NEET (UG) 2024 Physics Questions PDF

Summary

This document is a NEET (UG) 2024 Physics past paper, including questions and answers. It contains multiple-choice questions covering various physics topics. It is designed to help students prepare for their upcoming NEET exams.

Full Transcript

NEET (UG) – 2024 (CODE – R3) Date: 05-May-2024 Test Booklet Code R3...

NEET (UG) – 2024 (CODE – R3) Date: 05-May-2024 Test Booklet Code R3 ADDA 247 NEET (UG)-2024 Questions With Answers Time : 3 hrs. 20 Min. M.M.: 720 Important Instructions : 1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple choice questions (four options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology). 50 questions in each subject are divided into two sections (A and B) as per details given below: (a) Section A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos.-1 to 35, 51 to 85,101 to 135 and 151 to 185). All Questions are compulsory. (b) Section B shall consist of 15 (Fifteen) questions in each subject (Question Nos. – 36 to 50, 86 to 100,136 to 150 and 186 to 200). In section B, a candidate needs to attempt any 10 (Ten) questions out of 15 (Fifteen) in each subject. Candidates are advised to read all 15 questions in each subject of Section-B before they start attempting the question paper. In the event of a candidate attempting more than ten questions, the first ten questions answered by the candidate shall be evaluated. 2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect response, 1 mark will be deducted from the total scores. The maximum marks are 720. 3. Use Blue / Black Ball point Pen only for writing particulars on this page / marking responses on Answer Sheet. 4. Rough work is to be done in the space provided for this purpose in the Test Booklet only. 5. On completion of the test, the candidate must handover the Answer Sheet (ORIGINAL and OFFICE Copy) to the Invigilator before leaving the Room/Hall. The candidates are allowed to take away this Test Booklet with them. 6. The CODE for this Booklet is G6. 7. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in NEET (UG) – 2024 (CODE – R3) PHYSICS Section – A Q 1. At any instant of time t, the displacement of any particle is given by 2𝑡 − 1 (SI unit) under the influence of force of 5N. The value of instantaneous power is (in SI unit): 1. 5 2. 7 3. 6 4. 10 Q 2. If the monochromatic source in Young’s double slit experiment is replaced by white light, then 1. There will be a central dark fringe surrounded by few coloured fringes. 2. They will be a central bright white fringe surrounded by a few coloured fringes. 3. All bright fringes will be of equal width. 4. Interference pattern will disappear. Q 3. In the nuclear emission stated above. The mass number and atomic number of the produce Q respectively, are: 1. 286,80 2. 288,82 3. 286,81 4. 280, 81 Q 4. Match List – I with List – II List – I (Material) List – II (Material) A. Diamagnetic I. 𝑥=0 B. Ferromagnetic II. 0 < 𝑥 ≥ −1 C. Paramagnetic III. 𝑥≫1 D. Non - magnetic IV. 0 < 𝑥 < 𝜀 (𝑎 𝑠𝑚𝑎𝑎𝑙𝑙 positive number Choose the correct answer from the options given below: 1. A – II, B – I, C – III, D - IV 2. A – III, B – II, C – I, D - IV 3. A – IV, B – III, C – II, D - I 4. A – II, B – III, C – IV, D - I NEET (UG) – 2024 (CODE – R3) Q 5. In following circuit, the equivalent capacitance between terminal A and terminal B is: 1. 1𝜇𝐹 2. 0.5𝜇𝐹 3. 4𝜇𝐹 4. 2𝜇𝐹 Q 6. A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is: 1 (Take = 9 × 109 𝑆𝐼 𝑢𝑛𝑖𝑡𝑠) 4𝜋∈0 1. 1 × 105 2. 0.5 × 105 3. zero 4. 3 × 105 Q 7. The output (Y) the given logic gate is similar to the output of an/a 1. Nor gate 2. OR gate 3. AND gate 4. NAND gate NEET (UG) – 2024 (CODE – R3) Q 8. An unpolarised light beam strikes a glass surface at Brewster’s angle. Then 1. The refracted light will be completely polarised. 2. Both the reflected and refracted light will be completely polarised. 3. The reflected light will be completely polarised but the refracted light will be partially polarised. 4. The reflected light will be partially polarised. Q 9. A tightly wound 100 turns coil of radius 10 cm carries a current of 7A. The magnitude of the magnetic field at the canter of the coil is (Take permeability of free space as 4𝜋 × 10−7 𝑆𝐼 𝑢𝑛𝑖𝑡𝑠): 1. 4.4 T 2. 4.4 mT 3. 44 T 4. 44 mT Q 10. In the above diagram, a strong bar magnet is moving towards solenoid – 2 from solenoid – 1. The direction of induced current in solenoid – 1 and that in solenoid – 2, respectively, are through the directions: 1. BA and CD 2. AB and CD 3. BA and DC 4. AB and DC Q 11. Two bodies A and B of same mass undergo completely inelastic one-dimensional collision. The body A moves with velocity 𝑣1 while body B is at rest before collision. The velocity of the system after collision is 𝑣2. The ratio 𝑣1 : 𝑣2 is 1. 2:1 2. 4:1 3. 1:4 4. 1:2 NEET (UG) – 2024 (CODE – R3) Q 12. Given blow are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (V) at any axial point, at 2m distance R from the center of the dipole of dipole moment vector 𝑃⃗ of magnitude, 4 × 10−6 𝐶𝑚, 𝑖𝑠 ± 9 × 103 𝑉. 1 (Take 4π∈ = 9 × 109 SI units) 0 2𝑃 Reason R 𝑉 = ± 4𝜋∈ 2 , where r is the distance of any axial pint, situated at 2 m from 0𝑟 the center of the dipole. In the light of the above statements, choose the correct answer form the options given below: 1. Both A and R are true and R is NOT the correct explanation of A. 2. A is true but R is false. 3. A is false but R is true. 4. Both A and R are true and R is the correct explanation of A. Q 13. The terminal voltage of the battery, whose emf is 10 V and internal resistance 1Ω, when connected through an external resistance of 4Ω as L shown in the figure is: 1. 6V 2. 8V 3. 10 V 4. 4V Q 14. A particle moving with uniform speed in a circular path maintains: 1. Constant acceleration. 2. Constant velocity but varying acceleration. 3. Varying velocity and varying acceleration. 4. Constant velocity. NEET (UG) – 2024 (CODE – R3) 1 Q 15. The graph which shows the variation of (𝜆2 ) and its kinetic energy, E is (where 𝜆 is de Broglie wavelength of a free particle): 1. 2. 3. 4. Q 16. A light ray enters through a right-angled prism at point P with the angle of incidence 30° as shown in figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the prism NEET (UG) – 2024 (CODE – R3) √5 1. 2 √3 2. 4 √3 3. 2 √5 4. 4 Q 17. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is v in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)? 1. Point P moves faster than point Q 2. Both the points P and Q move with equal speed. 3. Point P has zero sped. 4. Point P moves slower than point Q. Q 18. A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is: 1. 30 J 2. - 90 J 3. - 60 J 4. zero NEET (UG) – 2024 (CODE – R3) 𝑁𝑝 1 Q 19. In an ideal transformer, the turns ratio is 𝑁𝑠 = 2. The ratio 𝑉𝑠 : 𝑉𝑝 is equal to (the symbols carry their usual meaning): 1. 2:1 2. 1:1 3. 1:4 4. 1:2 Q 20. A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 𝑁𝑚−1, then the excess force required to take it away from the surface is: 1. 198 N 2. 1.98 mN 3. 99 N 4. 