari Colorado State University Ruma Banerjee University of Nebraska Michael Barbush Baker University Douglas Barrick Johns Hopkins University Loran L. Bieber Michigan State University Margaret Brosnan University of Newfoundland Lukas K. Buehler University of California at San Diego C. Allen Bush University of Maryland, Baltimore County Tom Cech Howard Hughes Medical Institute Oscar P. Chilson Washington University Steven Clarke University of California at Los Angeles Philip A. Cole Johns Hopkins University School of Medicine Paul A. Craig Rochester Institute of Technology David L. Daleke Indiana University David Deamer University of California at Santa Cruz Frank H. Deis Rutgers University Eric S. Eberhardt Vassar College Duane C. Eichler University of San Francisco School of Medicine Stephen H. Ellis Auburn University Nuran Ercal University of Missouri at Rolla Gregg B. Fields Florida Atlantic University Gregory J. Gatto Jr. Johns Hopkins University Nancy Counts Gerber San Francisco State University Claiborne Glover III University of Georgia E. M. Gregory Virginia Polytechnic Institute and State University Mark Griep University of Nebraska at Lincoln Hebe M. Guardiola-Diaz Trinity College James R. Heitz Mississippi State University Neville R. Kallenbach New York University Harold Kasinsky University of British Columbia Dan Kirschner Boston College G. Barrie Kitto University of Texas at Austin James F. Koerner University of Minnesota John Koontz University of Tennessee Gary R. Kunkel Texas A&M University David O. Lambeth University of North Dakota Timothy Logan Florida State University Douglas D. McAbee California State University at Long Beach William R. Marcotte Jr. Clemson University Alan Mellors University of Guelph Dudley G. Moon Albany College of Pharmacy Kelley W. Moremen University of Georgia Scott Napper University of Saskatchewan Jeremy Nathans Johns Hopkins University School of Medicine James W. Phillips University of Health Sciences Terry Platt University of Rochester Medical Center Gary J. Quigley Hunter College, City University of New York Carl Rhodes Howard Hughes Medical Institute Gale Rhodes University of Southern Maine Mark Richter University of Kansas Anthony S. Serianni University of Notre Dame Ann E. Shinnar Barnard College Jessup M. Shively Clemson University Roger D. Sloboda Dartmouth College Carolyn M. Teschke University of Connecticut Dean R. Tolan Boston University Gordon Tollin University of Arizona Jeffrey M. Voigt Albany College of Pharmacy M. Gerard Waters Princeton University Linette M. Watkins Southwest Texas State University Gabriele Wienhausen University of California at San Diego James D. Willett George Mason University Gail R. Willsky State University of New York at Buffalo Dennis Winge University of Utah Charles F. Yocum University of Michigan Working with our colleagues at W. H. Freeman and Company has been a wonderful experience. We would especially like to acknowledge the efforts of the following people. Our development editor, Susan Moran, contributed immensely to the success of this project. During this process, Susan became a committed biochemistry student. Her understanding of how the subject matter, text, and illustrations, would be perceived by students and her commitment to excellence were a true inspiration. Our project editor, Georgia Lee Hadler, managed the flow of the entire project from manuscript to final product sometimes with a velvet glove and other times more forcefully, but always effectively. The careful manuscript editor, Patricia Zimmerman, enhanced the text's literary consistency and clarity. Designers Vicki Tomaselli and Patricia McDermond produced a design and layout that are organizationally clear and aesthetically pleasing. The tireless search of our photo researchers, Vikii Wong and Dena Betz, for the best possible photographs has contributed effectively to the clarity and appeal of the text. Cecilia Varas, the illustration coordinator, ably oversaw the rendering of hundreds of new illustrations, and Julia DeRosa, the production manager, astutely handled all the difficulties of scheduling, composition, and manufacturing. Neil Clarke of Johns Hopkins University, Sonia DiVittorio, and Mark Santee piloted the media projects associated with the book. Neil's skills as a teacher and his knowledge of the power and pitfalls of computers, Sonia's editing and coordination skills and her stylistic sense, and Mark's management of an ever-changing project have made the Web site a powerful supplement to the text and a lot of fun to explore. We want to acknowledge the media developers who transformed scripts into the animations you find on our Web site. For the Conceptual Insights modules we thank Nick McLeod, Koreen Wykes, Dr. Roy Tasker, Robert Bleeker, and David Hegarty, all at CADRE design. For the threedimensional molecular visualizations in the Structural Insights modules we thank Timothy Driscoll (molvisions. com 3D molecular visualization). Daniel J. Davis of the University of Arkansas at Fayetteville prepared the online quizzes. Publisher Michelle Julet was our cheerleader, taskmaster, comforter, and cajoler. She kept us going when we were tired, frustrated, and discouraged. Along with Michelle, marketing mavens John Britch and Carol Coffey introduced us to the business of publishing. We also thank the sales people at W. H. Freeman