Nucleotides in DNA and RNA
53 Questions
3 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What are the components of nucleic acids?

  • Nucleotides (correct)
  • Monosaccharides
  • Amino acids
  • Fatty acids

    • Which types of nucleic acids exist as single-stranded molecules?

  • RNA (correct)
  • Neither RNA nor DNA
  • DNA
  • Both RNA and DNA

    • What are the four nucleotides that make up DNA?

  • A, G, C, U
  • A, T, G, U
  • A, G, C, T (correct)
  • A, T, C, U

    • What is the function of nucleic acids in the cell?

    <p>Storage, transfer, and expression of genetic information</p> Signup and view all the answers

    What is the genetic material of the cell made of?

    <p>DNA</p> Signup and view all the answers

    What is the complementary pairing base for adenine in RNA?

    <p>Uracil</p> Signup and view all the answers

    How many types of nucleic acids are there?

    <p>Two</p> Signup and view all the answers

    In a DNA or RNA chain, which carbon of one nucleotide is joined to the phosphate of the next nucleotide?

    <p>3'</p> Signup and view all the answers

    In a DNA double helix, how many hydrogen bonds are there between an AT pair?

    <p>2</p> Signup and view all the answers

    What is the complementary RNA sequence for 5'-AGTTGCA-3'?

    <p>3'-UCAACGU-5'</p> Signup and view all the answers

    In a DNA double helix, how many hydrogen bonds are there between a GC pair?

    <p>3</p> Signup and view all the answers

    How is the directionality of DNA and RNA chains described?

    <p>5' to 3'</p> Signup and view all the answers

    What type of structure does double-stranded DNA typically form?

    <p>Right-handed helix with a B-form structure</p> Signup and view all the answers

    What is the primary structure of nucleic acid based on?

    <p>Sequence of bases in the 5'→3' direction</p> Signup and view all the answers

    Which of the following best describes the difference between ribose and deoxyribose?

    <p>Deoxyribose lacks a hydroxyl group at the 2' position of the sugar ring</p> Signup and view all the answers

    Which of the following nitrogenous bases is unique to RNA?

    <p>Uracil</p> Signup and view all the answers

    How are nucleotides connected to form nucleic acids?

    <p>Through 3',5'-phosphodiester bonds</p> Signup and view all the answers

    Which enzyme is responsible for synthesizing RNA chains?

    <p>RNA polymerase</p> Signup and view all the answers

    What provides the energy for diester bond formation during DNA and RNA synthesis?

    <p>The bond between the alpha and beta phosphates of nucleotide triphosphates</p> Signup and view all the answers

    Which of the following is classified as a pyrimidine?

    <p>Cytosine</p> Signup and view all the answers

    What is the primary difference between DNA and RNA?

    <p>Type of sugar unit in their building blocks</p> Signup and view all the answers

    Which type of nucleic acid mainly exists as a single-stranded molecule?

    <p>RNA</p> Signup and view all the answers

    What are the nitrogenous bases present in DNA?

    <p>A, T, C, G</p> Signup and view all the answers

    How are nucleotides linked to one another in DNA and RNA?

    <p>Phosphodiester bonds in the 5' to 3' direction</p> Signup and view all the answers

    What is the function of ribosomal RNA (rRNA)?

    <p>Structural component of the ribosome</p> Signup and view all the answers

    Which nucleic acid can function as genetic material in RNA-viruses?

    <p>RNA</p> Signup and view all the answers

    What are the components of a nucleotide?

    <p>Sugar, phosphate group, nitrogenous base</p> Signup and view all the answers

    In which direction are DNA strands oriented in a double helix?

    <p>Opposite directions</p> Signup and view all the answers

    What is the function of RNA molecules known as ribozymes?

    <p>Act as enzymes</p> Signup and view all the answers

    What are the nitrogenous bases found in DNA?

    <p>A, T, C, G</p> Signup and view all the answers

    Which type of nucleic acid mainly exists as a single-stranded molecule?

    <p>RNA</p> Signup and view all the answers

    What are the functions of RNA?

    <p>mRNA, rRNA, tRNA, genetic material in RNA-viruses, and Ribozyme</p> Signup and view all the answers

    What type of bond links nucleotides in DNA and RNA?

    <p>Phosphodiester bonds</p> Signup and view all the answers

    Which nucleic acid is a structural component of the ribosome?

    <p>Ribosomal RNA (rRNA)</p> Signup and view all the answers

    What is the difference between DNA and RNA?

    <p>The type of sugar unit in their building blocks</p> Signup and view all the answers

    Which nucleic acid can function as genetic material in RNA-viruses?

    <p>RNA</p> Signup and view all the answers

    In what direction are nucleotides linked in DNA and RNA?

    <p>5' to 3'</p> Signup and view all the answers

    Which type of nucleic acid has a double-stranded helical structure?

    <p>DNA</p> Signup and view all the answers

    Where would you expect variations to be if someone mentions 'several variants to this gene'?

    <p>In the base sequence of the gene</p> Signup and view all the answers

    In the context of the Central Dogma, what is a variant of a gene?