19.8 Mn Q 21. The maximum elongation of a steel wire of 1m length if the elastic limit of steel and its Young’s modulus, respectively, are 8 × 108 𝑁 𝑚−2 and 2 × 1011 𝑁 𝑚−2 , is: 1. 0.4 mm 2. 40 mm 3. 8 mm 4. 4 mm 1 th Q 22. The mass of planet is 10 that of the earth and its diameter is half that of the earth. Th e acceleration due to gravity on that planet is: 1. 9.8 m s−2 2. 4.9 m s−2 3. 3.92 m s−2 4. 19.6 m s−2 Q 23. In a vernier callipers, (𝑁 + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is: 1 1. 100(𝑁+1) 2. 100 𝑁 3. 10(𝑁 + 1) 1 4. 10 𝑁 NEET (UG) – 2024 (CODE – R3) Q 24. Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic spectrum. In the light of the above statements, choose the most appropriate answer from the options given below: 1. Both Statement I and Statement II are incorrect. 2. Statement I is correct but Statement II is incorrect. 3. Statement I is incorrect but Statement II is correct. 4. Both Statement I and Statement II are correct. Q 25. A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2kg and 3kg, respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is: 1. 4N 2. 6N 3. 10 N 4. zero Q 26. The quantities which have the same dimensions as those of solid angle are. 1. Stress and angle 2. Strain and arc 3. Angular speed and stress 4. Strain and angle Q 27. The moment of inertia of a thin rod about an axis passing through its mid-point and perpendicular to the rod is 2400 𝑔 𝑐𝑚2. The length of the 400 g rod is nearly 1. 17.5 cm 2. 20.7 cm 3. 72.0 cm 4. 8.5 cm NEET (UG) – 2024 (CODE – R3) Q 28. Consider the following statements A and B and identify the correct answer. A. For a solar-cell the I-V characteristics lies in the IV quadrant of the given graph. B. In a reverse biases pn junction diode, the current measured in (𝜇𝐴), is due to majority charge carries. 1. A is incorrect but B is correct. 2. Both (1) and (2) are correct. 3. Both 1 and 2 are incorrect. 4. 1 is correct but 2 is incorrect. Q 29. A wire of length ′𝑙′and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is. 1. 52 Ω 2. 55 Ω 3. 60 Ω 4. 26 Ω 𝜋 Q 30. If 𝑥 = 5 sin (𝜋𝑡 + 3 ) 𝑚 represent the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively are. 1. 5 m, 2 s 2. 5 cm, 1 s 3. 5 m, 1 s 4. 5 cm, 2 s Q 31. If c is the velocity of light in free space, the correct statements about photon among the following are: A. The energy of photon is E = hv. B. The velocity of a photon is c. ℎ𝑣 C. The momentum of a photon, 𝑝 = 𝑐. NEET (UG) – 2024 (CODE – R3) D. In a photon-electron collision, both total energy and total momentum are conserved. E. Photon possesses positive charge. Choose the correct answer from the options given below 1. A, B, C and D only 2. A, C and D only 3. A, B, D and E only 4. A and B only Q 32. Match List I with List II. List – I List I List II (Spectral Lines of Hydrogen (Wavelengths (nm) for transitions from A. 𝑛2 = 3 to 𝑛1 = 2 I. 410.2 B. 𝑛2 = 4 to 𝑛1 = 2 II. 434.1 C. 𝑛2 = 5 to 𝑛1 = 2 III. 656.3 D. 𝑛2 = 6 to 𝑛1 = 2 IV. 486.1 Choose the correct answer from the options given below. 1. A-III, B-IV, C-II, D-I 2. A-IV, B-III, C-I, D-II 3. A-I, B-II, C-III, D-IV 4. A-II, B-I, C-IV, D-III Q 33. A logic circuit provides the output Y as per the following truth table. A B Y 0 0 1 0 1 0 1 0 1 1 1 0 1. 𝐴. 𝐵̅ + 𝐴̅ 2. 𝐵̅ 3. 𝐵 4. 𝐴. 𝐵 + 𝐴̅ NEET (UG) – 2024 (CODE – R3) Q 34. In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is 9.8 × 10−6 𝑘𝑔 𝑚2. If the magnitude of magnetic moment of the needle is 𝑥 × 10−5 𝐴𝑚−2 ; then the value of ‘x’ is 1. 128 𝜋 2 2. 50 𝜋 2 3. 1280 𝜋 2 4. 5 𝜋2 Q 35. A bob is whirled in a horizontal plane by means of a string with an initial speed of 𝜔. The tension in the string is T. If speed becomes 2 𝜔while keeping the same radius, the tension in the string becomes. 1. 4𝑇 𝑇 2. 4 3. √2 𝑇 4. 𝑇 Section – B Q 36. A metallic bar of Young’s modulus, 0.5 × 1011 𝑁 𝑚−2 and coefficient of linear thermal expansion 10−5 °𝐶 −1 , length 1 m and area of cross-section 10−3 𝑚2 is heated from 0°𝐶 to 100°𝐶 without expansion or bending. The compressive force developed in it is. 1. 50 × 102 N 2. 100 × 102 𝑁 3. 2 × 103 𝑁 4. 5 × 103 𝑁 NEET (UG) – 2024 (CODE – R3) Q 37. Choose the correct circuit which can achieve the bridge balance. 1. 2. 3. 4. Q 38. A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distance object is. 1. 28 2. 17 3. 32 4. 34 NEET (UG) – 2024 (CODE – R3) Q 39. An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle 60° with each other. The magnetic moment of this new magnet is: 𝑀 1. 2 2. 2𝑀 𝑀 3. √3 4. 𝑀 Q 40. A 10 𝜇𝐹 capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly (𝜋 = 3.14). 1. 0.93 A 2. 1.20 A 3. 0.35 A 4. 0.58 A Q 41. Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is: 1. 2:9 2. 1:2 3. 2:3 4. 1:1 Q 42. If the mass of the bob in a simple pendulum is increased to thrice its original mass and 𝑥 its length is made half its original length, then the new time period of oscillation is 2 times its original time period. Then the value of x is: 1. √2 2. 2√3 3. 4 4. √3 NEET (UG) – 2024 (CODE – R3) Q 43. The property which is not of an electromagnetic wave travelling in free space is that. 1. The energy density in electric field is equal to energy density in magnetic field. 1 2. They travel with a speed equal to. √𝜇0 𝜖0 3. They originate from charges moving with uniform speed. 4. They are transverse in nature. Q 44. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it is non-magnetic. C. move the sheet away from the pole with uniform velocity if it is conducting. D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar. Choose the correct statement(s) from the options given below: 1. A and C only. 2. A, C and D only 3. C only. 4. B and D only. Q 45. The velocity (v)-time (t) plot of the motion of a body is shown below. The acceleration (a)- time (t) graph that best suits this motion is. 1. 2. NEET (UG) – 2024 (CODE – R3) 3. 4. Q 46. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates: 1. Displacement current of magnitude equal to I flows in the same direction as I. 2. Displacement current of magnitude equal to I flows in a direction opposite to that of I. 3. Displacement current of magnitude greater than I flows but can be in any direction. 4. There is no current. Q 47. A force defined by 𝐹 = 𝛼𝑡 2 + 𝛽𝑡 acts on a particle at a given time t. The factor which is dimensionless, if 𝛼 and 𝛽 constants, Is. 𝛼 1. 𝛽 2. 𝛼 𝛽𝑡 𝛼𝛽 3. 𝑡 𝛽𝑡 4. 𝛼 Q 48. If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the ratio of charge to its potential remains the same. E. the product of charge and voltage increases. Choose the most appropriate answer from the options given below: NEET (UG) – 2024 (CODE – R3) Choose the most appropriate answer from the options given below. 1. A, C and E only. 2. B, D and E only. 3. A, B and C only. 4. A, B and E only. Q 49. The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures 𝑃1 , 𝑃2 and 𝑃3 compared with those of Charles’s law represented as dotted lines. Then the correct relation is. 1. 𝑃1 > 𝑃3 > 𝑃2 2. 𝑃2 > 𝑃1 > 𝑃3 3. 𝑃1 > 𝑃2 > 𝑃3 4. 𝑃3 > 𝑃2 > 𝑃1 Q 50. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the earth is: 2 𝐺𝑚𝑀 1. 