Contribution of Genetic Changes to Human Disease PDF

The Contribution of Genetic Changes to Human Disease Michael Simpson  Learning Objectives II The Contribution of Genetic Changes to Human Disease An understanding of different ways in which DNA can vary How such DNA variations may have functional consequence...

The Contribution of Genetic Changes to Human Disease Michael Simpson  Learning Objectives II The Contribution of Genetic Changes to Human Disease An understanding of different ways in which DNA can vary How such DNA variations may have functional consequences How such functional consequences may lead to disease  DNA Variation Our genomes are unique to each of us We each have one maternal and one paternal genome that are shuffled versions of our parents genomes Our genomes are overall very similar but a small percentage is variable Some of this variation is common, some is rare and some is unique to our families and even each of us But it is the combination of variation patterns is what makes our genomes unique  DNA Variation Old and New DNA variation arises through the process of mutation Mutation is a constantly occurring phenomenon The variation in our genomes is a consequence of mutation events that have occurred over thousands of years Selection plays an important role as to what variation remains in the population This mixture will comprise old mutation events not subject to negative selection that are likely to be common in the population And more recent mutation events that generate variants that are unique to ourselves and even specific parts of our bodies (somatic)  How a DNA Sequence Can Vary Single nucleotide substitution A straight substitution of one base for another Wildtype c g g t g g g t c g c t t g a Alternative t > c substitution c g g t g g g c c g c t t g a  How a DNA Sequence Can Vary Single nucleotide substitution Purines NH 2 Single nucleotide substitutions may also be subdivided according C N C N to the effect on the nature of the base chemistry C Adenine C C N H N O Transition H C N C N A substitution which conserves the base chemistry C Guanine C C N NH 2 N C®T, T®C, G ®A, A ®G Pyrimidines CH 3 O C H Transversion C C A substitution which changes the base chemistry H N N Thymine C C®A, A ®C, G ®C, C ®G, T ®A, A ®T, G ®T, T ®G O H NH 2 H C C C Cytosine Although there are twice as many possible transversions as N N C transitions, it is found that transitions are roughly twice as O common as transversions.  How a DNA Sequence Can Vary Deletion A loss of a single base or a continuous block of sequence Wildtype c g g t g g g t c g c t t g a Alternative – single base pair deletion c g g t g g g c g c t t g a  How a DNA Sequence Can Vary Deletion A loss of a single base or a continuous block of sequence Wildtype c g g t g g g t c g c t t g a Alternative – three base pair deletion c g g t g g g c t t g a  How a DNA Sequence Can Vary Insertion An insertion of a single base or a continuous block of sequence between two previously adjacent bases Wildtype g t g g g t c g c t t Alternative – single base pair insertion g t g g g a t c g c t t  How a DNA Sequence Can Vary Insertion An insertion of a single base or a continuous block of sequence between two previously adjacent bases Wildtype g t g g g t c g c t t Alternative – 34 base pair insetion g t g g g a a t c g a t c c g a g c t c g g a t c g a t c g a t c g g g g t a t c g c t t  How a DNA Sequence Can Vary Insertion – tandem duplication A special case of an insertion where the inserted material is identical to the adjacent sequence Wildtype g g t a g t g g g t c g Alternative – three base pair tandem duplication g g t a g t a t g g g g t c g  How a DNA Sequence Can Vary Insertion – tandem duplication A special case of an insertion where the inserted material is identical to the adjacent sequence Wildtype g a c a c a c a c t c g Alternative – repeat expansion g a c a c a c a c a c t c g  How a DNA Sequence Can Vary Inversion A block of sequence is inverted – because of the nature of DNA pairing the inverted sequence is replaced with its reverse compliment Wildtype c g g t g g g t c g c t t g a Alternative - eight base pair inversion c g g g c g a c c c a t t g a  How a DNA Sequence Can Vary Translocation A block of sequence is inverted – because of the nature of DNA pairing the inverted sequence is replaced with its reverse compliment Wildtype ChrA: t g g g t c g c t t g a ChrB: t g a c a c c g a a g a Alternative – DNA exchanged between chromosomes ChrA: t g g g t c g c a a g a ChrB: t g a c a c c g t t g a  How a DNA Sequence Can Vary Deletions, insertions, tandem duplications and inversions can range from a single base