Untitled

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson
Download our mobile app to listen on the go
Get App

Questions and Answers

Match the scientist to their contribution in ecology:

  • Robert May - III, Alexander von Humboldt - IV, Paul Ehrlich - II, David Tilman - I
  • Robert May - III, Alexander von Humboldt - I, Paul Ehrlich - IV, David Tilman - II (correct)
  • Robert May - I, Alexander von Humboldt - III, Paul Ehrlich - II, David Tilman - IV
  • Robert May - II, Alexander von Humboldt - III, Paul Ehrlich - I, David Tilman - IV

Which description accurately identifies the features shown in the figure?

  • Compact inflorescence structure promoting complete autogamy by closely arranging flowers for self-pollination.
  • Cleistogamous flowers ensuring autogamy through self-pollination within closed, non-opening flowers.
  • Water-pollinated flowers exhibiting stamens with a mucilaginous covering, facilitating aquatic pollen dispersal.
  • Wind-pollinated plant inflorescence displaying flowers with well-exposed stamens, enhancing wind-driven pollen dispersal. (correct)

In an ecosystem, if the Net Primary Productivity (NPP) of the first trophic level is $100x \frac{kcal}{m^2 \cdot yr}$, what would be the Gross Primary Productivity (GPP) of the first trophic level?

  • $\frac{100x}{3} \frac{kcal}{m^2 \cdot yr}$
  • It cannot be determined without knowing the respiration rate of the primary producers. (correct)
  • $10x \frac{kcal}{m^2 \cdot yr}$
  • $x \frac{kcal}{m^2 \cdot yr}$

Given the electrochemical series, which of the following sequences correctly arranges the ions in increasing order of their discharge potential at the cathode during electrolysis?

<p>E, C, D, B, A (D)</p> Signup and view all the answers

Match each plant from List I with its corresponding characteristic from List II:

<p>Rose - II, Pea - IV, Cotton - I, Mango - III (B)</p> Signup and view all the answers

Categorize each floral characteristic from List I with the appropriate example from List II:

<p>Monadelphous - IV, Diadelphous - II, Polyadelphous - I, Epiphyllous - III (D)</p> Signup and view all the answers

Consider the reaction sequence: Propan-1-ol $\xrightarrow{PBr_3}$ A $\xrightarrow{alc. KOH, \Delta}$ B. What are the major products A and B?

<p>A = 1-Bromopropane, B = Propene (D)</p> Signup and view all the answers

During somatic hybridization involving two different plant varieties, which cellular structures are fused?

<p>Protoplasts (C)</p> Signup and view all the answers

What critical role do helper cells play during T-cell activation?

<p>Secreting cytokines that enhance the activation and differentiation of other immune cells. (D)</p> Signup and view all the answers

The rate of a reaction quadruples when the temperature changes from 27C to 57C. Calculate the energy of activation. (Given $R = 8.314 , J K^{-1} mol^{-1}$, $log4 = 0.6021$)

<p>38.04 kJ/mol (A)</p> Signup and view all the answers

In the context of population genetics, what conditions must be met for the Hardy-Weinberg equilibrium to remain constant from one generation to the next?

<p>Large population size, random mating, absence of mutations, absence of gene flow, and absence of natural selection. (C)</p> Signup and view all the answers

During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which acid is added to prevent the hydrolysis of $Fe^{2+}$ ions?

<p>Dilute sulphuric acid (D)</p> Signup and view all the answers

During the light-independent reactions (Calvin cycle), what would be the consequence of inhibiting the regeneration of RuBP?

<p>The cycle would stall because the initial carbon dioxide acceptor is not regenerated. (C)</p> Signup and view all the answers

The plot of osmotic pressure ($\Pi$) vs concentration (mol/L) for a solution gives a straight line with a slope of 25.73 L bar $mol^{-1}$. What is the temperature at which the osmotic pressure measurement was taken? (Use $R = 0.083 , L , bar , mol^{-1} , K^{-1}$)

<p>310C (D)</p> Signup and view all the answers

The Verhulst-Pearl logistic growth equation is given as $\frac{dN}{dt} = rN \frac{K-N}{K}$. What ecological concept does 'K' specifically represent in this model, and what are its implications for population dynamics?