3𝑅 𝐺𝑚 𝑀 2. 2𝑅 𝐺𝑚 𝑀 3. 3𝑅 5 𝐺𝑚 𝑀 4. 6𝑅 NEET (UG) – 2024 (CODE – R3) CHEMISTRY Section – A Q 51. The most stable carbocation among the following 1. 2. 3. 4. Q 52. For the reaction 2𝐴 ⇌ 𝐵 + 𝐶, 𝐾𝐶 = 4 × 10−3. At a given time, the composition of reaction mixture is : [𝐴] = [𝐵] = [𝐶] = 2 × 10−3 𝑀. Then, which of the following is correct? 1. Reaction has a tendency to go in forward direction 2. Reaction has a tendency to go in backward directio006E 3. Reaction has gone to completion in forward direction 4. Reaction is at equilibrium Q 53. ‘Spin only’ magnetic moment is same for which of the following ions? A. 𝑇𝑖 3+ B. 𝐶𝑟 2+ C. 𝑀𝑛2+ D. 𝐹𝑒 2+ E. 𝑆𝑐 3+ Choose the most appropriate answer from the options given below : 1. A and E only 2. B and C only 3. A and D only 4. B and D only NEET (UG) – 2024 (CODE – R3) Q 54. The energy of an electron in the ground state (n = 1) for 𝐻𝑒 + ion is −𝑥 𝐽, then that for an electron in 𝑛=2 state for 𝐵𝑒 3+ ion in 𝐽 is : 𝑥 1. − 9 2. −4𝑥 4 3. −9𝑥 4. −𝑥 Q 55. Which reaction is NOT a redox reaction? 1. 2𝐾𝐶𝑙𝑂3 + 𝐼2 → 2𝐾𝐼𝑂3 + 𝐶𝑙2 2. 𝐻2 + 𝐶𝑙2 → 2𝐻𝐶𝑙 3. 𝐵𝑎𝐶𝑙2 + 𝑁𝑎2 𝑆𝑂4 → 𝐵𝑎𝑆𝑂4 + 2𝑁𝑎𝐶𝑙 4. 𝑍𝑛 + 𝐶𝑢𝑆𝑂4 → 𝑍𝑛𝑆𝑂4 + 𝐶𝑢 Q 56. Match List I with List II List I (Molecule) List II (Number and types of bond/s between two carbon atoms) A. ethane I. one 𝜎 −bond and two 𝜋 −bonds B. Ethane II. two 𝜋 −bonds C. carbon molecule, 𝐶2 III. one 𝜎 −bond D. ethyne IV. one 𝜎 −bond and one 𝜋 −bond 1. A-IV, B-III, C-II, D-I 2. A-III, B-IV, C-II, D-I 3. A-III, B-IV, C-I, D-II 4. A-I, B-IV, C-II, D-III Q 57. Match List I with List II List I (Complex) List II (Type of isomerism) A. [𝐶𝑜(𝑁𝐻3 )5 (𝑁𝑂2 )]𝐶𝑙2 I. Solvate isomerism B. [𝐶𝑜(𝑁𝐻3 )5 (𝑆𝑂4 )]𝐵𝑟 II. Linkage isomerism C. [𝐶𝑜(𝑁𝐻3 )6 ][𝐶𝑟(𝐶𝑛)6 ] III. Ionization isomerism D. [𝐶𝑜(𝐻2 𝑂)6 ]𝐶𝑙3 IV. Coordination isomerism Choose the correct answer from the options given below: NEET (UG) – 2024 (CODE – R3) 1. A-IV, B-III, C-II, D-I 2. A-III, B-IV, C-II, D-I 3. A-III, B-IV, C-I, D-II 4. A-I, B-IV, C-II, D-III Q 58. The E° value for the 𝑀𝑛3+ /𝑀𝑛2+ couple is more positive than that of 𝐶𝑟 3+ /𝐶𝑟 2+ or 𝐹𝑒 3+ /𝐹𝑒 2+ due to change of 1. 𝑑5 to 𝑑2 configuration 2. 𝑑4 to 𝑑5 configuration 3. 𝑑3 to 𝑑5 configuration 4. 𝑑5 to 𝑑4 configuration Q 59. The highest number of helium atoms is in 1. 4 u of helium 2. 4 g of helium 3. 2.271098 L of helium at STP 4. 4 mol of helium 1 Q 60. Which plot of ln k vs is consistent with Arrhenius equation? 𝑇 1. 2. 3. NEET (UG) – 2024 (CODE – R3) 4. Q 61. The compound that will undergo 𝑆𝑁1 reaction with the fastest rate is 1. 2. 3. 4. Q 62. Match List I with List II List – I Quantum Number List – II Information provided A. 𝑚𝑙 I. Shape of orbitale B. 𝑚𝑠 II. Size of orbital C. 𝑙 III. Orientation of orbital D. n IV. Orientation of spin of electron 1. A – III, B – IV, C – I, D – II 2. A – III, B – IV, C – II, D – I 3. A – II, B – I, C – IV, D – III 4. A – I, B – III, C – II, D – IV NEET (UG) – 2024 (CODE – R3) Q 63. The Henry’s law constant (𝐾𝐻 ) values of three gases (A, B, C) in water are 145. 2 × 10−5 and 35 kbar, respectively. The solubility of these gases in water follow the order: 1. B>C>A 2. A>C>B 3. A>B>C 4. B>A>C Q 64. In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. 2 NaHCO3(s) → Na2 CO3(s) + CO2(g) + H2 O(g) C. Cl2(g) → 2Cl(g) Choose the correct answer from the options given below: 1. A, B and D 2. A, C and D 3. C and D 4. A and C Q 65. Given below are two statements: Statements I: Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II: Aniline cannot be prepared through Gabriel synthesis In the light of the above statements, chose the correct answer from the options given below: 1. Both Statement I and Statement II are false 2. Statement I is correct but Statement II is false 3. Statement I is incorrect but Statement II is true 4. Both Statement I and Statement II are true Q 66. Fehling’s solution ‘A’ is 1. Alkaline copper sulphate 2. Alkaline solution of sodium potassium tartrate (Rochelle’s salt) 3. Aqueous sodium citrate 4. Aqueous copper sulphate Q 67. Activation energy of any chemical reaction can be calculated if one knows the value of 1. Probability of collision NEET (UG) – 2024 (CODE – R3) 2. Orientation of reactant molecules during collision 3. Rate constant at two different temperatures 4. Rate constant at standard temperature Q 68. Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the options given below: 1. Li < B < Be < C < N 2. Li < Be < C < B < N 3. Li < Be < N < B < N 4. Li < Be < B < C < N Q 69. 1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to 1. 250 mg 2. Zero mg 3. 200 mg 4. 750 mg Q 70. A compound with a molecular formula of 𝐶6 𝐻14 has two tertiary carbons. Its IUPAC name is: 1. 2-methylpentane 2. 2,3-dimethylbutane 3. 2,2-dimethylbutane 4. n-hexane Q 71. Given below are two statements: Statements I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane > neopentane Statements II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, therby lowering the boiling point. In the light of the above statements, choose the most appropriate answer from the options given below : 1. Both statement I and statement II are incorrect. 2. Statement I is correct but statement II is incorrect. 3. Statements I is incorrect but statement II is correct. 4. Both statement I and statements II are correct NEET (UG) – 2024 (CODE – R3) Q 72. In which of the following equilibria, 𝑘𝑝 and 𝑘𝑐 are NOT equal? 1. 𝐻2(𝑔) + 𝐼2(𝑔) ⇋ 2 𝐻𝐼(𝑔) 2. 𝐶𝑂(𝑔) + 𝐻2 𝑂(𝑔) ⇋ 𝐶𝑂2(𝑔) + 𝐻2(𝑔) 3. 2 𝐵𝑟𝐶𝑙(𝑔) ⇋ 𝐵𝑟2(𝑔) + 𝐶𝑙2(𝑔) 4. 𝑃𝐶𝑙5(𝑔) ⇋ 𝑃𝐶𝑙3(𝑔) + 𝐶𝑙2(𝑔) Q 73. The reagents with which glucose does not react to given the corresponding tests/products are A. Tollen’s reagent B. Schiff’s reagents C. HCN D. 𝑁𝐻2 𝑂𝐻 E. 𝑁𝑎𝐻𝑆𝑂3 Choose the correct options from the given below : 1. A and D 2. B and E 3. E and D 4. B and C Q 74. Match List – I with List – II. List -I List – II A. 𝑁𝐻3 I. Trigonal Pyramidal B. 𝐵𝑟𝐹5 II. Square planar C. 𝑋𝑒𝐹4 III. Oetahedral D. 𝑆𝐹6 IV. Square Pyramidal Choose the correct answer from the options given below : 1. A-II, B-IV, C-III, D-I 2. A-III, B-IV, C-I, D-II 3. A-II, B-III, C-IV, D-I 4. A-I, B-IV, C-II, D-III NEET (UG) – 2024 (CODE – R3) Q 75. Among Group 16 elements, which one does NOT show –2 oxidation state? 1. Se 2. Te 3. Po 4. O Q 76. Match List I with List II. A. I. B. II. CrO3 C. III. KMnO4 /KOH , ∆ D. IV (i) O3 (ii)Zn − H2 O Choose The correct answer from the options given below: 1. A- III, B-I, C-II, D-IV 2. A- IV, B-I, C-II, D-III 3. A- I, B-IV, C-II, D-III 4. A- IV B-I, C-III, D-II Q 77. Arrange the following elements in increasing order of electronegativity: N. O. F. C. Si. Choose the correct answer from the option given below 1. Si < C < O < N < F 2. O < F < N < C < Si 3. F < O < N < C < Si 4. Si < C < N < O < F NEET (UG) – 2024 (CODE – R3) Q 78. Intermolecular hydrogen bonding is present in 1. 2. 3. HF 4. Q 79. Identify the correct reagents that would bring about the following transformation. 