to several million bases in size Rearrangements are often imperfect so the sequence at the ends of the blocks may also be disrupted Inversions and translocations may be benign if the breakpoints do not disrupt genes  Functional Variation DNA variants can occur throughout our genomes Some will have a functional (and potentially phenotypic) consequence Other variation will be benign The functional consequence a variant may have will be defined by the effect it has on functional regions of the genome  Variation in Genes Almost all reported disease causing variants directly effect functional parts of known genes. Most known functional parts of genes depend critically on nucleotide sequence, and are therefore sensitive to variation. UAS Promoter Polyadenylation site 5’UTR 3’UTR Initiation codon Stop codon Coding region Intron (cryptic splice) Splice donor site Splice acceptor site Splice branch site  Effects of Variants in Coding Regions The effects of coding region single nucleotide substitutions can be exceedingly variable. Consider: CAA GGA Gln Gly Of the 9 possible CTA AGA substitutions at this arginine Leu CGA Arg codon, 4 are SILENT, 4 result Arg in differing amino acid CCA CGT changes (“MISSENSE”), and Pro Arg one gives a NONSENSE codon. TGA CGG CGC Stop Arg Arg SILENT Will not affect the protein directly, but may affect splicing. MISSENSE Will cause a single amino acid change, whose affect may be neutral or harmful (resulting in gain of function, or direct/indirect loss of function). NONSENSE Will cause premature termination of the reading frame, resulting in a truncated protein or NMD.  Effects of Variants in Coding Regions “small” rearrangements (deletions, insertions, duplications, inversions) refer to those whose effects are confined to a single exon of a gene. The effect of the variant on the reading frame is more important than its extent. Normal. CGATCGTTGCGCAGGCTTAAAGCGCGGATAAACGATATC Frame 1 ArgSerLeuArgArgLeuLysAlaArgIleAsnAspIle... 1-bp CGATCGTTGCGCCAGGCTTAAAGCGCGGATAAACGATATC Frame 2 - insertion. ArgSerLeuArgGlnAlaTerm “frameshift” 1-bp CGATCGTTGCGCAGGTTAAAGCGCGGATAAACGATATC Frame 3 - deletion. ArgSerLeuArgArgLeuLysArgGlyTerm “frameshift” 6-bp CGATCGTTGCGCAGGCCGCGGATAAACGATATC Frame 1 - deletion. ArgSerLeuArgArgProArgIleAsnAspIle... “in-frame” The largest deletion here has the mildest effect, resulting in a change of LeuLysAla to Pro, rather than truncation and NMD.  Effects of Variants in Splice Sites Variants in all known splice recognition elements have been found to disrupt the splicing process: Lariat acceptor Polypyrimidine tract Splice acceptor YNYTRAY Yn YAG/G ttttcccttt ctgatatctc tgcctcttcc tctctctttt ataaaagGAA AAAATACCCC TGGAAAGCCA ATGAGAGAGg ttagtgagat tcaggctcac ggccatggct tctgtctgtc Some exonic Splice donor variants (ESEs) YAG/GTARGT The result depends on the relative strengths of the elements, the severity of the change, and the proximity of alternative options. Commonest consequences are: Exon skipping Use of cryptic splice sites (in exon or intron) Intron retention (small introns only) Combinations of the above  Large Rearrangements Although the sizes of rearrangements form a continuum from 1 bp to whole chromosomes, there are discrete scales at which they have different effects. a) One or more exons of a gene Normal. 1 2 3 4 5 Deletion 1 2 4 5 Duplication 1 2 3 3 4 5 Inversion 1 2 3 4 5 As with small rearrangements, the critical determinant of the effect is whether or not the removal or insertion of exon(s) affects the reading frame.  Other Site of Functional Variation The above account for the vast majority of reported functional variants. The following are also potential sites of functional variation but rarely described (because they are less often sought, because they are harder to substantiate, or because they are genuinely rarer?). Variants in promoters May be rare because promoters may be relatively insensitive to variation Can result in tissue-specific phenotype Can result in stage-specific phenotype Variants in untranslated regions Some UTRs are more highly conserved than coding regions or promoters. Functions poorly understood. Transcript stability & subcellular localisation? Very few confirmed pathogenic variants. Myotonic dystrophy, Fukuyama muscular dystrophy. Variants in polyadenylation signals Few characterised variants result in reduced transcript levels. Evidence from yeast that NMD pathway is involved.  