<p>The maximum sustainable population size that the environment can support, influencing population equilibrium. (A)</p> Signup and view all the answers

Which of the following statements about molecular properties is correct?

<p>Three resonance structures can be drawn for ozone. (D)</p> Signup and view all the answers

In a DNA transcription unit, what is the correct arrangement of the three key regions with respect to the upstream and downstream ends?

<p>Promoter, structural gene, Terminator (C)</p> Signup and view all the answers

How do bulliform cells contribute to the survival of monocots in arid environments?

<p>By collapsing under water stress, causing leaves to curl inward and reduce transpiration. (C)</p> Signup and view all the answers

Which characteristic is least reliable when classifying fungal species, considering their diverse adaptations and evolutionary relationships?

<p>The structural details of the fruiting body, which can vary with environmental conditions. (C)</p> Signup and view all the answers

Given the following statements, what combination of factors contributes most significantly to the high levels of species richness observed in tropical regions?

<p>Stable climates over long periods, high solar energy input, and niche specialization (B)</p> Signup and view all the answers

How does actinomorphy in flowers influence pollination strategies, and what selective advantage does it confer compared to zygomorphic flowers?

<p>Actinomorphic flowers attract a wider range of pollinators, increasing the chances of successful pollination in diverse environments. (C)</p> Signup and view all the answers

The relative positions of floral whorls (calyx, corolla, and androecium) with respect to the ovary are critical for floral classification. Which of these arrangements provides the greatest protection to the developing ovary and ovules, and why?

<p>Epigynous; the ovary is enclosed within the receptacle, providing a barrier against physical damage and herbivory. (D)</p> Signup and view all the answers

If a researcher disrupts the function of centrioles within a cell, which cellular process would be most directly impaired, and what would be the downstream consequences?

<p>Organization of the mitotic spindle, causing errors in chromosome segregation during cell division. (D)</p> Signup and view all the answers

Which of the following sequences accurately represents the hormonal control and cellular interactions involved in spermatogenesis?

<p>ICSH, Leydig cells, Sertoli cells, spermatogenesis (B)</p> Signup and view all the answers

What is the correct sequence of steps in the catalytic cycle of an enzyme?

<p>Substrate binding to active site → Substrate enzyme complex formation → Chemical bonds of the substrate broken → Release of products → Free enzyme ready to bind with another substrate (C)</p> Signup and view all the answers

Which combination of characteristics is most accurate for describing non-chordates?

<p>Notochord is absent, heart is dorsal if present, and post anal tail is absent. (C)</p> Signup and view all the answers

How are the structures of the cockroach digestive system correctly matched with their functions?

<p>The structures used for storing of food - Crop; Ring of 6-8 blind tubules at junction of foregut and midgut - Gastric Cacca; Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut - Malpighian tubules; The structures used for grinding the food - Gizzard. (B)</p> Signup and view all the answers

Evaluate the accuracy of the two statements regarding brain structure:

<p>Statement I is correct but Statement II is incorrect. (C)</p> Signup and view all the answers

Which of the following options correctly matches geological eras with their corresponding animal life?

<p>Cenozoic Era - Mammals Dominate (D)</p> Signup and view all the answers

What set of events would lead to a decrease in the $pO_2$ of arterial blood?

<p>Decreased alveolar ventilation coupled with increased pulmonary blood flow. (C)</p> Signup and view all the answers

Consider the following: (a) inspiration, (b) expiration, (c) increase in intrapulmonary pressure (d) decrease in intrapulmonary pressure. What is the correct sequence of events during the respiration cycle?

<p>a, d, b, c (B)</p> Signup and view all the answers

In plasmid construction, if gene 'X' controls the copy number and gene 'Y' is vital for plasmid replication, what is the most likely outcome if gene 'X' is inactivated and gene 'Y' function is enhanced?

<p>The plasmid copy number will increase significantly, potentially leading to cellular stress, while replication proceeds efficiently. (D)</p> Signup and view all the answers

Considering the functions of the nephron, how would a mutation affecting the descending limb of the loop of Henle, making it permeable to water but impermeable to electrolytes, impact urine concentration?