1. (i) BH3 ⊖ (ii)H2 O2 /O H (iii) PCC 2. (i) 𝐵𝐻3 ⊖ (ii) H2 O2 /OH (iii) alk. KMnO4 3. (i) H2 O/H = (ii) PCC 4. (i) H2 O/H + (ii) CrO3 Q 80. Match List I with List II List I (Conversion) List II (Number of Farady required) A. 1 mole of H2 O to O2 I. 3F B. 1 mol of MnO− 2 to Mn 2+ II. 2F C. 1.5 mol of Ca from molten CaCl2 III. 1F D. 1 mol of FeO to Fe2 O3 IV. 5F NEET (UG) – 2024 (CODE – R3) Choose then correct answer from the options given below: 1. A-II, B-IV, C-I, D-II 2. A-II, B-III, C-I, D-IV 3. A-III, B-IV, C-II, D-I 4. A-II, B-IV, C-I, D-III Q 81. Given below are two statements: Statement I: The boiling point of hydrides of group 16 elements follow the order H2 O > H2 Te > H2 Se > H2 S. Statement II: On the basis of molecular mass 𝐻2 𝑂 𝑖𝑠 expected to have boiling point than the other members of the group but due to the presence of extensive H-bonding in H2 O it has higher boiling point. In the light of the above statements, chose the correct answer the option given below: 1. Both Statement I and Statement II are false 2. Statements I is true but statement II is false. 3. Statement I is false but statement II is true. 4. Both Statement I and statement II are true Q 82. Given below are two statements: Statement I: Both [Co(NH3 )6 ]3+ and [CoF6 ]3− complex are octahedral but differ in their magnetic behaviour. Statement II:[CO(NH3 )6 ]3+ is diamagnetic whereas [CoF6 ]3− is paramagnetic In the light of the above statements, choose the correct answer the options given below: 1. Both Statement I and Statement II are false 2. Statements I is true but statement II is false. 3. Statement I is false but statement II is true. 4. Both Statement I and statement II are true Q 83. Which one of the following alcohols reacts instantaneously with Lucas reagent ? 1. 𝐶𝐻3 − 𝐶𝐻2 − 𝐶 𝐻 − 𝑂𝐻 | 𝐶𝐻3 2. 𝐶𝐻3 − 𝐶 𝐻 − 𝐶𝐻2 𝑂𝐻 | 𝐶𝐻3 𝐶𝐻3 | 3. 𝐶𝐻3 − 𝐶 − 𝑂𝐻 | 𝐶𝐻3 4. 𝐶𝐻3 − 𝐶𝐻2 − 𝐶𝐻2 − 𝐶𝐻2 𝑂𝐻 NEET (UG) – 2024 (CODE – R3) Q 84. Match the List – I with List II List – I (Process) List –II (Conditions) A. Isothermal process I. No heat exchange B. Isochoric process II. Carried out at constant temperature C. Isobaric process III. Carried out at constant volume D. Adiabatic process IV. Carried out at constant pressure 1. A-IV, B-II, C-III, D-I 2. A-I, B-II, C-III, D-IV 3. A-II B-III, C-IV, D-I 4. A-IV, B-III, C-II, D-I Q 85. On heating, some solid substance change from solid to vapour state passing through solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as 1. Sublimation 2. Distillation 3. Chromatography 4. Crystallization Section – B Q 86. The products A and B obtained in the following reactions, respectively are 3𝑅𝑂𝐻 + 𝑃𝐶𝑙3 → 3𝑅𝐶𝑙 + 𝐴 𝑅𝑂𝐻 + 𝑃𝐶𝑙5 → 𝑅𝐶𝑙 + 𝐻𝐶𝑙 + 𝐵 1. 𝑃𝑂𝐶𝑙3 and 𝐻3 𝑃𝑂4 2. 𝐻3 𝑃𝑂4 and 𝑃𝑂𝐶𝑙3 3. 𝐻3 𝑃𝑂3 and 𝑃𝑂𝐶𝑙3 4. 𝑃𝑂𝐶𝑙3 and 𝐻3 𝑃𝑂3 Q 87. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter constaining copper sulphate solutions for 100 seconds is : (Given : Molar mass of Cu : 63 g 𝑚𝑜𝑙 −1. (1𝐹 = 96487 𝐶) 1. 0.315 g 2. 31.5 g NEET (UG) – 2024 (CODE – R3) 3. 0.0315 g 4. 3.15 g Q 88. Consider the following reaction in a sealed vessel at equilibrium with concentrations of 𝑁2 = 3.0 × 10−3 𝑀, 𝑂2 = 4.2 × 10−3 𝑀 and 𝑁𝑂 = 2.8 × 10−3 M. 2𝑁𝑂(𝑔) ⇋ 𝑁2(𝑔) + 𝑂2(𝑔) If 0.1 mol 𝐿−1 of 𝑁𝑂(𝑔) is taken in a closed vessel. What will be degree of dissociation (𝛼) of 𝑁𝑂(𝑔) at equilibrium? 1. 0.0889 2. 0.8889 3. 0.717 4. 0.00889 Q 89. Given below are two statements :- Statements I : [𝐶𝑜(𝑁𝐻3 )6 ]3+ is a homoleptic Complex whereas [𝐶𝑜(𝑁𝐻3 )4 𝐶𝑙2 ]3 is a heteroleptic complex Statement II : Complex [𝐶𝑜(𝑁𝐻3 )6 ]3+ has only one kind of ligands but [𝐶𝑜(𝑁𝐻3 )4 𝐶𝑙2 ]+ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below: 1. Both statement I and statement II are false. 2. Statement I is true but statement II are false. 3. Statement I is false but statement II is true 4. Both statement I and Statement II are true. Q 90. Identify the major product C formed in the following reaction sequence 𝑁𝑎𝐶𝑁 𝑂𝐻 − 𝑁𝑎𝑂𝐻 𝐶𝐻3 − 𝐶𝐻2 − 𝐶𝐻2 − 𝐼 → 𝐴 → 𝐵→ 𝐶 𝑃𝑎𝑟𝑡𝑖𝑎𝑙 𝐵𝑟2 (𝑀𝑎𝑗𝑜𝑟) ℎ𝑦𝑑𝑟𝑜𝑙𝑦𝑠𝑖𝑠 1. butylamine 2. butanamide 3. 𝛼 −bromobutanoic acid 4. propylamine NEET (UG) – 2024 (CODE – R3) Q 91. The pair of lanthanoid ions which are diamagnetic is 1. 𝐶𝑒 3+ and 𝐸𝑢2+ 2. 𝐺𝑑3+ and 𝐸𝑢3+ 3. P𝑚3+ and Sm3+ 4. 𝐶𝑒 4+ and 𝑌𝑏 2+ Q 92. For the given reaction: ’P’ is 1. 2. 3. 4. Q 93. A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is: (Given atomic masses of A = 64; B = 40; C = 32 u) 1. ABC3 2. AB2C2 3. ABC4 4. A2BC2 Q 94. Given below are certain cations. Using inorganic qualitative analysis. Arrange them in increasing group number from 0 to VI A. Al3+ B. Cu2+ C. Ba2+ D. Co2+ E. Mg 2+ NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below 1. B, C, A, D, E 2. E, C, D, B, A 3. E, A, B, C, D 4. B, A, D, C, E Q 95. The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°𝐶 from pressure of 20 atmosphere to 10 atmosphere is: (Given 𝑅 = 2.0 𝑐𝑎𝑙 𝐾 −1 𝑚𝑜𝑙 −1) 1. −413.14 calories 2. 413.14 calories 3. 100 calories 4. 0 calories Q 96. Major product A and B formed in the following reaction sequence, are 𝑃𝐵𝑟3 𝑎𝑙𝑐. 𝐾𝑂𝐻 → 𝐴 → 𝐵 (𝑀𝑎𝑗𝑜𝑟) Δ (𝑀𝑎𝑗𝑜𝑟) 1. 2. 3. 4. NEET (UG) – 2024 (CODE – R3) Q 97. The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given 𝑅 = 8.314 𝐽𝐾 −1 𝑚𝑜𝑙 −1 , 𝑙𝑜𝑔4 = 0.6021 1. 380.4 kJ/mol 2. 3.80 kJ/mol 3. 3804 kJ/mol 4. 38.04 kJ/mol Q 98. During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of 𝐹𝑒 2 + ion? 1. concentrated sulphuric acid 2. dilute nitric acid 3. dilute sulphuric acid 4. dilute hydrochloric acid Q 99. The plot of osmotic pressure (II) vs concentration (mol L-¹) for a solution gives a straight line with slope 25.73 L bar 𝑚𝑜𝑙 −1. The temperature at which the osmotic pressure measurement is done is: (Use 𝑅 = 0.083 𝐿 𝑏𝑎𝑟 𝑚𝑜𝑙 −1 𝐾 − ¹) 1. 310°C 2. 25.73°C 3. 12.05°C 4. 37°C Q 100. Identify the correct answer. 1. 𝐵𝐹3 has non-zero dipole moment. 2. Dipole moment of 𝑁𝐹3 is greater than that of 𝑁𝐻3− 3. Three canonical forms can be drawn for 𝐶𝑂32− ion. 4. Three resonance structures can be drawn for ozone. NEET (UG) – 2024 (CODE – R3) Botany Section - A Q 101. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end 1. Structural gene, Transposons Operator gene 2. Inducer, repressor, Structural gene 3. Promoter, structural gene, Terminator 4. Repressor, Operator gene, Structural gene Q 102. Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar B. The flowers of waterlily are not pollinated by water C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below: 1. A, B, C and D only 2. A, C, D and E only 3. B, C, D and E only 4. C, D and E only Q 103. Lecithin, a small molecular weight organic compound found in living tissues, is an example 1. Phospholipids 2. Glycerides 3. Carbohydrates 4. Amino acids Q 104. These are regarded as major causes of biodiversity loss: A. Over exploitation B. Mutation C. Habitat loss and fragmentation D. Migration NEET (UG) – 2024 (CODE – R3) Choose the correct option: 1. A, B, C and D only 2. A, B and E only 3. A, B and D only 4. A, C and D only Q 105. Match List I with List II List – I List – II A. Clostridium butylicum I. Ethanol B. Saccharomyces cerevisiae II. Streptokinase C. Trichoderma polysporum III. Butyric acid D. Streptococcus sp. IV. Cyclosporin – A Choose the correct answer from the options given below: 1. A – II, B – IV, C – III, D – I 2. A – III, B – I, C – IV, D – II 3. A – IV, B – I, C – III, D – II 4. A – III, B – I, C – II, D – IV Q 106. Match List I with List II List – I List – II A. Rhizopus I. Mushroom B. Ustilago II. Smut fungus C. Puccinia III. Bread mould D. Agaricus IV. Rust fungus Choose the correct answer from the options given below: 1. A – I, B – III, C – II, D – IV 2. A – III, B – II, C – I, D – IV 3. A – IV, B – III, C – II, D – II 4. A – III, B – II, C – IV, D – I NEET (UG) – 2024 (CODE – R3) Q 107. The lactose present in the growth medium of bacteria is transported to cell by the action of: 1. Acetylase 2. Permease 3. Polymerase 4. Beta-galactosidase Q 108. List of endangered species was released by- 1. WWF 2. FOAM 3. IUCN 4. GEAC Q 109. How may molecules of ATP and NADPH are required for every molecule of CO 2 fixed in the Calvin cycle? 