LO16 - Genetic Basis of Life_Mutation.docx

NANYANG TECHNOLOGICAL UNIVERSITY Hello and Welcome In this online session,you will learn about Genetic Basis of Life:Mutation NANYANG TECHNOLOGICAL. UNIVERSITY School of Biological Sciences Learning Objectives At the end of the session,you should be able to: Describe what constitutes a mutat...

NANYANG TECHNOLOGICAL UNIVERSITY Hello and Welcome In this online session,you will learn about Genetic Basis of Life:Mutation NANYANG TECHNOLOGICAL. UNIVERSITY School of Biological Sciences Learning Objectives At the end of the session,you should be able to: Describe what constitutes a mutation; Distinguish between the types of mutations; List the various ways by which mutations may be generated;and Recognise the significance of studying mutations in biological systems. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences You have learnt how a gene encodes for a protein through the genetic code system in The Central Dogma. You have also learnt that the gene expression can be regulated to achieve coordination of cell functions in Regulation of Gene Expression. Now based on your understanding,if someone says"….there are several variants to this gene …"where would you expect the variations to be NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Since"gene"refers to the DNA in the scheme of the Central Dogma,the variation should be found in the base sequence of the gene. We refer to such changes in base sequences as"mutations". Let us say a bacterium carries a gene bacA that is responsible for synthesizing a kind of antibiotics.Another bacterium carries bacA as well. Or,some base(s)in its bacA may differ from that of the first bacterium -this then is a variant of the bacA gene. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences These changes in the base sequence are called "mutations". When a change in base sequence has occurred,we can either say that"a mutation has been generated"or that "the gene has mutated". NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences A mutation is only meaningful in the context of comparing to an "original" version. That "original"version acting as the reference is either called the"wild type" sequence or the"wild type"gene. However,if the reference itself is not the ultimate "original"(meaning,it has itself been through several previous rounds of mutations),then we may call them parental sequence/gene,instead of wild type sequence/gene,to make this distinction. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Mutations can occur in both the coding and the non-coding regions of a gene. Recall that the coding region carries DNA sequences that encode the amino acid sequences of a protein. So mutations in the coding region may lead to a change in the amino acid sequence,resulting in a mutant protein. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Also recall that the non-coding region of a gene often includes regulatory sequences,i.e.,it controls the gene expression level. So mutations in the non-coding region may lead to a change in gene expression.In this case,mutant cell will exhibit a change in gene expression pattern. NANYANG TECHNOLOGICAL UNIVERSITY You were informed that a gene for the color of eyes has variants that are responsible for producing either blue,green or brown eyes.When you compare the sequences of these genes,what can you potentially expect? There may be more than one correct option.Please select all options that you think are correct,and then submit. The cells carrying these genes cannot be distinguished at the gene level but will show difference at the cellular level. E None of the above. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences You may sometimes get confused with the terminology used to describe a particular mutation, because there are so many types of them.This can be avoided if you keep in mind that the terms are ncgocccnccn based on how mutations are classified. Single base mutation Parent Here,we shall first look at the single-base mutations ropttnscl- to Torncrcnr as insertion,deletion and substitution. Select each mutation type to know more. Insertion Deletion Substitution NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences A mutation involving a few bases running in sequence,as shown here,can also be classified as insertion,deletion or substitution. EoEnoTTme0 Multiple base mutation Parent pppp ppp Mutated Select each mutation type to know more. Insertion Deletion Substitution School of Biological Sciences In addition,for a mutation involving a sequence of many bases,it is possible to have two additional types of mutations -inversion and reciprocal translocation. Parent Select each mutation type to know more. Inversion Reciprocal Translocation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Some of the classification is based on the outcome generated by the mutation with respect to the amino acid sequence in the coding region.Nonsense mutation,missense mutation , silent mutation and frameshift mutation belong to this type of classification. sequence Select each mutation type to know more. Missense Mutation Assuming Monkey B carries the wild type version of TRA31 gene,how many mutation(s)is/are there in the region of Monkey A's gene shown? There may be more than one correct option.Please select all options that you think are correct,and then submit. Monkey Monkey A B TTTGCAGAGGTAATGCCGTCCGATGGAAATATGGCG TTTGCAGAGGAAATGCACGTCCGATGAAATATGGCG A 0 [ ) 3 B 1 E 4 C 2 NANYANG TECHNOLOGICAL UNIVERSITY Which is/are the type(s)of mutation that can be observed on Monkey A's gene? There may be more than one correct option.Please select all options that you think are correct,and then submit. Monkey A Monkey B TTTGCAGAGGTAATGCCGTCCGATGGAAATATGGCG TTTGCAGAGGAAATGCACGTCCGATGAAATATGGCG A B C Deletion Transposition Substitution D E Insertion Inversion Which of the region(s)carries a frame-shift in the coding sequence as a result of the mutation(s)in Monkey A? There may be more than one correct option.Please select all options that you think are correct,and then submit. 