BIOL 112 Unit 3 Practice Questions 2023-2024 PDF

BIOL 112: Unit 3 Practice Questions =================================== **Updated 2023-2024T2** This document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you could answer ea...

BIOL 112: Unit 3 Practice Questions =================================== **Updated 2023-2024T2** This document contains some questions for you to practice. The questions are grouped by topic. We encourage you to use the learning objectives to guide your studying; ask yourself if you could answer each objective if it was in the form of a question. There are different levels of questions provided: 1. **Study questions**: these are questions on your direct knowledge of the topics, so essentially covers the basics & helps you practice to make sure you get the fundamentals. Work with these questions first to build up your skills. 2. **Exam Style questions:** Can be multiple choice, multiple answers: these are the types of questions you are likely to see on the exam -- various levels of application of the fundamental knowledge and skills for each topic area. **\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_** Unit 3-1: DNA replication *in vivo* -- inside cells --------------------------------------------------- ### Exam Type Questions 1. Which of the following statements about DNA synthesis is TRUE? A. B. C. D. 2. The leading strand is the daughter strand that has its \_\_\_\_ end pointed toward the replication fork and is therefore synthesized \_\_\_\_\_\_. A. B. C. D. E. 3. What catalyzes DNA synthesis? A. B. C. D. E. 4. Which of the following choices describes the function of DNA Polymerase? A. Opens up double-stranded DNA to make it single stranded. B. Re-winds the old and new strand together after replication. C. Catalyzes the linking of dATP, dCTP, dGTP and dTTP in a specific order, using single stranded DNA as a template. D. Fuses intermediate length DNA segments into longer segments. 5. A defect occurs during replication where DNA replication proceeds without the RNA primers being removed and replaced with DNA. Which enzyme is most likely to be defective in this system? A. RNA primase B. helicase C. single strand binding protein D. a DNA polymerase (technically DNA Polymerase I) E. DNA ligase 6. In a DNA double helix an adenine of one strand always pairs with a(n)\_\_\_\_\_\_ of the complementary strand, and a guanine of one strand always pairs with a(n)\_\_\_\_\_\_ of the complementary strand. A. B. C. D. E. 7. After DNA replication is complete, \_\_\_\_\_\_\_\_. A. Each new DNA double helix consists of two new strands B. One DNA double helix consists of two old strands and one double helix consists of two new strands. C. There are four double helices D. Each of the four DNA strands consist of some old strand parts and some new strand parts. E. Each new double helix consists of one old DNA strand and one new DNA strand. 8. A parental DNA strand is used as a \_\_\_\_\_\_\_\_\_\_\_\_\_\_\_\_ for the assembly of a new daughter DNA strand. A. Primer B. Complement C. Model D. Source of nucleotides E. Template 9. When we say that DNA replication is semiconservative, we mean that: A. B. C. D. ### ORQ-Style Questions 10. Put the following steps of DNA replication on the lagging strand in chronological order.**\ **\ A. Single-stranded binding proteins attach to the DNA strands.\ B. Hydrogen bonds between base-pairs of the DNA strands are broken.\ C. Primase binds to the single strand DNA.\ D. DNA polymerase elongates the primer.\ E. A short RNA primer is created. B, A, C, E, D - Describe three major challenges faced by both bacteria and eukaryotic cells in replicating their DNA, and how the challenges are overcome. - [Challenge 1]: Strand separation -- separation of the double stranded DNA by breaking the H-bonds, to allow DNA Pol to bind to the single-stranded template DNA and synthesize the complementary daughter strand. This is achieved by specialized proteins (enzymes) called Helicases. - [Challenge 2]: DNA Polymerase needs a primer to start synthesis -- dealt with by the enzyme RNA Polymerase (Primase) synthesizing RNA primers that the DNA Pol can use to extend. - [Challenge 3]: DNA replication machinery makes mistakes introducing mutations -- dealt with by having proof reading capacity and DNA repair machinery. 