1. 2 molecules of ATP and 2 molecules of NADPH 2. 3 molecules of ATP and 3 molecules of NADPH 3. 3molecules of ATP and 2 molecules of NADPH 4. 2 molecules of ATP and 3 molecules of NADPH 𝑑𝑁 𝐾−𝑁 Q 110. The equation of Verhulst –Pearl logistic growth is 𝑑𝑡 = 𝑟𝑁 [ 𝐾 ], From this equation, K indicates: 1. Biotic potential 2. Carrying capacity 3. Population density 4. Intrinsic rate of natural increase Q 111. Bulliform cells are responsible for 1. Protecting the plant from salt stress 2. Increased photosynthesis in monocots 3. Providing large spaces for storage of sugars 4. Inward curling of leaves in monocots. NEET (UG) – 2024 (CODE – R3) Q 112. Which one of the following is not a criterion for classification of fungi? 1. Mode of nutrition 2. Mode of spore formation 3. Fruiting body 4. Morphology of mycelium Q 113. Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification B. Tropical environments are more seasonal C. More solar energy is available in tropics. D. Constant environments promote niche specialization E. Tropical environments are constants and predictable Choose the correct answer from the options given below: 1. A and B only 2. A, B and C only 3. A, B and D only 4. A, C, D and E only Q 114. Which of the following is an example of actinomorphic flower? 1. Cassia 2. Pisum 3. Sesbania 4. Datura Q 115. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b) 1. (a) Hypogynous; (b) Epigynous 2. (a) Perigynous; (b) Epigynous 3. (a) Perigynous; (b) Perigynous 4. (a) Epigynous; (b) Hypogynous NEET (UG) – 2024 (CODE – R3) Q 116. Match List I with List II List – I List – II A. Nucleolus I. Site of formation of glycolipid B. Centriole II. Organization like the cartwheel C. Leucoplasts III. Site for active ribosomal RNA synthesis D. Golgi apparatus IV. For storing nutrients Choose the correct answer from the options given below: 1. D and E only 2. B and C only 3. A and E only 4. A and B only Q 117. What is the fate of piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The pieced of DNA would be able to multiply itself independently in the progeny cell of the organism. B. It may get integrated into the genome of the recipient C. It may multiply and be inherited along with the host DNA D. The alien piece of DNA is not an integral part of chromosome E. It shows ability to replicate Choose the correct answer from the options given below: 1. D and E only 2. B and C only 3. A and E only 4. A and B only Q 118. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of: 1. 6 bp 2. 4 bp 3. 10 bp 4. 8 bp NEET (UG) – 2024 (CODE – R3) Q 119. The cofactor of the enzyme carboxypeptidase is: 1. Niacin 2. Flavin 3. Haem 4. Zinc Q 120. Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO2 D. ATP E. NADPH Choose the correct answer from the options given below: 1. B, C and D only 2. C, D and E only 3. D and E only 4. A, B and C only Q 121. The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called; 1. Biodiversity conservation 2. Semi-conservation method 3. Sustainable development 4. In-situ conservation Q 122. Match List I with List II List – I List – II A. Two or more alternative forms of a gene I. Back cross B. Cross of F1 progeny with homozygous recessive parent II. Ploidy C. Cross of F1 progeny with any of parent III. Allele D. Number of chromosome sets in plant IV. Test cross Choose the correct answer from the options given below: 1. A – II, B – I, C – III, D – IV 2. A – III, B – IV, C – I, D – II NEET (UG) – 2024 (CODE – R3) 3. A – IV, B – III, C – II, D – I 4. A – I, B – II, C – III, D – IV Q 123. Formation of interfascicular cambium from fully developed parenchyma cells is an example for 1. Redifferentiation 2. Dedifferentiate 3. Maturation 4. Differentiation Q 124. Spindle fibers attach to kinetochores of chromosomes during 1. Metaphase 2. Anaphase 3. Telophase 4. Prophase Q 125. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it? 1. bb 2. Bb 3. BB/Bb 4. BB Q 126. A pink flowered Snapdragon plant was crossed with a flowered Snapdragon plant. Whattype of phenotype/s is/are expected in the progeny? 1. Red Flowered as well as pink flowered plants 2. Only pink flowered plants 3. Red, pink as well as white flowered plants 4. Only red flowered plants Q 127. Inhibition of Succinic dehydrogenase enzymes by malonate is a classical example of: 1. Feedback inhibition 2. Competitive inhibition 3. Enzyme activation 4. Cofactor inhibition NEET (UG) – 2024 (CODE – R3) Q 128. Give below are two statements : Statements I : Bt toxins are insects group specific and coded by a gene cry 1Ac. Statements II : Bt toxins exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active from due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below: 1. Both statement I and statement II are false 2. Statement I is true but statement II is false 3. Statement I is false but statement II is true 4. Both Statement I and Statement II are true Q 129. In the figure, which component has thin outer walls and highly thicked inner walls? 1. D 2. A 3. B 4. C Q 130. Which one of the following can be explained on the basis of Mendel’s Law of Dominance? A. Out of o9ne pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in 𝐹2 Generation. C. Factors occur in pairs in normal diploid plants D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below. 1. A, C, D and E 2. B, C and D only 3. A, B, C, D and E 4. A, B and C only NEET (UG) – 2024 (CODE – R3) Q 131. Identify the parts of the seed from the given figure which is destined to form root when the seed germinates. 1. B 2. C 3. AD 4. A Q 132. Auxin is used gardeners to papers weed-free lawns. But no damage is caused to grassas auxin. 1. Promotes anseission of mature leaves only 2. Does not affect mature monocotyledonous plants 3. Can help in division in grasses, to produce growth 4. Promotes apical dominance Q 133. Given below are two statements : Statements I : Chromosomes becomes gradually visible under microscope during leptotene stage. Statements II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose t6he correct answer from the options given below : 1. Both statement I and Statement II are false 2. Statement I is true but statement II is false. 