Test #2.pdf

I Effects of mutation Define mutation Explain how mutation contribute to in DNA...

I Effects of mutation Define mutation Explain how mutation contribute to in DNA the evolution Change Sequence Random mutation will occur and over- Describe now a DNA mutation time will lead genetic variation in may a pop affect the func. Of a protein of organisms is therefore survive Change in MRNA - Change the reproduce to pass on the advantageous > polypeptide change the protein genes > - change the function Cells introduction Relate cellStructure to cell function · Cell membrane Channels/pumps : controls · what sub Mitochondria : convert glucose and O2 goes in and out of into ATP = energy the cell · Nucleus : DNA Kept here - intructions to produce enzymes: speeding up biochemical more cells proteins reactions · Cytoskeleton : Structure/shape Intracellular fluid · : mostly water + biochemicals Cytoplasm : All fluid inside the cell · except the nucleus Cytosol : All fluid inside · the cell except the organelle and the nucleus extracellular fluid : fluid outside the cell · mostly water - receptors/sensors : Allow cell to interact with Other cells + environment  Atoms, Molecules Bonds I Defineatomon cation anionprovidea , , polar creating these hydroge a e. g O Coxygene) bonds. Define bonds hydrogen · Ion : charged positive Weak' bonds' attraction between or negative Hst0S- ↓ d now hydrogen cations anions Identify bonds form between water molecules. H+ C - Due to the attraction of molecules Define covalent bond between the water molecules covalent bond : very strong bond between Identify how the temp can affect atoms sharing of electrons hydrogen bonds Compare molecules based on their charge ↓ temp : low vibration between the distribution. It bonds is in fact atoms NON polar Polar ion ↑ temp : High vibration between Overall neutral chargeegative. H bonds break the atoms charge neutral Define or solution ,solvant , solute positive d charge distribution even uneven uneven ↓ liquid ↓ Sub dissolved solvant in solvent sante H2O Nat + cat , Oz CO2 Exemples , compare hydrophilic vs hydrophobic , + Fatty acids glucose Cl , H subtances. I I interact other non-polar other polar Other ion / hydrophilic hydrophobic with molecules moleculestions polar molecules Mixes non-polar solvants withintoter Dissolves non-polar benzene H20 eg in subtance Hz0 e. g benzene non-polar molecules: Describe how water as a molecule Polar molecules: lipids example glucose "Magnet". Mention polarity fatty acids Since the oxygene atom have a Amino acids Oz CO2 partial negative and the Define amphiphilic molecules charge hydrogen partial positive have a Molecules having both. When charge they are aligned the hydrophilic hydro- and O atom will attract an other H atom Since are. phobic regions  The cell membrane · Identify I characteristics of lipids Recognize that the cell membrane is non-polar-hydrophobic selectively permeable List some important lipids and list ↳ decides wat can go in/out corresponding func. / characteristics Cholesterol : helps properties of cell w Identify 2 ways substances can go membrane template to through the cell membrane make steroids hormones pumps or channels Steroid hormones : Derived from Cholesterol Straight throughthe membrane e g. testosterone , estrogen , progesterone Fat/Oils triglycerides : Describe the structure and function of phospholipids Structure: hydrophilic head hydrophobic tail various environmental insults Identify the main components of the cell membrane ' their function Phospholipid Molecules : form cell membrane ↓ phospholipid bilayer Phospholipid bilayer : Allow passage of non polar (hydrophilic) subtances. Cholesterol : set stability of cell membrane Proteins Channels/pumps : Allow passage Of polar subtances Nat + glucose even receptors for a hormone Cytoskeleton filaments : gives cells structure + shape  I Passive Transport Explain Diffusion mour. of a subtance from a region Of Describe Osmosis high concentration to a low concentration diffusion of water across Indicate how hydrophobic substances may Semi-permeable membrane diffuse across the cell membrane. Simple diffusion through proteins channels Indicate how hydrophilic subtances may diffuse across the cell membrane. Facilitated diffusion through the phospholipid bilayer Compare Active Of Nat and Transport the concentration Describe the general role of ATP in cells + in intracellular vs. extracellular provides energy to places where Fluid energy-consuming activities are [Nat] extracellular & intracellular ↓ taking place. [ K ] intracellular ↑ + extracellular ↓ Compare chracteristics Of passive vs. Describe the effect of opening active transport , and in each case identify Nat or K+ Channels (passive which molecules /ions can pass and how transport) passive Active Nat will flo inside the cell concentration H-L LH K t will flo outside the cell gradient Describe the characteristics of active Requires NOPE YES transport energy(ATP) Requires ATP which sub can Oz , CO2 , lipids cross the Transports molecules or ions from ↓ to ↑ phospholipid + small amount of water NIA concentration bilayer hydrophobic non-polar Describe how the Nat/k pump performs + Which sub can Glucose , Nat, K+ Glucose , Nat, + cross via protein ions, polar its function channel ions , polar o umps hydrophilic hydrophilic Nat pump inside to outside LtH Recognize endocytosis and exocytosis as forms k+ pump outside to inside +H of active transport (need) ATP Define Explain reactions Speed variable 'R' Identify ↓ what Structure and func Chemical reactions metabolism therole of Proteins , DNA Describe the of proteins common back bone , catabolism total of all biochemical reactions in the human body enzymes group ↓ breaking down molecules building larga small ones up chemical reactions general & mainly determines proteins Sequence the amino acids- primary Structure bonds forme between Amina acids contains information Define genes ↳ secondary Describe the func. structure of DNA large macromolecule made of nucleotides (genetic code) Segments of DNA contains build proteins sanabolism in chemical 6) in the chain or I I structure 3D tertiary Structure instructions to Protein Describe. enzymes 2 In cytoplasm - Build. MRNA : C- 6 Asu > a I Define metabolic explain the role facilitate to 1 In nucleus products > DNA has - make copied pathways played by A serie of chemical reactions that With a substrate and end product S the and a protein a DNA DNA Sequence: AGGATACCAAGGATGACTTTTCAT UCUA finish genes proteins. DNA into miRNA (messenger) mRNA travels to the cytoplasm and is formed and the transformation of substrates Synthesis the steps in proteins Synthesis to ribosome : protein making protein from machine is read Sequence start with an A 6> Recognize that gene expression determines cell structure and function T-A Compare RNA and DNA Resulting ↓ ↳Double Stranded Amino acids Met-Val-Pro-Thr-Glu-Lys A copy of DNA gene sequence (single strand)  I Cells Division Introduction Recognize the advantages of having many Describe chromosomes small cells Densely packed DNA wrapped around special proteins transportedeasa Some can have many specialized try genes Possible errors in chromosome distribution Recognize the role of DNA replication in cell division Down Syndrome/Trisomy #21 (3 chromosomes # 21) The DNA is copied creplicated) before the Klinefelter syndrome XXY formation of new cells Stem Cells Explainhows cells with the same Identify how pools of stem cells DNA can have different structures maintained life ↓ are throughout function Self-renewal they synthesize and accumulate different Sets Of RNA and protein molecules compare stem cells , progenitor cells I differentiated terminally cell cells in terms of differentiation cmaturity) b begrea differentiation (maturity) immature intermediate mature