1 2 3 4 Monkey A TTTGCAGAGGTAATGCCGTCCGATGGAAATATGGCG Monkey B TTTGCAGAGGAAATGCACGTCCGATGAAATATGGCG A B C Between 1-2 Between 2-3 Between 3-4 D E Between Between 1-3 2-4 NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Another type of classification focuses on the phenotypic outcome of the mutation. This means that it describes the characteristics of the mutant protein compared to the wild type protein,or that of the mutant organism compared to the wild type organism. How the mutation is generated,e.g.,through deletion or insertion,is not relevant in this classification. Some of these mutations are presented below,but the list is not exhaustive because there is a wide variety of phenotypic changes possible. Null Mutation Constitutive Mutation Lethal Mutation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Select each mutation type to know more. Loss-of-Function Mutation Null Mutation Constitutive Mutation Lethal Mutation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Select each mutation type to know more. Gain-of-Function Mutation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Loss-of-Function Mutation Gain-of-Function( Mutation Null Constitutive Mutation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In certain situations,a mutation may be classified based on the way it has been generated. The process of generating mutations is called mutagenesis,and the agent of cause is called a mutagen. Hence you may see phrases such as "chemical mutagenesis"and "transposon mutagenesis",when the causative reason of the mutation needs to be described. We shall now examine the various ways in which mutations may be caused, which are presented below. Select each tab to knowhow mutation maybe caused. Spontaneous Mutation Chemical Mutagenesis Mutagenesis by Radiation 1 NANYANG TECHNOIOGICAL NIVERST) Spontaneous Mutation Schaol of Biological Scences X DNA replication is the process by which the parental chromosomal DNA is replicated to be distributed to the daughter cells.You will certainly learn about the mechanism in greater details in the module Continuity of Life.However,we shall briefly present what is happening during DNA replication here in order to understand how spontaneous mutations come about. Each parental strand provides a template that attracts and binds complementary bases,A with T and G with C. STAGE 3 STAGE1 STAGE 2 Parent strands unwind and separate along the DNA molecule. STAGE 4 Sugar-phosphate back-bone of daughter strands dlosed; Each new DNA molecule consists of one parental and one daughter strand. Mutation Mutagenesis by Radiation Mutagenesis NANYANG V Chemical Mutagenesis School of Biological Sciences V Chemical mutagenesis is caused by the exposure of DNA to compounds with mutagenic activity,i.e. directly through: 1.depurination, deamination and/or oxidation or 2.binding of DNA to alter its backbone structure. In both cases,the change enhances error-prone incorporation of bases during DNA replication, leading to mutation in the next generation of cells. Depurination Cytosine Apurinic Site g" Releasi Guanin Deamination Alteration of Backbone Structure Examples of mutagenic compounds include ethidium bromide (commonly used to stain DNA in laboratory)and nitrosamine (found in tobacco smoke). Mutation Mutagenesis Ethidium bromide(eb)added by Radiation NANYANG School of Biological Sciences TECHNOIOCICAL NIVERS Mutagenesis by Radiation X High energy radiations are able to 1.cause damages to the DNA backbone(e.g.,X-ray can break the sugar-phosphate backbone)or 2.alter the structure of bases (e.g.,UV light can cause thymine dimers to form). A break in the DNA backbone usually results in removal of short stretches of bases,leading to deletion,if the cell is able to repair the break.Sometimes the number of breaks within a genome can be so numerous that the cell is unable to repair them adequately.In this case,the cell will simply die instead of ending up with mutations. Altering the structure of DNA through thymine dimer formation will have similar effects as chemical mutagenesis,i.e.,resulting in error-prone DNA replication and incorporation of bases which are different from the original sequence. Mutation Mutagenesis by Radiation Mutageness NANYANG TTCHNOLOGICAI HNIVERSTY Transposon Mutagenesis X In a biological system,a large change in sequence may occur due to the activities of transposons.These are DNA sequences which can range from a few hundred bases long to several thousand bases long,and characterised by having inverted repeats (IR)at both ends. It is able to copy or cut itself out from its original position to somewhere else in another region of DNA due to the activities of the transposase enzyme (this is encoded in the transposon's DNA sequence). Mutation Mutagenesis by Radiation Mutagenesis NANYANG TECHNOLOGICAL UNIVERSITY Which of the following type of mutation does not require any external agent e.g.,chemical,radiation,to generate? There may be more than one correct option.Please select all options that you think are correct,and then submit. D Mutation due to apurination E None of the above School ofBiological Sciences Check Your Understanding Transposon mutagenesis is a type of mutation initiated by . A Chemicals B Mutagens C X-ray D UV light E An enzyme NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Many chemical agents that can cause mutation are in fact also classified as "carcinogens"i.e., cancer-causing substances.Cancer is triggered through accumulation of certain types of mutations in our cells.So it is not surprising that chemicals that can alter DNA structures and cause mutations are carcinogens as well. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences You have also learnt that nonsense mutation causes truncated proteins to be formed,which are usually defective or completely non-functional. At this point,you may have received the impression that mutations are bad,because the mutagens often seem like they are causing serious damage. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences So.…is mutation really "bad"and completely undesirable? The answer is NO. One should always remember that a mutation is simply a variation,and the variation may not always have negative consequence. For instance,if a gene carries a silent mutation,there is essentially no difference in the resulting protein. Some mutation may simply make the gene different but not worse e.g..producing pigments that gives rise to a red flower instead of an orange flower. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Sometimes the mutation may even make the gene perform better e.g.,in the case of gain- of-function mutations. With the advances in molecular biotechnology, we are even artificially introducing mutations to fulfill our needs.(You will learn more about this in the module Genetic Diversity). NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Furthermore,mutations/mutants serve a very important role in biological research. The function of a particular gene cannot be studied by just observing what a"normal" organism does,because it only reflects the collective actions of many genes that make up this organism.A mutation in the gene of interest helps to "dissect"its function out. Essentially,you can imagine that all other conditions (genes)remain the same compared to the wild type(the "control"in your experiment)and the only difference you observe is due to the "change"or"defect" occurring in the mutant. It is then possible to do detective work to trace what the function of the gene may have been. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences For example,you do not know the function of a gene called colR in a fungi. However,you managed to create a mutation in this gene using a transposon. Now,when you compare the wild type fungi and the colR mutant fungi,you observe that the mutant no longer appears blue,as the wild type does. You have received an important clue to the function of colR -it is probably involved in producing the blue coloration in the wild type fungi! Wild type fungi co/Rmutantfungi NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences By layering on experiments and observation like this,scientists have managed to decipher the functions of many genes to date.This is the basis of the discipline of "genetics"and we have to give thanks to the many mutants that had appeared. Wild type fungi colRmutantfung NANYANG TECHNOLOGICAL UNIVERSITY You collected some worms and accidentally subjected them to a dose of X-ray. Thereafter,some of the worms started to show red spots on their body.After analysis, you found that the DNA sequence of gene A of cells at these red spots are different from that at other parts of the worms'body.Which of the following may apply? There may be more than one correct option.Please select all options that you think are correct,and then submit. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In this section on Mutation in the module Genetic Basis of Life,you need to take home the following messages: 1.Variation comes about in genes due to mutations,which are simply any types of changes in the base sequences.This can occur within the coding and the non-coding regions. 2.Mutations can be classified according to the types of base changes and the types of outcome (either to the sequence,or to the phenotype). NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In this section on Mutation in the module Genetic Basis of Life,you need to take home the following messages: 3.Mutations can be generated spontaneously through accidental base-pairing errors during DNA replication,by chemical agents or radiation,and mobile DNA elements called transposons. 4.Mutations do not always lead to negative outcomes. 5.Mutations are valuable tools in research especially in the field of genetics. 学率学NAXYANG TECANOLOGICAL VAIVERSITY Self-Assessment Genetic Basis of Life:Mutation Total number of questions:4 BEGIN TEST NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Self-Assessment The sequence below are highlighted in red where mutations have occurred.What type of mutation(s)is/are these? AAGCTTGGGCAACGAGCGCTTTGGGACTAGC There may be more than one correct option.Please select all options that you think are correct,and then submit. A Insertion C Deletion D Substitution E Unable to determine NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences A mutant has a nonsense mutation.This is a classification based on . There may be more than one correct option.Please select all options that you think are correct,and then submit. A whether the base change is single or a few or many B the type of base change C the consequence to the phenotype of the organism D what kind of changes to the amino acid residues occurred E none of the above Mutation that is longer than a single base by may be introduced There may be more than one correct option.Please select all options that you think are correct,and then submit. A translocation B transposition C insertion deletion D E substitution A mutant cyanobacteria with a defect in the gene atcA is unable to carry out photosynthesis.This allows us to infer that the gene atcA There may be more than one correct option.Please select all options that you think are correct,and then submit. A B C may be involved in photosynthesis E none of the above School of Biological Sciences Self-Assessment Youve completed the Self-Assessment. Your score is 50%