<p>Urine concentration mechanisms would fail, leading to excretion of very large volumes of dilute urine. (C)</p> Signup and view all the answers

What is the most significant consequence if a newborn infant does NOT receive colostrum shortly after birth, considering its role in immunity?

<p>The infant is significantly more vulnerable to infections due to lack of passive immunity. (A)</p> Signup and view all the answers

A cardiologist observes a patient's ECG and notes a prolonged PR interval. Based on the understanding of the action potential conduction pathway in the heart, what is the most likely location of the conduction delay?

<p>At the AV node, delaying the signal from the atria to the ventricles. (C)</p> Signup and view all the answers

Given the DNA template 3'-TACATGGCAAATATCCATTCA-5', which of the following RNA sequences represents the correct product synthesized by DNA-dependent RNA polymerase during transcription?

<p><code>5'-AUGUACCGUUUAUAGGGAAGU-3'</code> (D)</p> Signup and view all the answers

If a researcher discovers that a specific eukaryotic mRNA transcript has a significantly shorter poly(A) tail than normal, what downstream effect is most likely to occur?

<p>Reduced mRNA stability and increased degradation. (C)</p> Signup and view all the answers

During gel electrophoresis, DNA fragments migrate and separate based on size. If you load a DNA sample containing fragments of varying lengths and the electrophoresis is run for an extended period at a high voltage, what potential problem is most likely to occur?

<p>The smaller DNA fragments may migrate off the end of the gel, leading to inaccurate size determination. (B)</p> Signup and view all the answers

Which modification in a PCR protocol would be most effective at reducing the formation of primer dimers?

<p>Increase the annealing temperature to a level closer to the melting temperature of the primers. (A)</p> Signup and view all the answers

Which of the following scientists is correctly paired with their discovery?

<p>Har Gobind Khorana - Synthesized artificial RNA molecules, deciphering the genetic code. (A)</p> Signup and view all the answers

Considering the structure and function of DNA within chloroplasts, which statement is most accurate?

<p>Chloroplast DNA is a circular, double-stranded molecule, reflecting its prokaryotic ancestry and facilitating efficient replication and gene expression. (B)</p> Signup and view all the answers

A researcher is studying cellular respiration in yeast cells. If the electron transport system is inhibited, how would this directly affect the proton gradient and ATP production?

<p>The proton gradient would collapse, severely limiting ATP production by ATP synthase. (D)</p> Signup and view all the answers

Which of the following scenarios is least likely to result in effective contraception, considering both traditional and modern methods?

<p>A couple who relies solely on coitus interruptus, without any additional contraceptive measures, for preventing pregnancy. (A)</p> Signup and view all the answers

A patient presents with symptoms of a common cold. Lab results confirm elevated levels of dust mite antigens. How are these findings best interpreted?

<p>The patient is experiencing rhinovirus infection and concurrent allergic reaction to dust mites. (A)</p> Signup and view all the answers

Which statement regarding bioreactors and their applications reflects a misunderstanding of their role in biotechnology?

<p>Bioreactors are exclusively utilized for the growth of small-scale bacterial cultures for preliminary research. (D)</p> Signup and view all the answers

A researcher aims to enhance the production of a specific recombinant protein in a bioreactor using E. coli. Which strategy would be least effective in achieving this goal?

<p>Introducing a mutation into the <em>E. coli</em> genome that disrupts the cell's ability to synthesize the target protein. (D)</p> Signup and view all the answers

In the context of genetic engineering, which of the following represents the most significant challenge in creating a stable and highly productive cell line for biopharmaceutical production?

<p>Ensuring that the recombinant gene is integrated into a transcriptionally active region of the host cell's genome and remains stably expressed over multiple generations. (B)</p> Signup and view all the answers

Flashcards

Isothermal Expansion Work

Work done during reversible isothermal expansion. Calculated using (W = -nRT \ln\frac{P_1}{P_2})

Activation Energy

Energy required for a reaction to occur. Calculated using Arrhenius equation relating rate constants and temperatures.