and Company for their excellent suggestions and view of the market, especially Vice President of Sales Marie Schappert, David Kennedy, Chris Spavins, Julie Hirshman, Cindi Weiss-Goldner, Kimberly Manzi, Connaught Colbert, Michele Merlo, Sandy Manly, and Mike Krotine. We thank Elizabeth Widdicombe, President of W. H. Freeman and Company, for never losing faith in us. Finally, the project would not have been possible without the unfailing support of our families especially our wives, Wendie Berg and Alison Unger. Their patience, encouragement, and enthusiasm have made this endeavor possible. We also thank our children, Alex, Corey, and Monica Berg and Janina and Nicholas Tymoczko, for their forbearance and good humor and for constantly providing us a perspective on what is truly important in life. I. The Molecular Design of Life Part of a lipoprotein particle. A model of the structure of apolipoprotein A-I (yellow), shown surrounding sheets of lipids. The apolipoprotein is the major protein component of high-density lipoprotein particles in the blood. These particles are effective lipid transporters because the protein component provides an interface between the hydrophobic lipid chains and the aqueous environment of the bloodstream. [Based on coordinates provided by Stephen Harvey.] I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution GACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTT CAGAGGGTAAAAATTAAGCACAGTGGAAGAATTTCATTC TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAG AAAATATCTTTGGTGTTTCCTATGATGAATATAGATACAG AAGCGTCATCAAAGCATGCCAACTAGAAGAG.... This string of letters A, C, G, and T is a part of a DNA sequence. Since the biochemical techniques for DNA sequencing were first developed more than three decades ago, the genomes of dozens of organisms have been sequenced, and many more such sequences will be forthcoming. The information contained in these DNA sequences promises to shed light on many fascinating and important questions. What genes in Vibrio cholera, the bacterium that causes cholera, for example, distinguish it from its more benign relatives? How is the development of complex organisms controlled? What are the evolutionary relationships between organisms? Sequencing studies have led us to a tremendous landmark in the history of biology and, indeed, humanity. A nearly complete sequence of the entire human genome has been determined. The string of As, Cs, Gs, and Ts with which we began this book is a tiny part of the human genome sequence, which is more than 3 billion letters long. If we included the entire sequence, our opening sentence would fill more than 500,000 pages. The implications of this knowledge cannot be overestimated. By using this blueprint for much of what it means to be human, scientists can begin the identification and characterization of sequences that foretell the appearance of specific diseases and particular physical attributes. One consequence will be the development of better means of diagnosing and treating diseases. Ultimately, physicians will be able to devise plans for preventing or managing heart disease or cancer that take account of individual variations. Although the sequencing of the human genome is an enormous step toward a complete understanding of living systems, much work needs to be done. Where are the functional genes within the sequence, and how do they interact with one another? How is the information in genes converted into the functional characteristics of an organism? Some of our goals in the study of biochemistry are to learn the concepts, tools, and facts that will allow us to address these questions. It is indeed an exciting time, the beginning of a new era in biochemistry. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution Disease and the genome. Studies of the human genome are revealing disease origins and other biochemical mysteries. Human chromosomes, left, contain the DNA molecules that constitute the human genome. The staining pattern serves to identify specific regions of a chromosome. On the right is a diagram of human chromosome 7, with band q31.2 indicated by an arrow. A gene in this region encodes a protein that, when malfunctioning, causes cystic fibrosis. [(Left) Alfred Pasieka/Peter Arnold.] I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function The structure of DNA, an abbreviation for d eoxyribo n ucleic a cid, illustrates a basic principle common to all biomolecules: the intimate relation between structure and function. The remarkable properties of this chemical substance allow it to function as a very efficient and robust vehicle for storing information. We begin with an examination of the covalent structure of DNA and its extension into three dimensions. 1.1.1. DNA Is Constructed from Four Building Blocks DNA is a linear polymer made up of four different monomers. It has a fixed backbone from which protrude variable substituents (Figure 1.1). The backbone is built of repeating sugar-phosphate units. The sugars are molecules of deoxyribose from which DNA receives its name. Joined to each deoxyribose is one of four possible bases: adenine (A), cytosine (C), guanine (G), and thymine (T). All four bases are planar but differ significantly in other respects. Thus, the monomers of DNA consist of a sugar- phosphate unit, with one of four bases attached to the sugar. These bases can be arranged in any order along a strand of DNA. The order of these bases is what is displayed in the sequence that begins this chapter. For example, the first base in the sequence shown is G (guanine), the second is A (adenine), and so on. The sequence of bases along a DNA strand constitutes the genetic information the instructions for assembling proteins, which themselves orchestrate the synthesis of a host of other biomolecules that form cells and ultimately organisms. 