Effects of Mutation in DNA

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson
Download our mobile app to listen on the go
Get App

Questions and Answers

What characterizes amphiphilic molecules?

  • They are entirely non-polar.
  • They contain both hydrophilic and hydrophobic regions. (correct)
  • They are exclusively attracted to water.
  • They have only hydrophilic regions.

What role does cholesterol play in the cell membrane?

  • It helps maintain the structure and properties of the membrane. (correct)
  • It makes the membrane fully permeable.
  • It serves as a barrier to all substances.
  • It is primarily involved in energy production.

Which statement best describes the nature of the cell membrane?

  • It is impermeable to all molecules.
  • It allows free passage of all ions.
  • It is completely polar.
  • It is selectively permeable, controlling what enters and exits. (correct)

How can substances pass through the cell membrane?

<p>By diffusion and active transport through pumps or channels. (B)</p> Signup and view all the answers

What is the significance of the partial charges on oxygen and hydrogen in the context of fatty acids?

<p>They allow the molecules to form polar interactions. (B)</p> Signup and view all the answers

What type of molecules does the term 'lipids' specifically refer to?

<p>A diverse group including fats, oils, and steroids. (B)</p> Signup and view all the answers

Which of the following substances is derived from cholesterol?

<p>Steroid hormones. (B)</p> Signup and view all the answers

What describes the hydrophobic characteristic of lipids?

<p>They repel water and do not mix with it. (D)</p> Signup and view all the answers

What is a characteristic of a covalent bond?

<p>It is a strong bond involving the sharing of electrons. (C)</p> Signup and view all the answers

What defines an ion?

<p>A charged particle that can be either positive or negative. (A)</p> Signup and view all the answers

How do temperature changes affect hydrogen bonds?

<p>Higher temperatures increase molecular vibration, potentially breaking bonds. (B)</p> Signup and view all the answers

Which type of molecule is characterized by having a non-polar charge distribution?

<p>A non-polar molecule. (C)</p> Signup and view all the answers

What is the relationship between cations and anions?

<p>Cations are positively charged and anions are negatively charged. (A)</p> Signup and view all the answers

Which description best defines polar molecules?

<p>Molecules that have a slight charge due to unequal electron sharing. (A)</p> Signup and view all the answers

What occurs during the formation of hydrogen bonds between water molecules?

<p>There is a weak attraction between positively charged hydrogen and negatively charged oxygen. (D)</p> Signup and view all the answers

What happens to molecular vibrations at low temperatures?

<p>Molecular vibrations decrease, leading to stronger bonds. (A)</p> Signup and view all the answers

What is a mutation in DNA?

<p>An alteration of the DNA sequence (B)</p> Signup and view all the answers

How can a mutation contribute to evolution?

<p>By providing genetic variation that may offer survival advantages (C)</p> Signup and view all the answers

What effect does a change in mRNA have on protein function?

<p>It alters the protein's amino acid sequence and function (A)</p> Signup and view all the answers

What role do cell membranes play in cellular function?

<p>They control the movement of substances in and out of the cell (A)</p> Signup and view all the answers

What is the primary function of mitochondria in a cell?

<p>To convert glucose and oxygen into ATP (C)</p> Signup and view all the answers

What describes the function of the nucleus?

<p>To store DNA and control gene expression (A)</p> Signup and view all the answers

What is the function of receptors in a cell?

<p>To enable interaction with other cells and the environment (D)</p> Signup and view all the answers

What is the primary difference between cytoplasm and cytosol?

<p>Cytoplasm contains organelles, while cytosol is the fluid part inside the cell excluding organelles (D)</p> Signup and view all the answers

What characterizes a cation?

<p>It is a positively charged ion (C)</p> Signup and view all the answers

How is a polar molecule created?

<p>By unequal sharing of electrons, leading to partial charges (A)</p> Signup and view all the answers

What is the primary function of DNA segments?

<p>To build proteins (D)</p> Signup and view all the answers

Which macromolecule is DNA primarily composed of?

<p>Nucleotides (B)</p> Signup and view all the answers

What is the primary function of the Na+/K+ pump?

<p>Transport Na+ into the cell and K+ out of the cell. (B)</p> Signup and view all the answers

What process occurs in the nucleus involving DNA?

<p>DNA replication (C)</p> Signup and view all the answers

Which of the following describes a characteristic of passive transport?

<p>Occurs across a concentration gradient. (C)</p> Signup and view all the answers

How does DNA influence enzyme function?

<p>By encoding genetic information (B)</p> Signup and view all the answers

What types of molecules can typically cross the phospholipid bilayer freely?