3. Statement I is false but statement II is true 4. Both statement I and statement II are true Q 134. The capacity to generate a whole plant from any cell of the plant is called: 1. Micropropagation 2. Differentiation 3. Somatic hybridization 4. Totipotency NEET (UG) – 2024 (CODE – R3) Q 135. Given below are two statements : Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, Choose the correct answer from the options given below: 1. Both statements I and II statement II are false 2. Statement I is true but statement II is false 3. Statement I is false but statement II is true 4. Both statement I and statement II are true Section – B Q 136. Spraying sugarcane crop with which of the following plants growth regulators, increases the length of stem, thus, increasing the yield? 1. Gibberellin 2. Cytokinin 3. Abscisic acid 4. Auxin Q 137. Given below are two statements : Statement I : In 𝐶3 plants, some 𝑂2 binds to RuBisCO, hence 𝐶𝑂2 fixation is decreased. Statement II: In 𝐶4 plants , mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespirations. 1. Both statements I and statement II are false 2. Statement I is true but statement II is false 3. Statement I is false but statement II is true 4. Both statement I and statement II are true Q 138. Match List –I with List – II List –I List –II A GLUT-4 I. Hormone B. Insulin II. Enzymes C. Trypsin III. Intercellular ground substance D. Collagen IV. Enable glucose transport into cells NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below : 1. A-I, B-II, C-III, D-IV 2. A-II, B-III, C-IV, D-I 3. A-III, B-IV, C-I, D-II 4. A-IV, B-I, C-II, D-III Q 139. Read the following statements and choose the set of correct statements : In the membrane of Phaeophycean. A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a,c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. 1. B, C, D and E only 2. A, C, D and E only 3. A, B, C and E only 4. A, B, C and D only Q 140. Which of the following statements is correct regarding the process replication in E.coli? 1. The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5′ → 3′ 2. The DNA dependent DNA polymerase catalyses polymerizartion in 5′ → 3′ as well as 3′ → 5′ direction. 3. The DNA dependent DNA polymerase catalyses polymerization in 5′ → 3′ direction 4. The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3 → 5′ Q 141. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate. 1. Succinic acid - Malic acid 2. Succinyl – CoA - Succinic acid 3. Isocitrate - 𝛼 − ketoglutaric acid 4. Malic acid - Oxaloacetic acid NEET (UG) – 2024 (CODE – R3) Q 142. Match the List – I with List – II List -I List –II A. Robert May I. Species –areas relationship B. Alexander von Humboldt II. Long term ecosystem experiment using out door plots C. Paul Ehrlich III. Global species diversity at about 7 million D. David Tilman IV. Rivet popper hypothesis Choose the correct answer from the option as given below: 1. A-III, B-I, C-IV, D-II 2. A-I, B-III, C-II, D-IV 3. A-III, B-IV, C-II, D-I 4. A-II, B-III, C-I, D-IV Q 143. Identify the correct description about the given figure : 1. Water pollinated flowers showing stamens with mucilaginous covering 2. Cleistogamous flowers showing autogamy 3. Compact inflorescence showing complete autogamy 4. Wind pollinated plant inflorescence showing flowers with well exposed stamens. Q 144. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100 𝑥 (𝑘𝑐𝑎𝑙 𝑚−2 )𝑦𝑟 −1. What would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem? 1. x(kcal m−2 )yr −1 2. 10x(kcal m−2 )yr −1 100x 3. (kcal m−2 )yr −1 3x x 4. 10 (kcal m−2 )yr −1 NEET (UG) – 2024 (CODE – R3) Q 145. Match List – I with List –II List –I List –II A Rose I. Twisted aestivation B. Pea II. Perigynous flower C. Cotton III. Drupe D. Mango IV. Marginal placentation Choose the correct answer from the options given below: 1. A-I, B-II, C-III, D-IV 2. A-IV, B-III, C-II, D-I 3. A-II, B-III, C-IV, D-I 4. A-II, B-IV, C-I, D-III Q 146. Match List – I with List – II List –I List –II A Monadelphous I. Citrus B. Diadelpjhous II. Pea C. Polyadelphous III. Lily D. Epiphyllous IV. China-rose Choose the correct answer from the options given below : 1. A-IV, B-I, C-II, D-III 2. A-I, B-II, C-IV, D-III 3. A-III, B-I, C-IV, D-II 4. A-IV, B-II, C-I, D-III NEET (UG) – 2024 (CODE – R3) Q 147. Which of the following are fused in somatic hybridization involving two varieties of plants? 1. Somatic embryos 2. Protoplasts 3. Pollens 4. Callus Q 148. List – I List – II A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque II. Semi-conservative mode of DNA replication C. Har Gobind Khorana III. Transformation D. Meselson & Stahl IV. Lac operon Match List I with List II Choose the correct answer from the options given below: 1. A – III, B – IV, C – I, D – II 2. A – II, B – III, C – IV, D – I 3. A – IV, B – I, C – II, D – III 4. A – III, B – II, C – I, D – IV Q 149. The DNA present in chloroplast is: 1. Circular, double stranded 2. Linear, single stranded 3. Circular, single stranded 4. Linear, double stranded Q 150. Match List I with List II List – I List – II A. Citric acid cycle I. Cytoplasm B. Glycolysis II. Mitochondrial matrix C. Electron transport system III. Intermembrane space of mitochondria D. Proton gradient IV. Inner mitochondrial membrane NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below: 1. A – II, B – I, C – IV, D – III 2. A – III, B – IV, C – I, D – II 3. A – IV, B – III, C – II, D – I 4. A – I, B – II, C – III, D – IV NEET (UG) – 2024 (CODE – R3) ZOOLOGY Section – A Q 151. Which of the following is not a natural/traditiona contraceptive method? 1. Periodic abstinence 2. Lactational amenorrhea 3. Vaults 4. Coitus interruptus) Q 152. Match List I with List II List I List II A. Common cold I. Plasmodium B. Haemozoin II. Typhoid C. Widal test III. Rhinoviruses D. Allergy IV. Dust mites Choose the correct answer from the options giver answer below: 1. A-I, B-III, C-II, D-IV 2. А-III, В-I, C-II, D-IV 3. A-IV, B-II, С-III, D-I 4. A-II, B-IV, C-III, D-I Q 153. Which of the following statements is incorrect? 1. Most commonly used bio-reactors are of stirring type. 2. Bio-reactors are used to produce small scale bacterial cultures. 3. Bio-reactors have an agitator system an oxygen delivery system and foam control system. 4. A bio-reactor provides optimal growth conditions for achieving the desired product Q 154. Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy X E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below: 1. A, B & E only 2. B, C & E only NEET (UG) – 2024 (CODE – R3) 3. C, D & E only 4. A, B & D only Q 155. Match List I with List II : List I List II A. Down's syndrome I. 11th chromosome B. a-Thalassemia II. 