DNA Replication & Repair PDF

DNA Replication & Repair Chromosomal DNA must be replicated in preparation for mitosis or meiosis. S phase of cell cycle. Very similar mechanisms are used repair it. Error correction while chromosomes are being replicated. Continual repair during the rest of the cell cycle. Initiation Beg...

DNA Replication & Repair Chromosomal DNA must be replicated in preparation for mitosis or meiosis. S phase of cell cycle. Very similar mechanisms are used repair it. Error correction while chromosomes are being replicated. Continual repair during the rest of the cell cycle. Initiation Begins with replication bubble at an origin of replication (ori). Usually a short region of high A/T content. Example: yeast ori are described well. 5’(A/T)TTTA(T/C)(A/G)TTT(A/T)3’ Origin recognition complex (ORC) finds ori and encourages strand separation of dsDNA. Prokaryote Chromosomes Most prokaryotes have a single circular chromosome. One replication bubble is sufficient to replicate a circular chromosome quickly. DNA synthesis proceeds inside the expanding bubble until meeting itself. Prokaryote Replication All DNA in a cell must be faithfully copied when cells divide and reproduce. Easy for tiny prokaryote genomes. E. coli has ~4.6 million base pairs in a single chromosome. Rate of DNA synthesis: ~2000 nt per second (nt/s). E. coli can copy all DNA in ~20 minutes. Given unlimited resources, DNA replication is limiting factor for how quickly prokaryotes can reproduce. Unlimited resources probably rare in nature. Additional ori add no benefit. Eukaryote Replication DNA synthesis is slower for eukaryotes. ~3.2 billion base pairs in human genome. DNA synthesis rate ~100 nt/s. Replicating DNA would take months with only one ori. Eukaryotic chromosomes have 1000s of ori. Mouse genome has ~100,000 possible ori 20,000-30,000 in mouse genome are activated during DNA replication. 1000s of simultaneous replication bubbles.  Eukaryote Bubble Expansion (1) Ori denature along chromosome. (2) Replication bubbles form and expand. (3) Replication bubbles begin to meet. (4) SEM image of process. Major Replication Machines Major cellular components involved in replication: 1. ORC: recognize ori; a complex of initiator proteins. 2. Helicase: breaks H-bonds to unzip dsDNA. 3. SSB: stabilizes ssDNA. 4. Topoisomerase: relaxes supercoiling of dsDNA. 5. Primase: makes short RNA primer needed to initiate DNA synthesis. 6. DNA polymerase: chains nucleotides together, synthesizing new DNA strand. 7. Ligase: joins ribose-phosphate backbones where two new strands meet. DNA Replication 1 (Initiation) ORC recognizes and attaches to ori, separating strands. Helicase attaches to the replication fork. Unzips dsDNA by breaking H-bonds. Topoisomerase relaxes dsDNA coils. dsDNA becomes positively supercoiled ahead of replication fork. SSB proteins stabilizes ssDNA. ssDNA may fold and pair with itself if not stabilized. DNA Replication 2 DNA polymerase III responsible for synthesizing DNA. Can’t start begin a new strand. Primase (DnaG in figure) synthesizes a short RNA primer. Provides a starting point for polymerase. DNA pol III uses 3’ end of RNA primer to add DNA nucleotides. Adds nucleotides to newly synthesized strand in 5’ to 3’ direction. DNA Polymerase Capabilities DNA polymerase CAN: Add nucleotides to 3’ end of DNA. Extend existing strand. DNA polymerase CAN’T: Begin new strand. Add nucleotides to 5’ end of DNA. Free nucleotides are in dNTP form. Deoxynucleotide triphosphate. Energy needed to activate synthesis is on free nucleotide. (ATP is a dNTP) Leading/Lagging Strand Synthesis dsDNA is antiparallel. New ssDNA synthesized 5’ ➔ 3’. Pol travels 3’ ➔ 5’ on ssDNA template. Leading strand: 5’ ➔ 3’ synthesis moves in the direction of replication fork Lagging strand: 5’ ➔ 3’ synthesis moves opposite of replication fork. Bubble expansion Okazaki Fragments Discontinuous Okazaki fragments form on lagging strand. Direction of replication template is the same direction as bubble expansion. Polymerase synthesizes in the opposite direction of bubble expansion. Pol must continually start over. DNA Replication 3 DNA polymerase I removes RNA primers, including Okazaki fragment primers. 