11. Making connections: Comparing DNA Polymerase vs. RNA polymerase +-----------------------+-----------------------+-----------------------+ | | DNA polymerase | RNA polymerase | +-----------------------+-----------------------+-----------------------+ | Are primers required? | yes | no | +-----------------------+-----------------------+-----------------------+ | Type of nucleotide | DNA nucleotides: ATCG | RNA nucleotides: AUCG | | required | | | +-----------------------+-----------------------+-----------------------+ | Direction of movement | Reads the template | Reads the template | | | from 3'to 5' | from | | | | | | | | 3' to 5' | +-----------------------+-----------------------+-----------------------+ | Process starts at | 3' | 3' | | which end: | | | +-----------------------+-----------------------+-----------------------+ Unit 3-2: DNA replication in vitro -- Polymerase chain reaction (PCR) --------------------------------------------------------------------- ### Study exercise: ***Learning Objective: Describe the three key steps in polymerase chain reactions; denaturation, annealing, and extension, and explain what role these play in the replication of DNA in a test tube*** 1. Fill in your answers in the empty boxes beside the questions: -------------- ----------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------- **PCR Step** **What occurs during this step?** **Why is this step important for DNA replication?** Denaturation Heat breaks the hydrogen bonds holding double-stranded DNA together and separates it into single strands of DNA This step mimics what helicase does during DNA replication *in vivo* by separating the double-stranded DNA into single strands, which allows other proteins to bind Annealing Primers bind to their complementary sequence on the strands of the template DNA DNA polymerase cannot synthesize DNA without a primer Extension DNA polymerase adds dNTPs to the 3' ends of the primers that is complementary to the template DNA DNA polymerase must bind to the correct region and read the template DNA correctly in order to replicate the region of interest -------------- ----------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------- ***Learning Objectives: List the components needed (in a test tube) to start a PCR amplification experiment and describe the role of the four deoxyribonucleoside triphosphates (dNTPs) used in DNA synthesis (dATP, dGTP, dCTP, dTTP).*** 2. Fill in your answers in the empty boxes beside the questions: ------------------------------------------------ ---------------------------------------------------------------------------------------------------------- **List the 4 components required for a PCR:** **Describe its function in a PCR:** DNA template Serves as a "template" for DNA polymerase in order to replicate the region of interest All four deoxynucleoside triphosphates (dNTPs) Are added to the 3' end of the primer by DNA polymerase and is complementary to the template DNA DNA polymerase Reads the template DNA and extends the primer by adding dNTPs that are complementary to the template DNA Primers Bind near to (flank) the region of interest and is required for DNA polymerase to start synthesis ------------------------------------------------ ---------------------------------------------------------------------------------------------------------- The remaining learning objectives will be addressed using the following example: 3. You are a graduate student in a lab and your supervisor has asked you to replicate a specific region of interest (highlighted in yellow) in a sample of bacterial DNA shown below. CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT What information is missing from the sample of DNA that you need in order to design the right primers? ----------------------------------------------------------------------- The directionality of the DNA i.e. the location of the 5' and 3' ends ----------------------------------------------------------------------- Your supervisor gives you one end of the DNA as shown below. Label the rest of the ends. 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' ***Learning Objective: Construct a representation of template DNA, primers, and their orientation to each other using the directionality of DNA and predict what primers would be needed to amplify a given piece of double-stranded DNA*** 4. Now that you know the directionality of the DNA, highlight in blue the bases of DNA that would be best for your primers (about 7 bases long) to bind in order to amplify the region of interest? (Hint: Remember primers are oriented with their 3' ends towards each other) 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' What are the sequences of the primers (about 7 bases long) that could be used in this experiment and their directionality? (Hint: Remember primers bind antiparallel and complementary to the DNA strand) Primer 1: ------------------- 5' - CTACGCG - 3' ------------------- Primer 2: ---------------------------------------- 3' - CTCGTGA - 5' OR 5' - AGTGCTC - 3' ---------------------------------------- ***Learning Objectives: Identify the structural "end" of a DNA molecule where dNTPs are added during DNA synthesis and predict what products of an amplification reaction given locations of primers on a DNA*** 5. Your supervisor now asks you to run the PCR experiment. Draw what the DNA would look like after the denaturation step. +-----------------------------------------------------------------------+ | Strands would be separated. Regions of interest are highlighted