Types of Functional DNA Variation Muller’s Morphs In 1932 Hermann J. Muller coined the following terms to classify mutations based on their behaviour in various genetic situations Loss of Function Amorph: a variant that causes complete loss of gene function Hypomorph: a variant that causes a partial loss of gene function Gain of function Hypermorph: a variant that causes an increase in normal gene function Antimorph: dominant alleles that act in opposition to normal gene activity Neomorphic: variants that causes a dominant gain of gene function that is different from the normal function  Types of Functional DNA Variation Loss of function variation The protein product fails to perform its normal function. This may arise because: (Normal) Little or no protein is produced (e.g. whole gene deletion, nonsense variant resulting in NMD). The protein is unstable or inappropriately targeted and is degraded (e.g. in-frame deletion causing misfolding). A residue or domain essential for function is missing or critically altered (e.g. missense variant in enzyme active site. The presence of a second, normal, allele can usually rescue the phenotype, resulting in normal heterozygotes. Loss of function variation are therefore usually recessive. But….  Types of Functional DNA Variation ….there are several (common sense) ways in which “loss of function” alleles exhibit a dominant form of inheritance: a) Haploinsufficiency The organism is so sensitive to levels of the protein that a 50% reduction in quantity causes a noticeable phenotype. û b) “Dominant negative” effect The formation of homomultimeric complexes means that not only does the protein lose its function, but it disrupts the function of its normal counterpart. û c) Somatic second hits Organism largely normal, but somatic 2nd mutations give rare clones of null cells, which are defective. Recessive at the cellular level but dominantly inherited in families. û  Types of Functional DNA Variation Gain of Function Rather than lose its principal function, the protein may become less specific in its normal function or even acquire a novel function. Dominantly inherited. a) Loss of regulation The activity of a protein (enzyme etc.) loses its spatial or temporal specificity. This may be due to loss of a regulatory region or mislocalisation. üüü Variant in inhibitory domain - constitutive activity (dominant) û Variant in active domain - loss of function (recessive). b) Novel function The protein has a novel effect which is not characteristic of the normal product. A common novel “function” is the formation of insoluble aggregates.  An Example Discovery (recap) Infantile onset epilepsy in the Amish Ultra rare disease but found at an elevated frequency in an Amish community in Ohio, US Seizure starting at 6 months of age Associated with developmental delay Autosomal recessive inheritance pattern Infantile onset epilepsy in the Amish (recap) Infantile onset epilepsy in the Amish (recap) SIAT9 Gene arg stop More on this in the next lecture…  Infantile onset epilepsy in the Amish SIAT9 gene encodes GM3 synthase GM3 synthase is a critical enzyme in the synthesis of a- and b- series gangliosides Such gangliosides are critical for membrane stability The mutation identified is predicted to lead to loss of function of GM3 synthase  Infantile onset epilepsy in the Amish It is possible to measure the levels of gangliosides and related molecules Measurement in affected individuals homozygous for the disease causing variant confirmed complete lack of a- and b- series gangliosides Measurement in carrier parents heterozygous for the disease causing variant demonstrated normal levels of a- and b- series gangliosides This demonstrated that one ‘normal’ copy of the gene is ‘ok’ but no normal copies resulted in loss of the a-a nd b- series molecules and ultimately the epileptic phenotype  Infantile onset epilepsy in the Amish I II III IV V VI VII  Summary DNA sequence can vary in many different ways There are certain biological biases that mean certain types of mutation events are more frequent The consequences of variation depend on the position of the variation with respect to functional sequences Disease causing variants have a functional consequence that leads to a phenotypic effect  Recommended Reading Human DNA variation and its contribution to disease Human Molecular Genetics, 2nd edition Tom Strachan and Andrew Read Chapter 16. Molecular pathology http://www.ncbi.nlm.nih.gov/books/NBK7580/ A map of human genome variation from population-scale sequencing Free access The 1000 Genomes Project Consortium Nature 467, 1061-1073 ( 28 October 2010 ) Also of potential interest… Infantile Onset Epilepsy in the Amish Simpson et al. Nature Genetics 36, 1225 - 1229 (2004) Infantile-onset symptomatic epilepsy syndrome caused by a homozygous loss-of-function mutation of GM3 synthase http://www.nature.com/ng/journal/v36/n11/abs/ng1460.html