'X' chromosome C. B-Thalassemia III. 21st chromosome D. Klinefelter's syndrome IV. 16th chromosome Choose the correct answer from the options given below: 1. А-II, В-III, С-IV, D-I 2. A-III, B-IV, C-I, D-II. 3. A-IV, B-I, C-II, D-III 4. A-I, B-II, C-III, D-IV Q 156. Match List I with List II : List I List II A: Non-medicated IUD- I. Multiload 375 B. Copper releasing IUD II. Progestogens C. Hormone releasing IUD III. Lippes loop D. Implants IV. LNG-20 Choose the correct answer from the options given below: 1. А-І, В-III, С-IV, D-II 2. A-IV, B-I, C-II, D-III 3. A-III, B-I, C-IV, D-II 4. A-III, B-I, C-II, D-IV Q 157. Match List I with List II : List I List II A. Pleurobrachia I. Mollusca B. Radula II. Ctenophora C. Stomochord III. Osteichthyes D. Air bladder IV. Hemichordata Choose the correct answer from the options given below: 1. A-II, B-I, C-IV, D-III 2. A-II, B-IV, C-I, D-III 3. A-IV, B-III, C-II, D-I 4. A-IV, B-II, C-III, D-I NEET (UG) – 2024 (CODE – R3) Q 158. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli? 1. High 𝑝𝑂2 and Lesser H+ concentration 2. Low pCO2 and High H+ concentration 3. Low pCO2 and High temperature 4. High pO2 and High pCO2 Q 159. Match List I with List II : List I List II A. Cocaine I. Effective sedative in surgery B. Heroin II. Cannabis sativa C. Morphine III. Erythroxylum D. Marijuana IV. Papaver somniferum Choose the correct answer from the options given below: 1. А-І, В-ІІІ, С-II, D-IV 2. A-II, B-I, C-III, D-IV 3. A-III, B-IV, C-I, D-II 4. A-IV, B-III, C-I, D-II Q 160. Match List I with List II : List I List II (Sub Phases of Prophase I) (Specific characters) A. Diakinesis I. Synaptonemal complex formation B. Pachytene II. Completion of terminalisation of chiasmata C. Zygotene III. Chromosomes look like thin threads D. Leptotene IV. Appearance of recombination nodules Choose the correct answer from the options given below: 1. A-I, B-II, C-IV, D-III 2. A-II, B-IV, C-1, D-III 3. A-IV, B-III, C-II, D-I 4. A-IV, B-II, C-III, D-I NEET (UG) – 2024 (CODE – R3) Q 161. Match List I with List II : List I List II A. Fibrous I. Adjacent joints vertebrae, limited movement B. Cartilaginous II. Humerus and joints Pectoral girdle, rotational movement C. Hinge joints III. Skull, don't allow any movement. D. Ball and IV. Knee, help in socket joints locomotion Choose the correct answer from the options given below: 1. А-І, В-III, C-II, D-IV 2. А-ІІ, В-III, C-I, D-IV 3. A-III, B-I, C-IV, D-II 4. A-IV, B-II, C-III, D-I Q 162.Which of the following is not a steroid hormone? 1. Testosterone 2. Progesterone 3. Glucagon 4. Cortisol Q 163. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on: 1. 10th segment 2. 8th and 9th segment 3. 11th segment 4. 5th segment NEET (UG) – 2024 (CODE – R3) Q 164. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below : 1. Both A and R are true but R is NOT the correct explanation of A. 2. A is true but R is false 3. A is false but R is true 4. Both A and R are true and R is the correct explanation of A Q 165. Match List I with List II : Choose the correct answer from the options given below: List I List II A. Expiratory capacity I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume B. Functional residual capacity II. Tidal volume +Expiratory reserve volume C. Vital capacity III Tidal volume + Inspiratory reserve D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume 1. A-III, B-II, C-IV, D-I 2. A-II, В-I, C-IV, D-III 3. A-I, В-III, C-II, D-IV 4. A-II, B-IV, C-I, D-III NEET (UG) – 2024 (CODE – R3) Q 166. Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body Name of muscle/location 1. (a) Skeletal - Triceps (b) Smooth – Stomach (c) Cardiac - Heart. (2) (a) Skeletal - Biceps (b) Involuntary - Intestine (c) Smooth - Heart (3) (a) Involuntary - Nose tip (b) Skeletal - Bone (c) Cardiac - Heart. (4) (a) Smooth - Toes, (b) Skeletal - Legs (c) Cardiac - Heart. Q 167. Match List I with List II : List I List II A. Lipase I. Peptide bond B. Nuclease II. Ester bond C. Protease III. Glycosidic bond D. Amylase IV. Phosphodiester bond Choose the correct answer from the options given below: 1. A-III, B-II, C-I, D-IV 2. A-II, B-IV, C-I, D-III 3. A-IV, B-I, C-III, D-II 4. A-IV, B-II, C-III, D-I NEET (UG) – 2024 (CODE – R3) Q 168. The flippers of the Penguins and Dolphins are the example of the 1. Natural selection 2. Convergent evolution 3. Divergent evolution 4. Adaptive radiation Q 169. Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below : 1. E-B-D-A-C 2. B-D-E-A-C 3. E-C-A-D-B 4. C-E-D-A-B Q 170. Which one of the following factors will not affect the Hardy-Weinberg equilibrium? 1. Genetic drift 2. Gene migration 3. Constant gene pool 4. Genetic recombination Q 171. Given below are two statements : Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below : 1. Both Statement I and Statement II are false 2. Statement I is true but Statement II is false 3. Statement I is false but Statement II is true 4. Both Statement I and Statement II are true NEET (UG) – 2024 (CODE – R3) Q 172. Match List I with List II: List I List II A. Typhoid I. Fungus B. Leishmaniasis ІІ. Nematode C. Ringworm III. Protozoa D. Filariasis IV. Bacteria Choose the correct answer from the options given below: 1. A-IV, B-III, C-I, D-II 2. А-III, В-I, C-IV, D-II 3. A-II, B-IV, C-III, D-I 4. A-I, B-III, C-II, D-IV Q 173. Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiensy C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below: 1. B-A-D-C 2. C-B-D-A 3. A-D-C-B 4. D-A-C-B Q 174. Which of the following is not a component of Fallopian tube? 1. Isthmus 2. Infundibulum 3. Ampulla 4. Uterine fundus Q 175. Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below: 1. A only 2. C only 3. D only 4. B only Q 176. Match List I with List II : List I List II A. Axoneme I. Centriole B. Cartwheel II. Cilia and flagella pattern C. Crista III. Chromosome D. Satellite IV. Mitochondria Choose the correct answer from the options given below : 1. A-IV, B-II, C-III, D-I 2. A-II, B-IV, C-I, D-III 3. A-II, B-I, C-IV, D-III 4. A-IV, B-III, C-II, D-I Q 177. Match List I with List II : List I List II A. Pterophyllum I. Hag fish B. Myxine II. Saw fish C. Pristis III. Angel fish D. Exocoetus IV. Flying fish Choose the correct answer from the options give below: 1. A-III, B-I, C-II, D-IV 2. A-IV, B-I, C-II, D-III 3. A-III, B-II, C-I, D-IV 4. A-II, B-I, C-III, D-IV NEET (UG) – 2024 (CODE – R3) Q 178. Match List I with List II : List I List II A. Pons I. Provides additional space for Neurons, regulates posture and balance. B. Hypothalamus II. Controls respiration and gastric secretions. C. Medulla III. Connects different regions of the brain D. Cerebellum IV. Neuro secretory cells Choose the correct answer from the options given below: 1. A-III, B-IV, C-II, D-I 2. А-І, В-III, C-II, D-IV 3. A-II, В-І, С-III, D-IV 4. А-II, В-III, C-I, D-IV Q 179. The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of 'X' and 'Y' genes : 1. The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid. 2. The gene 'X' is for protein involved in replication of Plasmid and 'Y' for resistance to antibiotics. 3. Gene 'X' is responsible for recognition sites and 'Y' is responsible for antibiotic resistance. 