1.1.2. Two Single Strands of DNA Combine to Form a Double Helix Most DNA molecules consist of not one but two strands (Figure 1.2). How are these strands positioned with respect to one another? In 1953, James Watson and Francis Crick deduced the arrangement of these strands and proposed a three- dimensional structure for DNA molecules. This structure is a double helix composed of two intertwined strands arranged such that the sugar-phosphate backbone lies on the outside and the bases on the inside. The key to this structure is that the bases form specific base pairs (bp) held together by hydrogen bonds (Section 1.3.1): adenine pairs with thymine (A- T) and guanine pairs with cytosine (G-C), as shown in Figure 1.3. Hydrogen bonds are much weaker than covalent bonds such as the carbon-carbon or carbon-nitrogen bonds that define the structures of the bases themselves. Such weak bonds are crucial to biochemical systems; they are weak enough to be reversibly broken in biochemical processes, yet they are strong enough, when many form simultaneously, to help stabilize specific structures such as the double helix. The structure proposed by Watson and Crick has two properties of central importance to the role of DNA as the hereditary material. First, the structure is compatible with any sequence of bases. The base pairs have essentially the same shape (Figure 1.4) and thus fit equally well into the center of the double-helical structure. Second, because of base- pairing, the sequence of bases along one strand completely determines the sequence along the other strand. As Watson and Crick so coyly wrote: "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material." Thus, if the DNA double helix is separated into two single strands, each strand can act as a template for the generation of its partner strand through specific base-pair formation (Figure 1.5). The three-dimensional structure of DNA beautifully illustrates the close connection between molecular form and function. 1.1.3. RNA Is an Intermediate in the Flow of Genetic Information An important nucleic acid in addition to DNA is r ibo n ucleic a cid (RNA). Some viruses use RNA as the genetic material, and even those organisms that employ DNA must first convert the genetic information into RNA for the information to be accessible or functional. Structurally, RNA is quite similar to DNA. It is a linear polymer made up of a limited number of repeating monomers, each composed of a sugar, a phosphate, and a base. The sugar is ribose instead of deoxyribose (hence, RNA) and one of the bases is uracil (U) instead of thymine (T). Unlike DNA, an RNA molecule usually exists as a single strand, although significant segments within an RNA molecule may be double stranded, with G pairing primarily with C and A pairing with U. This intrastrand base-pairing generates RNA molecules with complex structures and activities, including catalysis. RNA has three basic roles in the cell. First, it serves as the intermediate in the flow of information from DNA to protein, the primary functional molecules of the cell. The DNA is copied, or transcribed, into messenger RNA (mRNA), and the mRNA is translated into protein. Second, RNA molecules serve as adaptors that translate the information in the nucleic acid sequence of mRNA into information designating the sequence of constituents that make up a protein. Finally, RNA molecules are important functional components of the molecular machinery, called ribosomes, that carries out the translation process. As will be discussed in Chapter 2, the unique position of RNA between the storage of genetic information in DNA and the functional expression of this information as protein as well as its potential to combine genetic and catalytic capabilities are indications that RNA played an important role in the evolution of life. 1.1.4. Proteins, Encoded by Nucleic Acids, Perform Most Cell Functions A major role for many sequences of DNA is to encode the sequences of proteins, the workhorses within cells, participating in essentially all processes. Some proteins are key structural components, whereas others are specific catalysts (termed enzymes) that promote chemical reactions. Like DNA and RNA, proteins are linear polymers. However, proteins are more complicated in that they are formed from a selection of 20 building blocks, called amino acids, rather than 4. The functional properties of proteins, like those of other biomolecules, are determined by their three-dimensional structures. Proteins possess an extremely important property: a protein spontaneously folds into a welldefined and elaborate three-dimensional structure that is dictated entirely by the sequence of amino acids along its chain (Figure 1.6). The self-folding nature of proteins constitutes the transition from the one-dimensional world of sequence information to the three-dimensional world of biological