5’ to 3’ exonuclease activity. Primase has no proofreading ability. RNA nucleotides are replaced with DNA nucleotides by DNA pol I. DNA pol I can’t complete the “backbone” when encountering the next Okazaki fragment of lagging strand. Leaves “nicks” in lagging strand backbone. DNA Replication 4 DNA polymerases can only put a new nucleotide on the 3’ end of a DNA strand. Can’t join Okazaki fragments. Would require joining 3’ –OH to 5’ phosphate. No energy for this. Ligase recognizes “nicks” in the phosphate- deoxyribose backbone. Creates new deoxyribose-phosphate linkage to make a continuous DNA molecule. Basic Replication Summary dsDNA separated into ssDNA. DNA polymerase “reads” ssDNA templates 3’ ➔ 5’. New DNA synthesized 5’ ➔ 3’ along each template. Continuous DNA synthesis along leading stands in replication fork. Discontinuous DNA synthesis along lagging strands. Semiconservative Replication Each ssDNA strand becomes a template once dsDNA is separated. After replication, each molecule of dsDNA contains: One old piece of ssDNA. One new piece of ssDNA. DNA replication is semiconservative. The Terminus Problem Pol can synthesize leading strand DNA right to the end of chromosomes. Not so for lagging strand. DNA Pol I fills internal gaps by degrading RNA primer. Terminal gap can’t be filled without a 3’ -OH to begin synthesis. Leaves 3’ overhang at both ends of every linear chromosome. DNA with every subsequent replication. Telomeres Short tandem repeats (STR) Repeating motif of 5-8 nucleotides (usually). Motif varies across species. 1000s of nucleotides capping chromosome ends. Non-coding: not part of any genes required to “do” something. DNA can be lost from telomere region without harming gene functions. Human telomeric STRs 10-15 kilobases TTAGGG 5’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG… 3’ Telomerase Activity Carries small RNA molecule. Reverse complement of STR motif. Acts as primer for DNA synthesis. Telomerase anneals to 3’ overhang. Synthesizes a few nucleotides with polymerase activity. Slides 5’ ➔ 3’ to do it again. Telomerase Activity 2 Telomerase dissociates. Primase synthesizes RNA primer. DNA polymerase uses primer to synthesize DNA and fill gap. Ligase seals nicks in backbone. 3’ overhang remains. DNA Polymerase Efficiency Processivity: number of nucleotides that can be synthesized. DNA Replication needs to happen fast. Lots of DNA in a cell. Fidelity: how few mistakes are made during synthesis. DNA replication needs to happen accurately. Mistakes = mutations. Mutations change gene function. In vitro, DNA polymerase is bad at its job. Slow (~1 nt/s). Can only synthesize ~10 nucleotides before falling off. DNA Pol Processivity In vivo, DNA polymerase benefits from the replisome. Complex of replication “machines”. Form larger, coordinated system. Pol III holoenzyme. Leading/lagging strand DNA pols support each other. Coordinate with helicase. Accessory proteins. Increases processivity 1000x. Replisome DNA polymerases on leading and lagging strands form pol dimer at fork. - Joined by catalytic cores. - Increase speed. - Less likely to disassociate. Accessory protein: β-clamp. - Ring of proteins helps DNA pol slide along ssDNA. Other players act independently one site at a time. - ligase, pol I, and topoisomerase. DNA Pol Can’t Read Pol doesn’t read DNA sequence. No memory, no foresight. Nucleotide incorporation is geometrically limited. H-bond interactions cause free nucleotide to fit in place or not. If it fits, it sits. Pol agnostic to nucleotide base differences. DNA Pol Fidelity DNA polymerases can insert nucleotide with the wrong base. ~1 in 100,000 for most organisms. DNA polymerases catch this with proofreading. 