Nucleic Acids PDF

NUCLEIC ACIDS are essential molecules that continue the life in living world have two main functions 1. regulate metabolic activities in cells 2. maintence of genetic continuity between generations the first discovered nucleic acids are the one in leucocytes(WBC) Structure of...

NUCLEIC ACIDS are essential molecules that continue the life in living world have two main functions 1. regulate metabolic activities in cells 2. maintence of genetic continuity between generations the first discovered nucleic acids are the one in leucocytes(WBC) Structure of nucleic acids composed of a chain of nuceleotides a nucleotide is composed of: 1. nitrogenous base(A, G, T, C, U) are classified as: a. purines-with a single ring cytosine(C), thymine(T), uracil(U) b. pyrimidines-double ring adenine(A) guanine(G) 2. pentose sugar-5C presence or absence of oxygen a.deoxyribose in DNA b. ribose in RNA 3. phosphate group phosphoric acid H3PO4 1. DNA(deoxyribonucleic acid) some functions of ADN: 1. storage of genetic info. 2. provision of continuity by self-replication 3. reagulates cellular activities by controlling protein and enzyme synthesis the distinctive base somposition of DNA 1. DNA composition is different for each species 2. the same species have the same base composition 3. DNA composition is not connected to age or environment 4. the no. of purines adn pyrimidines are equal, since A pairs with T and G with C. THUS: A+G=T+C and A+G/T+C=1s Exercieses 1. CGTAAGCGCTAATTA 2. TCTTAAATGATCGATC 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. % nucleotides 7. (A-T links, there are 2 H bonds and for G-C links, there are 3 H bonds) The double helix model of The location of DNA in cells DNA DNA is a double-stranded helical structure a. the single, circular DNA in each strand comprises a chain of prokaryotes is located in nucleotide cytoplasm forming a region known as nucleoid a nucleotide is composed of a sugar, base and a phosphate group b. is particulary condensed in some regions of each chromosome the nucleotides of a strand are linked by known as chromomers im phosphodiester bonds eukaryotes the purines of one strand pair with are characterised by horizontal pyrimidines of the other strand bands or striations DNA Replication DNA stores all of the info. for activities for each cell of an organism when cells divide by mitosis or meiosis, DNA is copied and passed to the next generation DNA replication is the process by which DNA is duplicated, from which one double helix give two new double helixes, each of them having one part from the older double helix firstly these strands separate from each other, then each is used as an template to give new COMPLEMENTARY STRAND the replication of DNA starts at origins of replication, the site where replication starts enzymes - is a process that occurs in the presence of special enzymes i- DNA helicase(enz)-unwinds the double helix by using ATP ii-DNA gyrase- seperates one strand from the other strand of DNA iii-single stranded DNA proteins - still the unwind DNA can bind but proper proteins by binding the strands don't allow them to bind iv- primase(5')- starts the syntheisiz of RNA complementary to DNA RNA is needed for DNA polimerase to syntheisise complementary DNA v- DNA polimeraseIII(5')- adds DNA nucleotides after the RNA segments formed by primase DNA polimerase I removes the RNA primer and replaces with DNA don't forget that the DNA synthesis always procceed from 5' to 3' untill now we have explained 5' or leading strand vi- 3' is called lagging strand DNA polymerase is inactive here because it works only from 5' to 3' direction OKAZAKI FRAGMENTS - the solution comes by OKAZAKI FRAGMENTS, which are short, discontinous replication products DNA primase - removes single-strand proteins that were not allowing the strands to bind with each other also makes a RNA primer to make an Okazaki fragment DNA polymerase- adds the complementary DNA nucleotides vii-DNA polymerase- removes Okazaki fragments after are made RNA primers and replace them with DNA viii- DNA ligase-links the Okazaki fragments to form the full complementary DNA or lagging strand RNA - Transcription three stags: initiation, chain elongation, and termination 1. RNA Polymerase-Promoter Complex + holoenzyme - binds to the promoter gene in the DNA, also allows for the finding of the start sequence for the RNA polymerase 2. Elongation - RNA Polymerase : one strand of the DNA is read for the base sequence, 3. Termination - RNA polymerase also recognizes signals for chain termination, which includes the release of the nascent RNA and the enzyme from the template. TRANSLATION – PROTEIN SYNTHESIS the info. content of DNA si in the form of specific sequences of nucleotides info. then is translated in the form of genes which are the smallest unit of hereditary and determine a trait a trait is made up of many peptides or polypeptides this info. is visible when are translated to proteins we know that DNA control the protein synthesis by RNA and this flow of info. is called CENTRAL DOGMA this info. is passed firstly by 1. TRANSCRIPTION (pass of info. from DNA-RNA) and 2. TRANSLATION (when the info. is translated from nucleic acid lang. to protein lang.) TRANSCRIPTION – PROTEIN SYNTHESIS EXERCIESES write the mRNA strand for the given DNA strand. 1. ATGTCGCTGATACTGT 2. GAAGCGATCAGTTACG 3. AATGAATAGCTAGCTT 4. GGCATTCGCGATCATG 5. CGTTAGCATGCTTCAT 6. ACTAACGGTAGCTAGC Write the tRNA sequence for the given strand of mRNA 13. AGGUCAUGCAUGGGCAUGCAU 14. AGAGAUUCAGCUAGCACGAUA 15. GUCAUCGAUCGAUCGGAUGCC 16. UUUCAGUCAGCUAGCGAUCGU MUTATIONS Genetic Changes - MUTATIONS Mutation: any change in the DNA sequence. Mutagen: any agent that can cause a change in DNA…(radiation, chemicals, and even high temperatures. Point mutation: Change in a single base pair in DNA Frameshift Mutation: A single base is added or deleted from DNA  Deletion: part of the chromosome is left out Insertion: part of the a chromatid breaks off and attaches to its sister chromatid Inversion: part of a chromosome breaks off and reattaches backwards Translocation: part of one chromosome breaks off and is added to a different chromosome TRISOMY A trisomy is a type of polysomy in which there are three instances of a particular chromosome, instead of the normal two 1. Autosomal – (Down syndrome 21) 2. X/Y linked - Turner syndrome (XO)  Polyploidy Polyploidy describes the case of a cell or an individual possessing entire extra sets of chromosomes. Triploid (3N) individuals have three sets of chromosomes while tetraploid (4N) individuals have four. Polyploidy is extremely common in plants. As a matter of fact, common food plants such as wheat, seedless grapes and bananas are polyploid. However,polyploidy is not common in mammals, and it is usually lethal when it occurs. MONONSOMY Monosomy is a form of aneuploidy with the presence of only one chromosome 1. Wolf–Hirschhorn syndrome 2. Turner syndrome