Recombinant DNA Technology PDF

5 Main Applications of Recombinant DNA Technology - rDNA Technology for the Benefit of Human Health - Increasing Agricultural Productivity - Creating Transgenic animals - rDNA Technology in Forensics - Recombinant DNA Technology and Environment Protection How is R...

5 Main Applications of Recombinant DNA Technology - rDNA Technology for the Benefit of Human Health - Increasing Agricultural Productivity - Creating Transgenic animals - rDNA Technology in Forensics - Recombinant DNA Technology and Environment Protection How is Recombinant DNA Technology beneficial? Introduction to Cloning and Recombinant DNA Technology  What Does It Mean: “To Clone”? Clone: A collection of molecules or cells, all identical to an original molecule or cell v To "clone a gene" is to make many copies of it - for example, by replicating it in a culture of bacteria. v Cloned gene can be a normal copy of a gene (“wild type”). v Cloned gene can be an altered version of a gene (“mutant”). v Recombinant DNA technology makes manipulating genes possible.  Major steps in cloning v Selection and amplification of desired genes/promoters v Restriction enzyme digestion of the gene of interest and vector v Ligation v Transformation Insert (gene of interest) + Plasmid Functional (vector) construct Selection and amplification of desired genes/promoters Selection and amplification of desired genes/promoters If you are cloning out of a known plasmid, just use the sequence that have been available for that plasmid. Example, the protein we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Add a stop codon Selection and amplification of desired genes/promoters v A single DNA molecule can be amplified allowing it to be: § Studied – Sequenced § Manipulated - Mutagenised or Engineered § Expressed - Generation of Protein v Design the primers (forward and reverse) for the desired genes and mass amplify them using Polymerase chain reaction. v Directly transfer the PCR products to the PCR cloning vectors. v If required digest the PCR products with suitable/compatible restriction enzyme and ligate with cloning vectors.  Polymerase chain reaction target DNA 5' 3' 3' 5' Double-stranded DNA 5' 3' Step 1 Denaturation 3' 5' 5' 3' Step 2 Primer annealing 3' 5' 5' 5' 3' 3' 5' 5' Step 3 3' 3' 5' 5' 3' 3' Extension 3' 3' 5' 5' Repeat PCR cycles DNA polymerase always adds nucleotides to the 3’ end of the primer  Design of the Primers Once the insert has got selected, the next step is designing of the primers, based on insert synthesis strategy Three main strategies towards insert synthesis: v PCR amplification v Klenow extension of overlapping primers v Complimentary full-length primers + Insert Vector PCR Amplification of Insert from an Existing Gene The most common method of insert synthesis v Necessitates a pre-existing construct v Extra restriction sites and/or amino acid residues can be added on each side of the gene v Internal mutations are more difficult Insert  Klenow Extension of Overlapping Primers v Two primers that are complimentary in their 3’ region are designed (overlap » 15bp) v Extended to full length by the Klenow fragment of DNA Polymerase I v Useful if insert is 50 to 150 bp 5’ 3’ 3’ 5’ Insert 5’ 3’ 3’ 5’ Klenow Klenow fragment: retains 3’ to 5’ polymerase activity, but does not have exonuclease activity  PCR Synthesis of Insert PCR amplification from overlapping primers v No pre-existing construct is needed v PCR products messy, possibly making subsequent reactions difficult v Good for inserts >150 bp F1: 10x 5’ 3’ F2: 1x 5’ 3’ 5’ 3’ R1: 1x 3’ 5’ R2: 10x Insert Full-length insert should still be the major product  Complementary Full-Length Primers v The simplest approach v Order two primers that complement each other v Mix the two primers, heat, and anneal slowly (to ensure proper base-pairing) v Feasible if the total insert size is < 60 bp 5’ 3’ Anneal 3’ 5’ Insert Restriction enzyme digestion of the gene of interest and vector  Restriction Enzymes v Bacteria have learned to "restrict" the possibility of attack from foreign DNA by means of "restriction enzymes”. v Cut up “foreign” DNA (viral) that invades the bacterial cell. v Bacteria protect their own DNA from the restriction enzymes by methylate those nucleotide sequences. v An enzyme that recognizes a 6-base sequence is called a "six- base cutter”. v They break the phosphodiester bonds that link adjacent nucleotides in DNA molecules.  