Preventing Hydrolysis of (Fe^{2+})

Acid added to prevent the reaction of (Fe^{2+}) ions with water (hydrolysis) during preparation of Mohr's salt.

Osmotic Pressure Equation

The relationship between osmotic pressure, concentration, gas constant, and temperature: (\Pi = CRT)

Signup and view all the flashcards

Dipole Moment

A measure of molecular polarity. Depends on bond polarity and molecular geometry.

Signup and view all the flashcards

Transcription Unit

Regions of DNA that define a gene: promoter, structural gene, and terminator.

Signup and view all the flashcards

Waterlily Pollination

The flowers emerge above the surface for pollination.

Signup and view all the flashcards

Autogamy

Transfer of pollen grains from the anther to the stigma of the same flower.

Signup and view all the flashcards

Carrying Capacity (K)

Maximum population size an environment can sustain given available resources.

Signup and view all the flashcards

Bulliform Cells

Large, empty, colorless cells in the epidermis of monocot leaves. Responsible for inward curling of leaves to minimize water loss.

Signup and view all the flashcards

Criteria for Fungi Classification

Nutritional mode, spore formation, fruiting body formation and mycelium morphology.

Signup and view all the flashcards

Species Richness in Tropics

Tropical regions have remained undisturbed for a long time. More solar energy is available and constant environments promote niche specialization.

Signup and view all the flashcards

Actinomorphic Flower

Flower with radial symmetry, where flower parts are arranged in a circle.

Signup and view all the flashcards

Hypogynous vs. Epigynous Flower

Ovary is superior, with other floral parts (calyx, corolla, and androecium) positioned below it. (b) Epigynous: Ovary is inferior, with other floral parts positioned above it.

Signup and view all the flashcards

Nucleolus Function

Site of active ribosomal RNA (rRNA) synthesis.

Signup and view all the flashcards

Centriole

Organization like the cartwheel.

Signup and view all the flashcards

Species-Area Relationship

Species richness and area are positively correlated; larger areas tend to support more species.

Signup and view all the flashcards

Rivet Popper Hypothesis

The idea that ecosystems are like airplanes; losing species (rivets) weakens the ecosystem over time.

Signup and view all the flashcards

Gross Primary Productivity (GPP)

Total energy captured by producers (plants) through photosynthesis.

Signup and view all the flashcards

Net Primary Productivity (NPP)

The rate at which biomass accumulates in an ecosystem, accounting for the energy used by the primary producers for respiration.

Signup and view all the flashcards

Water-pollinated flowers

Flower pollination occurs by water. Stamens are generally covered in a mucilaginous substance.

Signup and view all the flashcards

Cleistogamous Flower

A type of flower that never opens, ensuring self-pollination.

Signup and view all the flashcards

Monadelphous

Stamens fused into one group.

Signup and view all the flashcards

Diadelphous

Stamens fused into two groups.

Signup and view all the flashcards

Protoplasts

Plant cells, bacterial or fungal cells that had their cell walls completely removed using mechanical or enzymatic means.

Signup and view all the flashcards

Pollens

Structures containing the male genetic material of a plant, critical for fertilization.

Signup and view all the flashcards

Callus

An undifferentiated mass of plant cells, capable of developing into various plant tissues or organs.

Signup and view all the flashcards

Griffith's experiment

Frederick Griffith discovered the bacterial transformation using Streptococcus pneumoniae.

Signup and view all the flashcards

Chloroplast DNA

Circular, double-stranded DNA.

Signup and view all the flashcards

Cellular Respiration Locations

A. Citric acid cycle (II. Mitochondrial matrix), B. Glycolysis (I. Cytoplasm), C. Electron transport system (IV. Inner mitochondrial membrane), D. Proton gradient (III. Intermembrane space of mitochondria).

Signup and view all the flashcards

Natural Contraception

Physical barriers or methods such as periodic abstinence, lactational amenorrhea, or coitus interruptus.

Signup and view all the flashcards

Disease Associations

A-Common cold (III-Rhinoviruses), B- Haemozoin (I- Plasmodium), C- Widal test (II -Typhoid), D- Allergy (IV- Dust mites).