function. This marvelous ability of proteins to self assemble into complex structures is responsible for their dominant role in biochemistry. How is the sequence of bases along DNA translated into a sequence of amino acids along a protein chain? We will consider the details of this process in later chapters, but the important finding is that three bases along a DNA chain encode a single amino acid. The specific correspondence between a set of three bases and 1 of the 20 amino acids is called the genetic code. Like the use of DNA as the genetic material, the genetic code is essentially universal; the same sequences of three bases encode the same amino acids in all life forms from simple microorganisms to complex, multicellular organisms such as human beings. Knowledge of the functional and structural properties of proteins is absolutely essential to understanding the significance of the human genome sequence. For example, the sequence at the beginning of this chapter corresponds to a region of the genome that differs in people who have the genetic disorder cystic fibrosis. The most common mutation causing cystic fibrosis, the loss of three consecutive Ts from the gene sequence, leads to the loss of a single amino acid within a protein chain of 1480 amino acids. This seemingly slight difference a loss of 1 amino acid of nearly 1500 creates a life-threatening condition. What is the normal function of the protein encoded by this gene? What properties of the encoded protein are compromised by this subtle defect? Can this knowledge be used to develop new treatments? These questions fall in the realm of biochemistry. Knowledge of the human genome sequence will greatly accelerate the pace at which connections are made between DNA sequences and disease as well as other human characteristics. However, these connections will be nearly meaningless without the knowledge of biochemistry necessary to interpret and exploit them. Cystic fibrosis- A disease that results from a decrease in fluid and salt secretion by a transport protein referred to as the cystic fibrosis transmembrane conductance regulator (CFTR). As a result of this defect, secretion from the pancreas is blocked, and heavy, dehydrated mucus accumulates in the lungs, leading to chronic lung infections. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.1. Covalent Structure of DNA. Each unit of the polymeric structure is composed of a sugar (deoxyribose), a phosphate, and a variable base that protrudes from the sugar-phosphate backbone. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.2. The Double Helix. The double-helical structure of DNA proposed by Watson and Crick. The sugar- phosphate backbones of the two chains are shown in red and blue and the bases are shown in green, purple, orange, and yellow. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.3. Watson-Crick Base Pairs. Adenine pairs with thymine (A-T), and guanine with cytosine (G-C). The dashed lines represent hydrogen bonds. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.4. Base-Pairing in DNA. The base-pairs A-T (blue) and C-G (red) are shown overlaid. The Watson-Crick base- pairs have the same overall size and shape, allowing them to fit neatly within the double helix. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.5. DNA Replication. If a DNA molecule is separated into two strands, each strand can act as the template for the generation of its partner strand. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.1. DNA Illustrates the Relation between Form and Function Figure 1.6. Folding of a Protein. The three-dimensional structure of a protein, a linear polymer of amino acids, is dictated by its amino acid sequence. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.2. Biochemical Unity Underlies Biological Diversity The stunning variety of living systems (Figure 1.7) belies a striking similarity. The common use of DNA and the genetic code by all organisms underlies one of the most powerful discoveries of the past century namely, that organisms are remarkably uniform at the molecular level. All organisms are built from similar molecular components distinguishable by relatively minor variations. This uniformity reveals that all organisms on Earth have arisen from a common ancestor. A core of essential biochemical processes, common to all organisms, appeared early in the evolution of life. The diversity of life in the modern world has been generated by evolutionary processes acting on these core processes through millions or even billions of years. As we will see repeatedly, the generation of diversity has very often resulted from the adaptation of existing biochemical components to new roles rather than the development of fundamentally new biochemical technology. The striking uniformity of life at the molecular level affords the student of biochemistry a particularly clear view into the essence of biological processes that applies to all organisms from human beings to the simplest microorganisms. On the basis of their biochemical characteristics, the diverse organisms of the modern world can be divided into three fundamental groups called domains: Eukarya (eukaryotes), Bacteria (formerly Eubacteria), and Archaea (formerly Archaebacteria). Eukarya comprise all macroscopic organisms, including human beings as well as many microscopic, unicellular organisms such