History v Restriction enzyme word originated from the studies of phage λ and the phenomenon of host-controlled restriction and modification of a bacterial virus. v The phenomenon was first identified by Salvador Luria and Giuseppe Bertani in early 1950s. v It was found that a bacteriophage λ that can grow well in one strain of Escherichia coli, for example E. coli C, when grown in another strain, for example E. coli K, its yields can drop significantly, by as much as 3-5 orders of magnitude. v The E. coli K host cell, known as the restricting host, appears to have the ability to reduce the biological activity of the phage λ. If a phage become established in one strain, the ability of that phage to grow also become restricted in other strains. v In the 1960s, it was shown in work done in the laboratories of Werner Arber and Matthew Meselson that the restriction is caused by an enzymatic cleavage of the phage DNA, and the enzyme involved was therefore termed a restriction enzyme  History v The restriction enzymes studied by Arber and Meselson were type I restriction enzymes which cleave DNA randomly away from the recognition site. v In 1970, Hamilton O. Smith, Thomas Kelly and Kent Welcox isolated and characterized the first type II restriction enzyme, HindII, from the bacterium Haemophilus influenzae. v This type of restriction enzymes is more useful for laboratory use as they cleave DNA at the site of their recognition sequence. It was later shown by Daniel Nathans and Kathleen Danna that cleavage of simian virus 40 (SV40) DNA by restriction enzymes yielded specific fragments which can be separated using polyacrylamide gel electrophoresis, thus showing that restriction enzymes can be used for mapping of the DNA. v For their work in the discovery and characterization of restriction enzymes, the 1978 Nobel Prize for Physiology or Medicine was awarded to Werner Arber, Daniel Nathans, and Hamilton O. Smith.  Restriction enzyme action v Restriction enzyme consists of three subunits for Specificity Modification Restriction v Cofactors required Magnesium ion ATP SAM (S-adenosyl-L-methionine) How does a becterial cell protect its own DNA from restriction enzymes? v by reinforcing bacterial DNA structure with covalent phosphodiester bonds v using DNA ligase to seal the bacterial DNA in a closed circle v by adding methyl groups to adeninee and cytosines v adding histones to protect the double stranded DNA  Types of Restriction endonucleases Type I :- v Possess both cutting (restriction) and protecting activity (modification by methylation). v cuts at random sites v requires ATP to function Type II :- v Possess only cutting (restriction) activity cannot methylate the bases. v Each cuts in a predictable and consistent manner at a site within or adjacent to the recognition sequence. v Requires only magnesium ion to function Type III :- v Possess both cutting (restriction) and protecting activity v cleave at specific sites near to the recognition site which is difficult to predict. v Requires ATP to function  Nomenclature of Restriction endonucleases v First letter: initial letter of the genus name of the organism from which the enzyme is isolated. v Second and third letter: usually initial letters of the organism’s species name. v Fourth letter (if any): indicates a particular strain of organism v Roman numerals: originally indicate the order in which enzymes from the same organism and strain are eluted from chromatography column.  Type II restriction enzyme nomenclature Example EcoRI – Escherichia coli strain R, 1st enzyme BamHI –Bacillus amyloliquefaciens strain H, 1st enzyme DpnI – Diplococcus pneumoniae, 1st enzyme HindIII – Haemophilus influenzae, strain D, 3rd enzyme BglII – Bacillus globigii, 2nd enzyme PstI – Providencia stuartii 164, 1st enzyme Sau3AI – Staphylococcus aureus strain 3A, 1st enzyme KpnI – Klebsiella pneumoniae, 1st enzyme  Basics of type II Restriction Enzymes v No ATP requirement. Cuts usually occurs at a palindromic sequence v Recognition sites in double stranded DNA have a 2- SmaI: produces blunt ends fold axis of symmetry – a 5´ CCCGGG 3´ “palindrome”. 