4. The gene 'X' is responsible for resistance to antibiotics and 'Y' for protein involved in the replication of Plasmid. NEET (UG) – 2024 (CODE – R3) Q 180. Given below are two statements : Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below : 1. Both Statement I and Statement II are false 2. Statement is true but Statement II is false 3. Statement l is false but Statement II is true 4. Both Statement I and Statement II are true Q 181. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby. In the light of the above statements, choose the most appropriate answer from the options given below: 1. Both A and R are correct but R is NOT the correct explanation of A. 2. A is correct but R is not correct. 3. A is not correct but R is correct. 4. Both A and R are correct and R is the correct explanation of A. Q 182. Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below : 1. A-E-C-B-D 2. B-D-E-C-A 3. E-A-D-B-C 4. E-C-A-D-B NEET (UG) – 2024 (CODE – R3) Q 183. Which one is the correct product of DNA dependent RNA polymerase to the given template? 3‘ TACATGGCAAATATCCATTCA’5 1. 5'AUGUAAAGUUUAUAGGUAAGU3’ 2. 5'AUGUACCGUUUAUAGGGAAGU3' 3. 5'ATGTACCGTTTATAGGTAAGT3’ 4. 5'AUGUACCCUUUAUAGGUAAGU3’ Q 184. Match List I with List II : List I List II A. 𝛼 −1 I. Cotton bollworm antitrypsin B. Cry IAb II. ADA deficiency C. Cry IAc III. Emphysema D. Enzyme IV. Corn borer replacement therapy Choose the correct answer from the options given below: 1. А-III, В-І, C-II, D-IV 2. A-III, B-IV, C-I, D-II 3. A-II, B-IV, C-I, D-III 4. A-II, B-I, C-IV, D-III Q 185. The "Ti plasmid of Agrobacterium tumefaciens stands for 1. Tumor independent plasmid 2. Tumor inducing plasmid 3. Temperature independent plasmid 4. Tumour inhibiting plasmid Section – B Q 186. Match List I with List II: List I List II A. P wave I. Heart muscles are electrically silent. B. QRS complex II. Depolarisation of ventricles. C. T wave III. Depolarisation of atria. D. T-P gap IV. Repolarisation of ventricles. NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below: 1. А-III, В-II, С-IV, D-I 2. A-II, B-III, C-I, D-IV 3. A-IV, B-II, C-I, D-III 4. A-I, B-III, C-IV, D-II Q 187. Given below are two statements : Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. X Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below : 1. Both Statement I and Statement II are false. 2. Statement I is true but Statement II is false. 3. Statement I is false but Statement II is true. 4. Both Statement I and Statement II are true. Q 188. Given below are two statements: Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements, choose the most appropriate answer from the options given below : 1. Both Statement I and Statement II are incorrect. 2. Statement I is correct but Statement II is incorrect. 3. Statement I is incorrect but Statement II is correct. 4. Both Statement I and Statement II are correct. Q 189. Choose the correct statement given below regarding juxta medullary nephron. 1. Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla. 2. Loop of Henle of juxta medullary nephron runs deep into medulla. 3. Juxta medullary nephrons outnumber the cortical nephrons. 4. Juxta medullary nephrons are located in the columns of Bertini. NEET (UG) – 2024 (CODE – R3) Q 190. Match List I with List II : List I List II A. Exophthalmic goiter I. Excess secretion of cortisol, moon face & hyperglycemia B. Acromegaly II. Hypo-secretion of thyroid hormone and stunted growth. C. Cushing's syndrome III Hyper secretion of thyroid hormone & protruding eye balls. D. Cretinism IV. Excessive secretion of growth hormone. Choose the correct answer from the options given below: 1. A-IV, B-II, C-I, D-III 2. A-III, B-IV, C-II, D-I 3. A-III, B-IV, C-I, D-II 4. A-I, B-III, C-II, D-IV Q 191. Match List I with List II: List I List II A. Unicellular glandular epithelium I. Salivary glands B. Compound epithelium II. Pancreas C. Multicellular glandular epithelium III. Goblet cells of alimentary canal D. Endocrine glandular epithelium IV. Moist surface of buccal cavity Choose the correct answer from the options given below: 1. A-IV, B-III, C-I, D-II 2. A-III, B-IV, C-I, D-II 3. A-II, В-I, C-IV, D-III 4. A-II, B-I, C-III, D-IV Q 192. Match List I with List II : List I List II A. RNA polymerase III I. snRNPS B. Termination of II. Promotor transcription C. Splicing of Exons III. Rho factor D. TATA box IV. SnRNAs, tRNA NEET (UG) – 2024 (CODE – R3) Choose the correct answer from the options given below: 1. A-III, В-II, C-IV, D-I 2. A-III, B-IV, C-I, D-II 3. ATV, B-III, C-I, D-II 4. A-II, B-IV, C-I, D-III Q 193. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. 1. ICSH, Interstitial cells, Leydig cells, spermiogenesis. 2. FSH, Sertoli cells, Leydig cells, spermatogenesis. 3. ICSH, Leydig cells, Sertoli cells, spermatogenesis. 4. FSH, Leydig cells, Sertoli cells, spermiogenesis Q 194. Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below: 1. A, E, B, D, C 2. B, A, C, D, E 3. E, D, C, B, A 4. E, A, D, С, В Q 195. The following are the statements about non- chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. NEET (UG) – 2024 (CODE – R3) Choose the most appropriate answer from the options given below : 1. A, B & D only 2. B, D & E only 3. B, C & D only 4. A & C only Q 196. Match List I with List II related to digestive system of cockroach. List I List II A. The structures used for I. Gizzard storing of food. B. Ring of 6-8 blind tubules II. Gastric Cacca at junction of foregut and midgut. C. Ring of 100-150 yellow III. Malpighian tubules coloured thin filaments at junction of midgut and hindgut. D. The structures used for IV. Crop grinding the food. Choose the correct answer from the options given below: 1. A-1, B-II, C-III, D-IV 2. A-IV, B-III, C-II, D-I 3. A-III, B-II, C-IM, D-I 4. A-IV, B-II, C-III, D-I Q 197. Given below are two statements : Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below: 1. Both Statement I and Statement II are incorrect. 2. Statement I is correct but Statement II is incorrect. 3. Statement I is incorrect but Statement II is correct. 4. Both Statement I and Statement II are correct. NEET (UG) – 2024 (CODE – R3) Q 198. Match List I with List II : List I List II A. Mesozoic Era I. Lower invertebrates B. Proterozoic Era II. Fish & Amphibia C. Cenozoic Era III. Birds & Reptiles D. Paleozoic Era IV. Mammals Choose the correct answer from the options given below: 1. A-III, B-I, C-II, D-IV 2. A-I, B-II, C-IV, D-III 3. A-III, B-I, C-IV, D-II 4. A-II, B-I, C-III, D-IV Q 199. As per ABO blood grouping system, the blood group of father is B+, mother is 𝐴+ and child is 𝑂+ Their respective genotype can be A. 𝐼 𝐵 𝑖/𝐼 𝐴 𝑖/𝑖𝑖 B. 𝐼 𝐵 𝐼 𝐵 /𝐼 𝐴 𝐼 𝐴 /𝑖𝑖 C. 𝐼 𝐴 𝐼 𝐵 /𝐼𝐼 𝐴 /𝐼 𝐵 𝑖 D. 𝐼 𝐴 𝑖/𝐼 𝐵 𝑖/𝐼 𝐴 𝑖 E. i𝐼 𝐵 /𝐼𝐼 𝐴 /𝐼 𝐴 𝐼𝐵 Choose the most appropriate answer from the options given below; 1. B only 2. C & B only 3. D & E only 4. A only Q 200. Given below are two statements : Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. In the light of the above statements, choose the most appropriate answer from the options given below: 1. Both Statement I and Statement II are incorrect. 2. Statement I is correct but Statement II is incorrect. 3. Statement I is incorrect but Statement II is correct. 4. Both Statement I and Statement II are correct.