    <p>A gene with changes in its base sequence</p> Signup and view all the answers

    In the scenario of two bacteria carrying the same gene, what would constitute a variant of the gene?

    <p>Differences in the base sequence of the gene</p> Signup and view all the answers

    Which type of mutation results in the insertion of an extra nucleotide into the gene sequence?

    <p>Frameshift mutation</p> Signup and view all the answers

    What is the term for a mutation that leads to a premature stop codon and results in a non-functional protein?

    <p>Nonsense mutation</p> Signup and view all the answers

    What is the process of generating mutations known as?

    <p>Mutagenesis</p> Signup and view all the answers

    What is the primary cause of chemical mutagenesis?

    <p>Exposure to compounds with mutagenic activity</p> Signup and view all the answers

    What type of mutations can cause truncated and defective proteins?

    <p>Nonsense mutations</p> Signup and view all the answers

    What is the role of gain-of-function mutations?

    <p>Enhance gene function</p> Signup and view all the answers

    What type of mutation(s) is/are highlighted in the given sequence AAGCTTGGGCAACGAGCGCTTTGGGACTAGC?

    <p>Substitution</p> Signup and view all the answers

    A mutant has a nonsense mutation. This is a classification based on:

    <p>the consequence to the phenotype of the organism</p> Signup and view all the answers

    Mutation that is longer than a single base may be introduced by:

    <p>transposition</p> Signup and view all the answers

    A mutant cyanobacteria with a defect in the gene atcA is unable to carry out photosynthesis. This allows us to infer that the gene atcA:

    <p>may be involved in photosynthesis</p> Signup and view all the answers

    What can be inferred from the observation that some worms subjected to X-ray showed red spots with different DNA sequence in gene A?

    <p>Gene A might be involved in the development of red spots</p> Signup and view all the answers

    What can be inferred from the observation that the mutant fungi no longer appears blue, unlike the wild type?

    <p>The gene colR may be involved in producing the blue coloration</p> Signup and view all the answers

    Study Notes

    Understanding Nucleic Acids: Key Concepts

    • RNA mainly exists as a single-stranded molecule but forms double-stranded regions in its secondary structure.
    • RNA has several functions, including mRNA, rRNA, and tRNA, involved in genetic information transfer and the process of transcription/translation.
    • RNA can also function as genetic material in RNA-viruses and as an enzyme, such as Ribozyme.
    • Ribosomal RNA is a structural component of the ribosome.
    • DNA and RNA are the two types of nucleic acids found in living systems, differing in the type of sugar unit found in their building blocks.
    • Nucleotides, consisting of a sugar, phosphate group, and nitrogenous base, are the basic building blocks of nucleic acids.
    • The nitrogenous bases in DNA are A, T, C, and G, while in RNA they are A, U, C, and G.
    • Nucleotides are linked to one another through phosphodiester bonds in DNA and RNA, in the 5' to 3' direction.
    • DNA has a double-stranded helical structure, with the two strands running in opposite directions.
    • RNA can function as mRNA, tRNA, or rRNA, and some RNA molecules have enzymatic activities.
    • DNA and RNA are able to perpetuate or transfer information in the form of a sequence of bases.
    • The Self-Assessment test scored 40% for the completion of the Nucleic Acids section at NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences.

    Understanding Mutations and Their Causes

    • Mutations can be caused by different factors including spontaneous mutations, chemical mutagenesis, radiation, and transposon mutagenesis.
    • Spontaneous mutations can occur during DNA replication when errors are made in copying the parental DNA.
    • Chemical mutagenesis is caused by exposure to compounds with mutagenic activity, like ethidium bromide and nitrosamine, leading to error-prone DNA replication.
    • Mutagenesis by radiation can occur through high-energy radiation causing damage to DNA backbone or altering the structure of bases, leading to mutations.
    • Transposon mutagenesis involves large changes in DNA sequence due to the activities of transposons, which can move to different regions of DNA.
    • Chemical agents that cause mutations are often classified as carcinogens, which can lead to the accumulation of mutations and trigger cancer.
    • Nonsense mutations can cause truncated and defective proteins to be formed, contributing to the perception that mutations are negative.
    • Mutations are not always negative, as some variations may have no negative consequences or may even improve gene function.
    • Gain-of-function mutations can enhance gene function and have positive effects.
    • Mutations are artificially introduced in molecular biotechnology to fulfill specific needs.
    • Mutations play a crucial role in biological research by allowing the study of the specific function of a gene of interest.
    • Understanding the causes and effects of mutations is essential in various fields, from genetics to cancer research and biotechnology.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    LO7 - Macromolecules_Nucleic Acids(2).docx
    LO16 - Genetic Basis of Life_Mutation.docx

    Description

    Test your knowledge of nucleotides in DNA and RNA with this quiz covering key concepts such as the structure of nucleotides, differences between RNA and DNA, functions of RNA, and the role of nucleic acids in genetic information transfer.

    More Like This

    Use Quizgecko on...
    Browser
    Open
    Browser
    Browser