Signup and view all the flashcards

Gene 'X' Function (Plasmid)

Controls copy number of linked DNA.

Signup and view all the flashcards

Gene 'Y' Function (Plasmid)

Protein involved in plasmid replication.

Signup and view all the flashcards

Importance of Colostrum

Colostrum provides antibodies essential for the newborn's immunity.

Signup and view all the flashcards

Heart Conduction Pathway

The sequence of electrical conduction in the heart.

Signup and view all the flashcards

Correct Heart Conduction Sequence

SA node → AV node → AV bundle → Bundle branches → Purkinje fibers.

Signup and view all the flashcards

PCT Epithelium and Reabsorption

Statement II is true: PCT has brush border epithelium for increased reabsorption.

Signup and view all the flashcards

DNA-Dependent RNA Polymerase Product

RNA sequence is synthesized complementary to the template strand, replacing T with U.

Signup and view all the flashcards

Correct mRNA Sequence

5' AUGUACCGUUUAUAGGGAAGU 3'

Signup and view all the flashcards

ICSH and Spermiogenesis

ICSH stimulates Leydig cells, which produce testosterone. Spermiogenesis is the transformation of spermatids into spermatozoa.

Signup and view all the flashcards

FSH and Spermatogenesis

FSH stimulates Sertoli cells, and Sertoli cells support spermatogenesis.

Signup and view all the flashcards

Enzyme Catalytic Cycle

Enzyme binds substrate (E), forms complex (A), breaks bonds (D), releases products (C), and becomes free (B).

Signup and view all the flashcards

Non-Chordate Characteristics

Non-chordates lack a notochord, have a dorsal central nervous system, and a post-anal tail is absent.

Signup and view all the flashcards

Cockroach Digestive System

Crop stores food; Gastric caeca secrete digestive enzymes; Malpighian tubules excrete waste; Gizzard grinds food.

Signup and view all the flashcards

Brain Structure Statements

Cerebral hemispheres are connected by the corpus callosum. The brainstem includes the medulla oblongata and pons, but not the cerebrum.

Signup and view all the flashcards

Mesozoic Era

Mesozoic Era is the Age of Reptiles.

Signup and view all the flashcards

Phanerogams

Phanerogams have well-differentiated reproductive tissues and seeds

Signup and view all the flashcards

Study Notes

General Exam Information

  • The NEET (UG) - 2024 exam is 3 hours and 20 minutes long.
  • The test booklet has 200 multiple-choice questions.
  • Questions cover Physics, Chemistry, and Biology (Botany and Zoology).
  • There are 50 questions in each subject.
  • The code of the booklet is G6.
  • The test booklet code is R3

Structure of Each Subject

  • Section A has 35 compulsory questions in each subject covering question numbers 1-35, 51-85, 101-135 and 151-185.
  • Section B contains 15 questions in each subject covering question numbers 36-50, 86-100, 136-150 and 186-200.
  • In Section B, candidates must attempt any 10 questions out of the 15.
  • The first ten questions answered are evaluated if a candidate answers more than ten.

Marking Scheme

  • Each question carries 4 marks.
  • 4 marks are awarded for each correct answer.
  • 1 mark is deducted for each wrong answer.
  • The maximum possible marks are 720.

Instructions for Answering

  • Use a blue or black ballpoint pen for writing and marking answers.
  • Rough work should be done in the Test Booklet only.
  • Candidates must hand over the Answer Sheet (ORIGINAL and OFFICE Copy) to the invigilator before leaving the room.
  • Candidates are allowed to take the Test Booklet with them.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

More Like This

Untitled Quiz
6 questions

Untitled Quiz

AdoredHealing avatar
AdoredHealing
Untitled
44 questions

Untitled

ExaltingAndradite avatar
ExaltingAndradite
Untitled
48 questions

Untitled

HilariousElegy8069 avatar
HilariousElegy8069
Untitled
49 questions

Untitled

MesmerizedJupiter avatar
MesmerizedJupiter
Use Quizgecko on...
Browser
Browser