3´ GGGCCC 5´ v Cleavage can leave staggered or "sticky" ends EcoRI: produces sticky ends or can produce "blunt” 5´ GAATTC 3´ ends. 3´ CTTAAG 5´  Results of Type II Digestion Enzymes with staggered cuts ® complementary ends HindIII - leaves 5’ overhangs (“sticky”) 5’ --AAGCTT-- 3’ 5’ --A AGCTT--3’ 3’ --TTCGAA-- 5’ 3’ –TTCGA A--5’ KpnI leaves 3’ overhangs (“sticky”) 5’--GGTACC-- 3’ 5’ –GGTAC C-- 3’ 3’--CCATGG-- 5’ 3’ –C CATGG-- 5’ Sticky ends: Restriction enzyme cleavage results in DNA fragment ends with short single-stranded overhangs.  Results of Type II Digestion Enzymes that cut at same position on both strands leave “blunt” ends SmaI 5’ --CCCGGG-- 3’ 5’ --CCC GGG-- 3’ 3’ --GGGCCC-- 5’ 3’ --GGG CCC-- 5’ Blunt ends: Restriction enzyme cleavage results in DNA fragment ends that are fully base paired.  Star Activity In most practical applications of restriction endonucleases, star activity is not desirable. The practical analysis of number of reports on star activity suggest the following may be the possible reasons for this phenomenon: v Prolonged incubation time or a large excess of enzyme with respect to DNA. v High glycerol concentration (>5%) in the reaction mixture or the presence of other organic solvents, such as ethanol or dimethyl sulfoxide. v Low ionic strength or high pH values in the reaction buffer. v Substitution of cofactor Mg2+ with other divalent cation (such as Mn2+ or Co2+). Isoschizomers and Neoschizomers v Different Restriction endonucleases that recognize and cleave in the same sequence are known as isoschizomers. v Different restriction enzymes that recognize the same sequence but cleaves in different locales of the sequence are known as neoschizomers. DNA Ligation  DNA Ligases DNA ligases close nicks in the phosphodiester backbone of DNA. Two of the most important biologically roles of DNA ligases are: 1. Joining of Okazaki fragments during replication. 2. Completing short-patch DNA synthesis occurring in DNA repair process. There are two classes of DNA ligases: 1. The first uses NAD+ as a cofactor and only found in bacteria. 2. The second uses ATP as a cofactor and found in eukaryotes, viruses and bacteriophages. The smallest known ATP-dependent DNA ligase is the one from the bacteriophage T7 (molecular mass 41 kDa). Eukaryotic DNA ligases may be much larger (human DNA ligase I is > 100 kDa) but they all appear to share some common sequences and probably structural motifs.  DNA Ligase Mechanism DNA ligase forms two covalent phosphodiester bonds between 3’ hydroxyl ends of one nucleotide, ("acceptor") with the 5' phosphate end of another ("donor") in the presence of ATP. The reaction occurs in three stages in all DNA ligases: 1. Formation of a covalent enzyme-AMP intermediate linked to a lysine side-chain in the enzyme. 2. Transfer of the AMP nucleotide to the 5’-phosphate of the nicked DNA strand. 3. Attack on the AMP-DNA bond by the 3’-OH of the nicked DNA sealing the phosphate backbone and resealing AMP. DNA Ligase Mechanism  Bacteriophage T4 DNA ligase Characteristics Molecular mass: Is a single polypeptide with a M.W of 68,000 Dalton. pH: The maximal activity pH range is 7.5-8.0. The enzyme exhibits 40% of its activity at pH 6.9 and 65% at pH 8.3. Ions: The presence of Mg++ ion is required and the optimal concentration is 10mM. Sulfhydryl reagents (DTT, 2-mercapteothanol) are required as well. Concentrations of NaCl that exceeds 200mM are inhibited. Temperature: The optimal incubation temperature for T4 DNA ligase is 16 °C. When very high efficiency ligation is desired (e.g. making libraries) this temperature is highly recommended. However, ligase is active at a broad range of temperatures. For routine purposes such as sub cloning, convenience often dictates incubating time and temperature- ligations performed at 4C overnight or at room temperature for 30 minutes to a couple of hours usually work well. Others: “For intermolecular ligation, especially when the substrate DNAs consist of large DNA molecules PEG (concentrations of 1 % - 10%) appears to stimulate the enzymatic activity”.  