as yeast. The defining characteristic of eukaryotes is the presence of a well-defined nucleus within each cell. Unicellular organisms such as bacteria, which lack a nucleus, are referred to as prokaryotes. The prokaryotes were reclassified as two separate domains in response to Carl Woese's discovery in 1977 that certain bacteria-like organisms are biochemically quite distinct from better-characterized bacterial species. These organisms, now recognized as having diverged from bacteria early in evolution, are archaea. Evolutionary paths from a common ancestor to modern organisms can be developed and analyzed on the basis of biochemical information. One such path is shown in Figure 1.8. By examining biochemistry in the context of the tree of life, we can often understand how particular molecules or processes helped organisms adapt to specific environments or life styles. We can ask not only what biochemical processes take place, but also why particular strategies appeared in the course of evolution. In addition to being sources of historical insights, the answers to such questions are often highly instructive with regard to the biochemistry of contemporary organisms. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.2. Biochemical Unity Underlies Biological Diversity Figure 1.7. The Diversity of Living Systems. The distinct morphologies of the three organisms shown-a plant (the false hellebora, or Indian poke) and two animals (sea urchins and a common house cat)-might suggest that they have little in common. Yet biochemically they display a remarkable commonality that attests to a common ancestry. [(Left and right) John Dudak/Phototake. (Middle) Jeffrey L. Rotman/Peter Arnold.] I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.2. Biochemical Unity Underlies Biological Diversity Figure 1.8. The Tree of Life. A possible evolutionary path from a common ancestral cell to the diverse species present in the modern world can be deduced from DNA sequence analysis. I. The Molecular Design of Life 1. Prelude: Biochemistry and the Genomic Revolution 1.3. Chemical Bonds in Biochemistry The essence of biological processes the basis of the uniformity of living systems is in its most fundamental sense molecular interactions; in other words, the chemistry that takes place between molecules. Biochemistry is the chemistry that takes place within living systems. To truly understand biochemistry, we need to understand chemical bonding. We review here the types of chemical bonds that are important for biochemicals and their transformations. The strongest bonds that are present in biochemicals are covalent bonds, such as the bonds that hold the atoms together within the individual bases shown in Figure 1.3. A covalent bond is formed by the sharing of a pair of electrons between adjacent atoms. A typical carbon-carbon (C-C) covalent bond has a bond length of 1.54 Å and bond energy of 85 kcal mol-1 (356 kJ mol-1). Because this energy is relatively high, considerable energy must be expended to break covalent bonds. More than one electron pair can be shared between two atoms to form a multiple covalent bond. For example, three of the bases in Figure 1.4 include carbon-oxygen (C=O) double bonds. These bonds are even stronger than C-C single bonds, with energies near 175 kcal mol-1 (732 kJ mol-1). For some molecules, more than one pattern of covalent bonding can be written. For example, benzene can be written in two equivalent ways called resonance structures. Benzene's true structure is a composite of its two resonance structures. A molecule that can be written as several resonance structures of approximately equal energies has greater stability than does a molecule without multiple resonance structures. Thus, because of its resonance structures, benzene is unusually stable. Chemical reactions entail the breaking and forming of covalent bonds. The flow of electrons in the course of a reaction can be depicted by curved arrows, a method of representation called "arrow pushing." Each arrow represents an electron pair. 1.3.1. Reversible Interactions of Biomolecules Are Mediated by Three Kinds of Noncovalent Bonds Readily reversible, noncovalent molecular interactions are key steps in the dance of life. Such weak, noncovalent forces play essential roles in the faithful replication of DNA, the folding of proteins into intricate three-dimensional forms, the specific recognition of substrates by enzymes, and the detection of molecular signals. Indeed, all biological structures and processes depend on the interplay of noncovalent interactions as well as covalent ones. The three fundamental noncovalent bonds are electrostatic interactions, hydrogen bonds, and van der Waals interactions. They differ in geometry, strength, and specificity. Furthermore, these bonds are greatly affected in different ways by the presence of water. Let us consider the characteristics of each: 1. Electrostatic interactions. An electrostatic interaction depends on the electric charges on atoms. The energy of an electrostatic interaction is given by Coulomb's law: where E is the energy, q 1 and q 2 are the charges on the two atoms (in units of the electronic charge), r is the distance between the two atoms (in angstroms), D is the dielectric constant (which accounts for the effects of the intervening medium), and k is a proportionality constant (k = 332, to give energies in units of kilocalories per mole, or 1389, for energies in kilojoules per mole). Thus, the electrostatic interaction between two atoms bearing single opposite charges separated by 3 Å in water (which has a dielectric constant of 80) has an energy of 1.4 kcal mol-1 (5.9 kJ mol-1). 