3’ to 5’ exonuclease activity. Most errors caught before become incorporated into sequence. Actual mutation rate much lower. Other errors fixed by redundant repair mechanisms. Base-excision repair (BER). Post-replication mismatch repair (MMR). Nucleotide-excision repair (NER). Pol Exonuclease Activity Mismatched bases “felt” by DNA pol. 1. Lesion in backbone causes pol shape change. 2. DNA pol backs up 3’ to 5 one nucleotide. 3. Removes mismatched nucleotide. 4. Continues synthesizing DNA. Base-Excision Repair Most important after pol proofreading. A base that has become chemically altered is recognized by glycoslyase. Glycosylase cleaves base. Creates apurinic/apyrimidic (AP) site. Multiple glycosylases, each specific to the base they remove. Uracil glycosylase, for example. Base-Excision Repair 2 AP endonuclease recognizes AP nucleotide site with no base. Cleaves phosphodiester backbone. Creates gap in DNA backbone. Third protein, dRpase, removes nucleotides. Creates stretch of missing ssDNA. Makes room DNA polymerase. Base-Excision Repair 3 DNA polymerase inserts new nucleotides with correct base. Exactly like during DNA replication. Does not need primer. Ligase seals the nick left behind in the backbone. Ligase won’t seal gap if pol inserted mismatched nucleotides. Process begins again. Mismatch Repair Recognizes mismatched nucleotides after replication. - MutS protein “feels” and binds to distortions in normal double helix. - Triggers replacement of mismatched nucleotide. Example: 5’ G T T C 3’ 3’ T A A G 5’ Mismatch Repair 2 Certain bases carry epigenetic markers. Methylated adenines in prokaryotes. Methylated cytosines in eukaryotes. Presence of methylated markers indicate original template vs new DNA. MutS recruits other Mut proteins, which recognizes methylated base in older DNA. MutH cuts backbone of newer DNA. Methylated DNA Methyl group added to specific carbon in purine/pyrimidine ring. Regulates transcription of genes, turning them on/off. Heritable: passed on through semiconservative replication. Methyltransferases transfer methylated state to new DNA eventually. Mismatch Repair 3 Helicase unwinds DNA around nicked site. Newer DNA containing the mismatch is excised from the region. DNA polymerase synthesizes new DNA. Ligase seals the gap. Nucleotide Excision Repair Bulky lesions can render genes nonfunctional and stall replication. Damage recognition complexes recognize damage beyond base mismatch. Global genomic NER (GG-NER) for stalled replication forks. Transcription coupled NER (TT-NER) for transcription complexes. Nucleotide Excision Repair 2 Damage recognition complexes recruit TFIIH complex of proteins. - Contains two helicases. TFIIH helicases separate DNA on either side of damaged region. - Potentially 2 to 100s of nucleotides apart. Nucleotide Excision Repair 3 Endonucleases cleave phosphodiester bonds of one strand on both sides of lesion. Damaged strand is removed. DNA polymerase fills in missing DNA with reverse complement of remaining strand. Ligase seals gaps in backbone. DNA Repair Mechanisms Repair mechanisms highly redundant. - No repair: 1 in 100,000 errors. - With pol proofreading: 1 in 10,000,000 errors. - With proofreading and BER and MMR for mismatched bases: 1 in 1,000,000,000 replication errors. Repair mechanisms target specific damage. - BER chemically altered bases. - MMR for base mismatches. - NER for bulky lesions. Replication & Repair Summary 1. Origins of replication. 2. Replication machines. 3. Leading/lagging strands in fork. 4. Telomerase. 5. Replisome concept. 6. Pol proofreading. 7. Redundant repair: BER, MMR, & NER.