DNA Ligase joins DNA fragments together v Enzymes that cut with staggered cuts result in complementary ends that can be ligated together. v HindIII - leaves 5’ overhangs (“sticky”) 5’ --A AGCTT--3’ 5’ --AAGCTT-- 3’ 3’ --TTCGA A--5’ 3’ --TTCGAA-- 5’ v Sticky ends that are complementary (from digests with the same or different enzymes) can be ligated together. v Blunt ends can also be ligated, but the efficiency of the ligation will be less. Any complementary ends can be ligated BamHI -G GATCC- -CCTAG G- BglII -A GATCT- -TCTAG A- Result -GGATCT- No longer palindromic, so -CCTAGA- not cut by BamHI or BglII Practical approaches v The volume of the ligation mixture and the DNA concentration depends on the types of ligation experiments. The ratio between the inserts and the vector should be optimum, higher concentration of the insert DNA will promotes the formation of concatamer ligation products. v Usually for sticky end ligation use 0.25 Units enzyme for one µg DNA whereas for blunt end ligation the enzyme concentration should be 2.5 unit/µg DNA. v The incubation time for the blunt end reaction mixture is 1-16 h whereas for sticky end reaction mixture 1-2 h incubation is required.  Linkers and Adaptors Sticky ends are desirable for DNA cloning experiments. Provided by treating the target and vectors with same restriction enzyme or with different but producing the sticky end. But some time target DNA blunt ended So therefore we will have to use Linkers and Adaptors.  Linkers Synthetic , short and known double stranded oligonucleotides sequence. Having blunted ends on both sides and restriction sites. Treatment with R.E produces sticky ends after ligation with target DNA. e.g. Linker having site for BamHI. Drawback if target DNA also having the same restriction site then? Linkers  Adaptors A Synthetic double stranded Oligonucleotide having blunt end and sticky end. Blunt ends will bind to the blunt ends of target DNA to produce new DNA with sticky ends. Problems: sticky of adaptors will binds with each other so…. Treatment with Alkaline Phosphates. After attachment with target…… treatment Polynucleotide Kinase to add P–OH at 5 prime.  Homopolymer tailing (HT) Homopolymer: A strand composed of one type of nucleotide. HT: the in-vitro addition of the same nucleotide by the enzyme terminal deoxynucleotide transferase to 3’-OH of a duplex DNA molecule. (calf thymus). e.g. Complimentary poly (C) and poly (G) for vector and target DNA respectively. Transformation  Transformation v Transformation is the genetic alteration of a cell resulting from the direct uptake, incorporation and expression of exogenous genetic material (exogenous DNA) from its surroundings and taken up through the cell membrane(s) v It may occur naturally and can be induced artificially. v Transformation is one of three processes by which exogenous genetic material may be introduced into a bacterial cell, the other two being conjugation (transfer of genetic material between two bacterial cells in direct contact), and transduction (injection of foreign DNA by a bacteriophage virus into the host bacterium) Artificial competence for cell transformation v Artificial competence in the cells can be achieved by the chemical treatment or by washing with chilled water. v In case of chemical competence cells are most commonly kept with chilled calcium chloride solution. Mechanism v The divalent cations shield the charges between the negatively charged bacterial surface and the DNA by coordinating the phosphate groups and other negative charges, thereby allowing a DNA molecule to adhere to the cell surface. v Divalent cations in cold condition may also change or weaken the cell surface structure of the cells making it more permeable to DNA Chemical transformation with calcium chloride  Reasons for Performing Each Transformation Step? Ca++ O 1. Transformation solution = Ca++ O P O Base CaCI2 O CH2 O Positive charge of Ca++ Sugar ions shields negative O charge of DNA Ca++ O P O phosphates Base O CH2 O Sugar OH Transformation by electroporation  Biolistic Transformation v DNA is mixed with microscopic (1 to 10 micron diameter) particles of tungsten or gold and the DNA is precipitated onto the particles. v The DNA-coated particles are placed on the end of a larger plastic bullet. v The bullet is loaded into a gun barrel and the target - plant tissue that you want to transform - is positioned at the end of the barrel. v The gun is fired, accelerating the bullet to the end of the barrel.  