2. Hydrogen bonds. Hydrogen bonds are relatively weak interactions, which nonetheless are crucial for biological macromolecules such as DNA and proteins. These interactions are also responsible for many of the properties of water that make it such a special solvent. The hydrogen atom in a hydrogen bond is partly shared between two relatively electronegative atoms such as nitrogen or oxygen. The hydrogen-bond donor is the group that includes both the atom to which the hydrogen is more tightly linked and the hydrogen atom itself, whereas the hydrogen-bond acceptor is the atom less tightly linked to the hydrogen atom (Figure 1.9). Hydrogen bonds are fundamentally electrostatic interactions. The relatively electronegative atom to which the hydrogen atom is covalently bonded pulls electron density away from the hydrogen atom so that it develops a partial positive charge ( δ +). Thus, it can interact with an atom having a partial negative charge ( δ -) through an electrostatic interaction. Hydrogen bonds are much weaker than covalent bonds. They have energies of 1 3 kcal mol-1 (4 13 kJ mol-1) compared with approximately 100 kcal mol-1 (418 kJ mol-1) for a carbon-hydrogen covalent bond. Hydrogen bonds are also somewhat longer than are covalent bonds; their bond distances (measured from the hydrogen atom) range from 1.5 to 2.6 Å; hence, distances ranging from 2.4 to 3.5 Å separate the two nonhydrogen atoms in a hydrogen bond. The strongest hydrogen bonds have a tendency to be approximately straight, such that the hydrogen-bond donor, the hydrogen atom, and the hydrogen-bond acceptor lie along a straight line. 3. van der Waals interactions. The basis of a van der Waals interaction is that the distribution of electronic charge around an atom changes with time. At any instant, the charge distribution is not perfectly symmetric. This transient asymmetry in the electronic charge around an atom acts through electrostatic interactions to induce a complementary asymmetry in the electron distribution around its neighboring atoms. The resulting attraction between two atoms increases as they come closer to each other, until they are separated by the van der Waals contact distance (Figure 1.10). At a shorter distance, very strong repulsive forces become dominant because the outer electron clouds overlap. Energies associated with van der Waals interactions are quite small; typical interactions contribute from 0.5 to 1.0 kcal mol-1 (from 2 to 4 kJ mol-1) per atom pair. When the surfaces of two large molecules come together, however, a large number of atoms are in van der Waals contact, and the net effect, summed over many atom pairs, can be substantial. 1.3.2. The Properties of Water Affect the Bonding Abilities of Biomolecules Weak interactions are the key means by which molecules interact with one another enzymes with their substrates, hormones with their receptors, antibodies with their antigens. The strength and specificity of weak interactions are highly dependent on the medium in which they take place, and the majority of biological interactions take place in water. Two properties of water are especially important biologically: 1. Water is a polar molecule. The water molecule is bent, not linear, and so the distribution of charge is asymmetric. The oxygen nucleus draws electrons away from the hydrogen nuclei, which leaves the region around the hydrogen nuclei with a net positive charge. The water molecule is thus an electrically polar structure. 2. Water is highly cohesive. Water molecules interact strongly with one another through hydrogen bonds. These interactions are apparent in the structure of ice (Figure 1.11). Networks of hydrogen bonds hold the structure together; simi-lar interactions link molecules in liquid water and account for the cohesion of liquid water, although, in the liquid state, some of the hydrogen bonds are broken. The highly cohesive nature of water dramatically affects the interactions between molecules in aqueous solution. What is the effect of the properties of water on the weak interactions discussed in Section 1.3.1? The polarity and hydrogen-bonding capability of water make it a highly interacting molecule. Water is an excellent solvent for polar molecules. The reason is that water greatly weakens electrostatic forces and hydrogen bonding between polar molecules by competing for their attractions. For example, consider the effect of water on hydrogen bonding between a carbonyl group and the NH group of an amide. A hydrogen atom of water can replace the amide hydrogen atom as a hydrogen-bond donor, whereas the oxygen atom of water can replace the carbonyl oxygen atom as a hydrogen-bond acceptor. Hence, a strong hydrogen bond between a CO group and an NH group forms only if water is excluded. The dielectric constant of water is 80, so water diminishes the strength of electrostatic attractions by a factor of 80 compared with the strength of those same interactions in a vacuum. The dielectric constant of water is unusually high because of its polarity and capacity to form oriented