in | | yellow. | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | +-----------------------------------------------------------------------+ Now draw what the DNA would look like after the annealing step (Hint: where do the primers bind?): +-----------------------------------------------------------------------+ | Primers are highlighted in blue. | | | | 5'-CTACGCG-3' | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | | | | 3'-CTCGTGA-5' | +-----------------------------------------------------------------------+ Finally, what would the DNA look like after the extension step (Hint: how far along the template DNA does DNA polymerase extend the primers?): +-----------------------------------------------------------------------+ | Primers are highlighted in blue. Extended DNA is highlighted in pink. | | | | 5'-CTACGCGCGCAATTATTACGAGCACTGATCAGCAAT-3' | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | | | | 3'-CAATTCGGATGCGCGCGTTAATAATGCTCGTGA-5' | +-----------------------------------------------------------------------+ Given the products (DNA sequences) generated from the first cycle of a PCR experiment, what products (DNA sequences) would you expect to find in the next cycle of a PCR experiment? Again show what would happen during the denaturation step (Hint: use the DNA sequences you drew after the extension step): +-----------------------------------------------------------------------+ | Primer sequences are highlighted in blue. Regions of interest are | | highlighted in yellow. Extended DNA from the first cycle of PCR is | | highlighted in pink. | | | | 5'-CTACGCGCGCAATTATTACGAGCACTGATCAGCAAT-3' | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | | | | 3'-CAATTCGGATGCGCGCGTTAATAATGCTCGTGA-5' | +-----------------------------------------------------------------------+ Draw what would happen during the annealing step (Hint: would the primers bind to every strand of DNA?): +-----------------------------------------------------------------------+ | Primer sequences are highlighted in blue. | | | | 3'-CTCGTGA-5' | | | | 5'-CTACGCGCGCAATTATTACGAGCACTGATCAGCAAT-3' | | | | 5'-CTACGCG-3' | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 3'-CTCGTGA-5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | | | | 5'-CTACGCG-3' | | | | 3'-CAATTCGGATGCGCGCGTTAATAATGCTCGTGA-5' | +-----------------------------------------------------------------------+ What about the extension step?: +-----------------------------------------------------------------------+ | Extended DNA from the second cycle of PCR is highlighted in orange. | | | | 3'-GATGCGCGCGTTAATAATGCTCGTGA-5' | | | | 5'-CTACGCGCGCAATTATTACGAGCACTGATCAGCAAT-3' | | | | 5'-CTACGCGCGCAATTATTACGAGCACTGATCAGCAAT-3' | | | | 3' -- CAATTCGGATGCGCGCGTTAATAATGCTCGTGACTAGTCGTTA -- 5' | | | | 3'-CAATTCGGATGCGCGCGTTAATAATGCTCGTGA-5' | | | | 5' -- GTTAAGCCTACGCGCGCAATTATTACGAGCACTGATCAGCAAT -- 3' | | | | 5'-CTACGCGCGCAATTATTACGAGCACT-3' | | | | 3'-CAATTCGGATGCGCGCGTTAATAATGCTCGTGA-5' | +-----------------------------------------------------------------------+ What products (DNA sequences) would you expect to find at the end of the PCR (e.g. after 30 cycles) experiment (Hint: are the primer sequences included in the final product of PCR?): +-----------------------------------------------------------------------+ | Regions of interest are highlighted in yellow. Primers are | | highlighted in blue. | | | | 3' -- GATGCGCGCGTTAATAATGCTCGTGA -- 5' | | | | 5' -- CTACGCGCGCAATTATTACGAGCACT -- 3' | +-----------------------------------------------------------------------+ ### ### MCQ Exam Style Questions: 1. Heating a polymerase chain reaction (PCR) to 95^o^C in each cycle eliminates the need for which of the following proteins involved in DNA replication in a cell?\ \ 1. Single stranded binding proteins\ 2. RNA primase\ 3. Helicase\ 4. Topoisomerase\ 5. Ligase 2. The diagram below shows a DNA region containing a gene in a bacterium. The PCR primer positions (numbered 1, 2, 3, 4, 5) are shown. The numbers of bases in this region are indicated starting at the +1 site for transcription. The arrows indicate the 5' to 3' direction of the primers. If you wanted to amplify the promoter region for this gene, which pair of primers would you use?\ \ +1 = start of transcription\ \ \ \[JaKS2\] 3. A graduate student wants to use PCR to amplify the **promoter and coding region** of the *ABC* gene to do further experiments. Which pair of primers should she pick to amplify the *ABC* gene?\  4. A graduate student wants to use PCR to amplify the **promoter** of the *ABC* gene to do further experiments. Which pair of primers should she pick to amplify the *ABC* gene promoter?\ A. 2 & 6\ B. 2 & 5\ C. 1 & 6\ D. 1 & 5\ E. 1 & 4 5. Which of the following statements is **FALSE** about **both** RNA polymerase and DNA polymerase? (Alternate wording suggestion: Comparing RNA Polymerase and DNA Polymerase, which of the following statements is **FALSE**?)