Biolistic Transformation v A plate with a small hole in the end stops the plastic bullet. v The small, DNA-coated particles maintain momentum and pass through the hole and strike the target.  Biolistic Transformation v Some of the particles will pass through the cell wall and enter individual cells. v Some of the DNA will be released from the particle, end up in the nucleus and integrate into a chromosome, resulting in transformation. v Multiple copies of transgene can lead to silencing v Consumables are expensive  PEG-Mediated Transformation v Digest cells with cellulase to get protoplasts–PEG induces reversible permeabilization of the plasma membrane v PEG (Polyethelene glycol ) is a polymer of ether and a hydrophilic compound. When the protoplast is treated with PEG in the presence of calcium ions, it destabilises the plasma membrane, allowing for the entry of the naked DNA. v Low viability of protoplasts v Low transformation efficiency (1-2%) v Difficult to regenerate Liposome v Targeted DNA encapsulated in a spherical lipid bilayer termed a liposome v In the presence of PEG, endocytosis occurs. v After endocytosis, the DNA is free to recombine and integrate with the host genome Silicon Carbide Fibers v Use silicon carbide fibers to punch holes through cultured plant cells v Silicon carbide fibers and cultured plant cells are added to a tube and vortexed vigorously v The mechanical force generated by the vortex drives the fibers into the cell Microinjection v Uses fine glass needles to inject the foreign DNA directly into the host cell v Developed to inject DNA into protoplasts, cultured embryonic cell suspensions and multicellular structures v Time consuming Desiccation v Dried embryos can be mixed with a nutrient solution containing the foreign DNA v The DNA should be taken up as the embryo rehydrates and seedlings can be germinated in the presence of a selection medium to assess the incorporation of the foreign DNA  Agrobacterium Agrobacterium (disease symptomology and host range) A. radiobacter - “avirulent” species A. tumefaciens - crown gall disease A. rhizogenes - hairy root disease A. rubi - cane gall disease A. vitis - galls on grape and a few other plant species Otten et al., 1984  Cellular process of Agrobacterium–host interaction Tzvi Tzfira and Vitaly Citovsky, 2002, Trends in Cell Biol. 12(3), 121-129  Plant Transformation Methods Virus-mediated gene transfer (Plant viruses as vectors) Caulimoviruses – ds DNA – CaMV Geminiviruses - 2ss DNA – maize streak virus RNA plant viruses - TMV  In Planta Transformation ♣ Meristem transformation ♣ Floral dip method ♣ Pollen transformation Chloroplast transformation - Horizontal gene transfer  Selectable Markers A gene encoding an enzyme Antibiotic resistance Herbicide resistance Positive selection genes – genes that allow use of some necessary media component.  Selectable Markers – NPTII - kanamycin (antibiotic) – Hpt - hygromycin – PMI - changes mannose to useable carbohydrate  Novel Selection Genes Luciferase - gene from fireflies – substrate Green Fluorescent Protein - from jellyfish - under lights and filter the transgenic plants - GFP GUS - glucuronidase gene will convert added substrate to blue color.  Production of transgenic plants Isolate and clone gene of interest Add DNA segments to initiate or enhance gene expression Add selectable markers Introduce gene construct into plant cells (transformation) Select transformed cells or tissues Regenerate whole plants  Transformation success Number of Transformed cells Frequency of transformation = Total number of cells in the culture Number of Transformed cells Transformation efficiency = Amount of DNA in µg