53 Questions
What are the components of nucleic acids?
Nucleotides
Which types of nucleic acids exist as single-stranded molecules?
RNA
What are the four nucleotides that make up DNA?
A, G, C, T
What is the function of nucleic acids in the cell?
Storage, transfer, and expression of genetic information
What is the genetic material of the cell made of?
DNA
What is the complementary pairing base for adenine in RNA?
Uracil
How many types of nucleic acids are there?
Two
In a DNA or RNA chain, which carbon of one nucleotide is joined to the phosphate of the next nucleotide?
3'
In a DNA double helix, how many hydrogen bonds are there between an AT pair?
2
What is the complementary RNA sequence for 5'-AGTTGCA-3'?
3'-UCAACGU-5'
In a DNA double helix, how many hydrogen bonds are there between a GC pair?
3
How is the directionality of DNA and RNA chains described?
5' to 3'
What type of structure does double-stranded DNA typically form?
Right-handed helix with a B-form structure
What is the primary structure of nucleic acid based on?
Sequence of bases in the 5'→3' direction
Which of the following best describes the difference between ribose and deoxyribose?
Deoxyribose lacks a hydroxyl group at the 2' position of the sugar ring
Which of the following nitrogenous bases is unique to RNA?
Uracil
How are nucleotides connected to form nucleic acids?
Through 3',5'-phosphodiester bonds
Which enzyme is responsible for synthesizing RNA chains?
RNA polymerase
What provides the energy for diester bond formation during DNA and RNA synthesis?
The bond between the alpha and beta phosphates of nucleotide triphosphates
Which of the following is classified as a pyrimidine?
Cytosine
What is the primary difference between DNA and RNA?
Type of sugar unit in their building blocks
Which type of nucleic acid mainly exists as a single-stranded molecule?
RNA
What are the nitrogenous bases present in DNA?
A, T, C, G
How are nucleotides linked to one another in DNA and RNA?
Phosphodiester bonds in the 5' to 3' direction
What is the function of ribosomal RNA (rRNA)?
Structural component of the ribosome
Which nucleic acid can function as genetic material in RNA-viruses?
RNA
What are the components of a nucleotide?
Sugar, phosphate group, nitrogenous base
In which direction are DNA strands oriented in a double helix?
Opposite directions
What is the function of RNA molecules known as ribozymes?
Act as enzymes
What are the nitrogenous bases found in DNA?
A, T, C, G
Which type of nucleic acid mainly exists as a single-stranded molecule?
RNA
What are the functions of RNA?
mRNA, rRNA, tRNA, genetic material in RNA-viruses, and Ribozyme
What type of bond links nucleotides in DNA and RNA?
Phosphodiester bonds
Which nucleic acid is a structural component of the ribosome?
Ribosomal RNA (rRNA)
What is the difference between DNA and RNA?
The type of sugar unit in their building blocks
Which nucleic acid can function as genetic material in RNA-viruses?
RNA
In what direction are nucleotides linked in DNA and RNA?
5' to 3'
Which type of nucleic acid has a double-stranded helical structure?
DNA
Where would you expect variations to be if someone mentions 'several variants to this gene'?
In the base sequence of the gene
In the context of the Central Dogma, what is a variant of a gene?
A gene with changes in its base sequence
In the scenario of two bacteria carrying the same gene, what would constitute a variant of the gene?
Differences in the base sequence of the gene
Which type of mutation results in the insertion of an extra nucleotide into the gene sequence?
Frameshift mutation
What is the term for a mutation that leads to a premature stop codon and results in a non-functional protein?
Nonsense mutation
What is the process of generating mutations known as?
Mutagenesis
What is the primary cause of chemical mutagenesis?
Exposure to compounds with mutagenic activity
What type of mutations can cause truncated and defective proteins?
Nonsense mutations
What is the role of gain-of-function mutations?
Enhance gene function
What type of mutation(s) is/are highlighted in the given sequence AAGCTTGGGCAACGAGCGCTTTGGGACTAGC?
Substitution
A mutant has a nonsense mutation. This is a classification based on:
the consequence to the phenotype of the organism
Mutation that is longer than a single base may be introduced by:
transposition
A mutant cyanobacteria with a defect in the gene atcA is unable to carry out photosynthesis. This allows us to infer that the gene atcA:
may be involved in photosynthesis
What can be inferred from the observation that some worms subjected to X-ray showed red spots with different DNA sequence in gene A?
Gene A might be involved in the development of red spots
What can be inferred from the observation that the mutant fungi no longer appears blue, unlike the wild type?
The gene colR may be involved in producing the blue coloration
Study Notes
Understanding Nucleic Acids: Key Concepts
- RNA mainly exists as a single-stranded molecule but forms double-stranded regions in its secondary structure.
- RNA has several functions, including mRNA, rRNA, and tRNA, involved in genetic information transfer and the process of transcription/translation.
- RNA can also function as genetic material in RNA-viruses and as an enzyme, such as Ribozyme.
- Ribosomal RNA is a structural component of the ribosome.
- DNA and RNA are the two types of nucleic acids found in living systems, differing in the type of sugar unit found in their building blocks.
- Nucleotides, consisting of a sugar, phosphate group, and nitrogenous base, are the basic building blocks of nucleic acids.
- The nitrogenous bases in DNA are A, T, C, and G, while in RNA they are A, U, C, and G.
- Nucleotides are linked to one another through phosphodiester bonds in DNA and RNA, in the 5' to 3' direction.
- DNA has a double-stranded helical structure, with the two strands running in opposite directions.
- RNA can function as mRNA, tRNA, or rRNA, and some RNA molecules have enzymatic activities.
- DNA and RNA are able to perpetuate or transfer information in the form of a sequence of bases.
- The Self-Assessment test scored 40% for the completion of the Nucleic Acids section at NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences.
Understanding Mutations and Their Causes
- Mutations can be caused by different factors including spontaneous mutations, chemical mutagenesis, radiation, and transposon mutagenesis.
- Spontaneous mutations can occur during DNA replication when errors are made in copying the parental DNA.
- Chemical mutagenesis is caused by exposure to compounds with mutagenic activity, like ethidium bromide and nitrosamine, leading to error-prone DNA replication.
- Mutagenesis by radiation can occur through high-energy radiation causing damage to DNA backbone or altering the structure of bases, leading to mutations.
- Transposon mutagenesis involves large changes in DNA sequence due to the activities of transposons, which can move to different regions of DNA.
- Chemical agents that cause mutations are often classified as carcinogens, which can lead to the accumulation of mutations and trigger cancer.
- Nonsense mutations can cause truncated and defective proteins to be formed, contributing to the perception that mutations are negative.
- Mutations are not always negative, as some variations may have no negative consequences or may even improve gene function.
- Gain-of-function mutations can enhance gene function and have positive effects.
- Mutations are artificially introduced in molecular biotechnology to fulfill specific needs.
- Mutations play a crucial role in biological research by allowing the study of the specific function of a gene of interest.
- Understanding the causes and effects of mutations is essential in various fields, from genetics to cancer research and biotechnology.
Test your knowledge of nucleotides in DNA and RNA with this quiz covering key concepts such as the structure of nucleotides, differences between RNA and DNA, functions of RNA, and the role of nucleic acids in genetic information transfer.
Make Your Own Quizzes and Flashcards
Convert your notes into interactive study material.
Get started for free