solvent shells around ions. These oriented solvent shells produce electric fields of their own, which oppose the fields produced by the ions. Consequently, the presence of water markedly weakens electrostatic interactions between ions. The existence of life on Earth depends critically on the capacity of water to dissolve a remarkable array of polar molecules that serve as fuels, building blocks, catalysts, and information carriers. High concentrations of these polar molecules can coexist in water, where they are free to diffuse and interact with one another. However, the excellence of water as a solvent poses a problem, because it also weakens interactions between polar molecules. The presence of water- free microenvironments within biological systems largely circumvents this problem. We will see many examples of these specially constructed niches in protein molecules. Moreover, the presence of water with its polar nature permits another kind of weak interaction to take place, one that drives the folding of proteins (Section 1.3.4) and the formation of cell boundaries (Section 12.4). The essence of these interactions, like that of all interactions in biochemistry, is energy. To understand much of biochemistry bond formation, molecular structure, enzyme catalysis we need to understand energy. Thermodynamics provides a valuable tool for approaching this topic. We will revisit this topic in more detail when we consider enzymes (Chapter 8) and the basic concepts of metabolism (Chapter 14). 1.3.3. Entropy and the Laws of Thermodynamics The highly structured, organized nature of living organisms is apparent and astonishing. This organization extends from the organismal through the cellular to the molecular level. Indeed, biological processes can seem magical in that the well- ordered structures and patterns emerge from the chaotic and disordered world of inanimate objects. However, the organization visible in a cell or a molecule arises from biological events that are subject to the same physical laws that govern all processes in particular, the laws of thermodynamics. How can we understand the creation of order out of chaos? We begin by noting that the laws of thermodynamics make a distinction between a system and its surroundings. A system is defined as the matter within a defined region of space. The matter in the rest of the universe is called the surroundings. The First Law of Thermodynamics states that the total energy of a system and its surroundings is constant. In other words, the energy content of the universe is constant; energy can be neither created nor destroyed. Energy can take different forms, however. Heat, for example, is one form of energy. Heat is a manifestation of the kinetic energy associated with the random motion of molecules. Alternatively, energy can be present as potential energy, referring to the ability of energy to be released on the occurrence of some process. Consider, for example, a ball held at the top of a tower. The ball has considerable potential energy because, when it is released, the ball will develop kinetic energy associated with its motion as it falls. Within chemical systems, potential energy is related to the likelihood that atoms can react with one another. For instance, a mixture of gasoline and oxygen has much potential energy because these molecules may react to form carbon dioxide and release energy as heat. The First Law requires that any energy released in the formation of chemical bonds be used to break other bonds, be released as heat, or be stored in some other form. Another important thermodynamic concept is that of entropy. Entropy is a measure of the level of randomness or disorder in a system. The Second Law of Thermodynamics states that the total entropy of a system and its surroundings always increases for a spontaneous process. At first glance, this law appears to contradict much common experience, particularly about biological systems. Many biological processes, such as the generation of a well-defined structure such as a leaf from carbon dioxide gas and other nutrients, clearly increase the level of order and hence decrease entropy. Entropy may be decreased locally in the formation of such ordered structures only if the entropy of other parts of the universe is increased by an equal or greater amount. An example may help clarify the application of the laws of thermodynamics to a chemical system. Consider a container with 2 moles of hydrogen gas on one side of a divider and 1 mole of oxygen gas on the other (Figure 1.12). If the divider is removed, the gases will intermingle spontaneously to form a uniform mixture. The process of mixing increases entropy as an ordered arrangement is replaced by a randomly distributed mixture. Other processes within this system can decrease the entropy locally while increasing the entropy of the universe. A spark applied to the mixture initiates a chemical reaction in which hydrogen and oxygen combine to form water: If the temperature of the system is held constant, the entropy of the system decreases because 3 moles of two differing reactants have been combined to form 2 moles of a single product. The gas now consists of a uniform set of indistinguishable molecules. However, the reaction releases

Biochemistry by Stryer PDF

Document Details

Tags

Related

Summary

Full Transcript

Upgrade to continue