<p>Small non-polar molecules and gases. (D)</p> Signup and view all the answers

What is the sequence of nucleotides in the provided DNA example?

<p>AGGATACCAAGGATGACTTTTCAT (D)</p> Signup and view all the answers

What happens to mRNA in the cytoplasm?

<p>It is translated into proteins (A)</p> Signup and view all the answers

What is the effect of opening Na+ channels in a cell?

<p>Na+ ions will increase inside the cell. (D)</p> Signup and view all the answers

Which process is classified as active transport?

<p>Endocytosis of large molecules. (C)</p> Signup and view all the answers

Which of the following best describes the tertiary structure of proteins?

<p>Three-dimensional folded shape (B)</p> Signup and view all the answers

What type of reactions does DNA play a crucial role in?

<p>Metabolic pathways (C)</p> Signup and view all the answers

What do hydrophilic substances require to cross the cell membrane?

<p>They require protein channels. (C)</p> Signup and view all the answers

Which of the following is NOT true about active transport?

<p>It occurs through protein channels only. (C)</p> Signup and view all the answers

What chemical component is directly tied to the instructions for protein synthesis?

<p>mRNA (A)</p> Signup and view all the answers

What role do enzymes play in metabolic reactions?

<p>They lower the activation energy required for reactions. (C)</p> Signup and view all the answers

Which option correctly describes the role of proteins coded by DNA?

<p>They act as structural components (D)</p> Signup and view all the answers

Which substance crosses the cell membrane through a protein channel?

<p>Glucose and ions. (C)</p> Signup and view all the answers

What differentiates active transport from passive transport?

<p>Active transport requires energy expenditure. (C)</p> Signup and view all the answers

Flashcards are hidden until you start studying

Study Notes

Effects of Mutation

  • Mutation in DNA refers to a change in the sequence of nucleotides.
  • Mutations can occur randomly and result in genetic variation in populations over time.
  • Genetic variation allows for different traits; advantageous traits can lead to better survival and reproduction.
  • Change in mRNA due to mutation alters polypeptide shape, ultimately affecting protein function.

Cell Structure and Function

  • Cell membrane acts as a barrier, controlling the entry and exit of substances via channels and pumps.
  • Mitochondria convert glucose and oxygen into ATP, serving as cellular energy sources.
  • The nucleus houses DNA, providing instructions to produce enzymes that accelerate biochemical reactions.
  • Cytoskeleton contributes to cell structure and shape.
  • Cytoplasm comprises all fluid inside the cell excluding the nucleus, while cytosol is the fluid within the cell excluding organelles.
  • Extracellular fluid is primarily water, existing outside the cell, facilitating communication and interactions.

Atoms, Molecules, and Bonds

  • An atom is a basic unit of matter, with cations being positively charged and anions negatively charged.
  • Polar molecules have uneven distribution of charge, leading to the formation of hydrogen bonds, key for water’s properties.
  • Covalent bonds involve strong interactions between atoms sharing electrons.
  • Temperature influences hydrogen bond dynamics; higher temperatures increase molecular vibration, weakening bonds.
  • Amphiphilic molecules possess both hydrophilic (water-attracting) and hydrophobic (water-repelling) regions.

The Cell Membrane

  • Characteristics of lipids include being non-polar and hydrophobic, crucial for membrane integrity.
  • The cell membrane is selectively permeable, regulating the passage of substances.
  • Important lipids include cholesterol (maintains membrane fluidity) and steroid hormones (derived from cholesterol).
  • Substances can cross the membrane via passive transport (channels) or active transport (pumps).

Transport Mechanisms

  • In passive transport, molecules flow along the concentration gradient (high to low concentration); e.g., sodium (Na+) enters while potassium (K+) exits.
  • Active transport requires energy (ATP) to move substances against the concentration gradient.
  • Sodium-potassium pump maintains essential ion balance; Na+ is pumped out while K+ is brought in.
  • Endocytosis and exocytosis involve transport of large molecules or particles using ATP for energy.

Chemical Reactions and Metabolism

  • Metabolism encompasses all chemical reactions in the body, categorized as catabolism (breaking down molecules) and anabolism (building larger molecules).
  • Proteins serve as biological catalysts (enzymes) facilitating reactions, determined by amino acid sequences and bonding.
  • Genes are segments of DNA that encode information for building proteins and control cellular functions.
  • DNA is a macromolecule constructed from nucleotides, creating the genetic code responsible for protein synthesis and cellular activities.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

Test #2 PDF

More Like This

Use Quizgecko on...
Browser
Browser