High Sensitivity SARS-CoV-2 Detection Using Graphene Oxide-Multiplex qPCR PDF

MT 6332: Seminar 1 GROUP 1: 4GMT High sensitivity SARS-CoV-2 detection using graphene oxide-multiplex qPCR Yuanyuan Zeng, Lili Zhou, Zhongzhu Yang, Xiuzhong Yu, Zhen Song, Yang...

MT 6332: Seminar 1 GROUP 1: 4GMT High sensitivity SARS-CoV-2 detection using graphene oxide-multiplex qPCR Yuanyuan Zeng, Lili Zhou, Zhongzhu Yang, Xiuzhong Yu, Zhen Song, Yang He ___________________________________________________________ INTRODUCTION OUTLINE COVID-19 PANDEMIC I Introduction A COVID-19 Pandemic The worldwide epidemic is caused by the B Diagnostic Standards highly infectious severe acute respiratory i Reverse Transcription-Quantitative syndrome coronavirus 2 (SARS-CoV-2). Polymerase Chain Reaction ii Multiplex QPCR SARS-CoV-2 is mainly transmitted through the C Graphene Oxide (GO) respiratory tract, with extremely easy spread D Objectives of the Study among populations. II Materials and Methods A Study Design B Endpoints DIAGNOSTIC STANDARDS i Sensitivity Analysis ii Specificity Analysis C Inclusion Criteria REVERSE TRANSCRIPTION-QUANTITATIVE D Exclusion Criteria POLYMERASE CHAIN REACTION E Preparation of Graphene Oxide RT-qPCR is the gold standard for detecting F Establishing Go-Forward Primer Composites SARS-CoV-2. G Establishment of the GO-multiplex qPCR method ○ However, it detects only 71% of H The specificity and sensitivity of GO-multiplex SARS-CoV-2 infections. qPCR I Evaluation of the assay using SARS-CoV-2 Insufficient assay sensitivity and low pseudovirus sample concentrations due to low J Adsorption efficiency of GO on ssDNA viral load in vivo or improper III Results and Discussion A Characterization of GO sampling. i Transmission Electron Microscope MULTIPLEX QPCR ii Atomic Force Microscopy iii Raman Spectroscopy Multiplex qPCR is the commonly adopted iv Fourier Transform Infrared Spectroscopy assay for gene expression and single v Ultraviolet-Visible Absorption Spectroscopy nucleotide polymorphism (SNP) analysis. vi X-Ray Photoelectron Spectroscopy ○ Detects different target genes B Optimization of GO solutions simultaneously, although its application in C Optimization of temperature for GO-forward primer composites clinical diagnosis is low due to its D Specificity and Sensitivity of the GO-multiplex complexity and possible interference PCR between different amplification reactions. E Evaluation of the assay using SARS-CoV-2 pseudovirus A high-sensitivity multiplex qPCR system is F Analysis and Functionalization principles of the necessary to enhance the accuracy of GO-forward primer Composites SARS-CoV-2 detection. IV Conclusion V Group’s Critique A Critique of Strengths GRAPHENE OXIDE (GO) i Improved Specificity and Sensitivity An oxidation derivative of graphene ii Higher Efficiency Rate B Critique of Limitations ○ Having a sp2 region with a hexagonal i Limited Pathogen Evaluation honeycomb structure and the sp3 carbon ii Higher Testing Complexity C Critique of Statistics matrix region linked to oxygen-containing i Analysis of Reproducibility and Variance functional groups. D Group Conclusion ○ sp2 structural domain gives GO an E Application to Current Clinical Practice i Earlier Detection And Diagnosis affinity for aromatic rings and a ii Lower Rate of Possible Disease fluorescence-quenching ability Transmission ○ The hydrophilic group attached to the sp3 iii Establish Molecular Techniques F Further Studies Needed region stabilizes GO in aqueous solutions. ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 1  Enhances the sensitivity of conventional PCR SPECIFICITY ANALYSIS and single qPCR for detecting tuberculosis Non-cross-reactivity with other common and ovarian cancer. respiratory viruses to avoid false positives Adsorb single-stranded DNA (ssDNA), preventing mismatches and enhancing the INCLUSION CRITERIA efficiency of multiplex reactions. The study used specific SARS-CoV-2 genes, ○ This is due to the large surface area, namely RNA-dependent RNA polymerase outstanding chemical functional groups, gene (RdRP) and Envelope (E), as target and unique interfacial properties. genes for detection. ○ GO-multiplex qRT-PCR reduces the limit RNase P gene, a human gene, is used as a of SARS-CoV-2 detection by 10-fold. reference in the multiplex qPCR. Nine common respiratory RNA and DNA OBJECTIVES OF THE STUDY viruses for specificity testing, like adenovirus, Develop a GO-multiplex qPCR method to rhinovirus, and human parainfluenza virus, significantly improve the detection sensitivity were used to evaluate cross-reactivity. of SARS-CoV-2, particularly for Pseudovirus samples containing SARS-CoV-2 low-viral-load samples genetic material are included to test the Investigate whether GO can improve the assay’s sensitivity and accuracy in real-world sensitivity of multiplex qPCR by reducing the applications. virus's detection limit. Evaluate whether GO can prevent EXCLUSION CRITERIA non-specific primer interactions and ensure The study excluded viruses outside the accurate detection of SARS-CoV-2 without scope of common respiratory viruses for cross-reactivity with other commonly known specificity testing. respiratory viruses Non-target SARS-CoV-2 genes were Compare the performance of conventional excluded from the GO-multiplex qPCR assay multiplex qPCR with the GO-multiplex qPCR since only the RdRP and E genes were chosen through the limits of detection, amplification for the assay. efficiency, and cycle threshold (Ct) values PREPARATION OF GRAPHENE OXIDE MATERIALS AND METHODS Sulfuric acid (95-98%) and graphite (0.5g) were added to a beaker and stirred using a STUDY DESIGN magnetic stirrer The study focused on developing a new Potassium permanganate (3g) and potassium method of detecting SARS-CoV-2 using nitrate (0.5g) were added to the sulfuric graphene oxide (GO)-multiplex qPCR through acid-graphite solution, forming a dark green experimental research. MnO₃+ solution After settling under light-proof conditions, ENDPOINTS H₂O₂ (2.5 mL or 10 mL) was added to the The endpoints help evaluate the effectiveness solution to oxidize the graphite, forming the of the newly developed method of GO stock solution. SARS-CoV-2 detection in comparison to the The residual acid and low molecular weight conventional method. byproducts were removed through dialysis in deionized water using a 3500 Da dialysis bag SENSITIVITY ANALYSIS The GO stock solution was sonicated for 20 Limit of detection or lowest number of viral minutes to ensure uniform dispersal before copies per reaction further use in experiments. Cycle threshold (Ct) values for earlier detection of the target ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 2  ESTABLISHING GO-FORWARD PRIMER GO stock solutions were prepared at various COMPOSITES concentrations (5.21 to 23.46 μg/mL) for Primers and probes for RdRP, E, and RNase P GO-forward primer composites targeting genes were designed following WHO and CDC RdRP, E, and RNase P genes, with optimal GO methods and synthesized by Sangon Biotech, concentration assessed by comparing Ct with probes labeled using specific values to conventional multiplex qPCR results. fluorophores (JOE, ROX, HEX). A pre-sonicated GO stock solution was mixed THE SPECIFICITY AND SENSITIVITY OF with 10 μM forward primers in a one-to-one GO-MULTIPLEX qPCR ratio, followed by sonication and incubation to Tested simultaneously with GO-multiplex and enhance primer adsorption. multiplex qPCR using nine common The adsorption capacity of GO was tested at respiratory viruses and SARS-Cov-2 (from various temperatures (35 °C, 50 °C, 65 °C, Maccura Biotechnology in Sichuan, China) 80 °C), and unbound GO was removed ○ 2 RNA viruses through centrifugation at 13,800 g. Coronavirus HKU1 RNase-free ddH2O served as a control, Human parainfluenza virus processed at room temperature, with a ○ 7 DNA viruses forward primer concentration of 5 μM in all Enterovirus composites. Adenovirus Rhinovirus Human cytomegalovirus Varicella-Zoster Mumps Measles Sensitivity was measured using three plasmids, including RdRP, E, and RNase P target sequences ○ Each plasmid was serially diluted from 107 ESTABLISHMENT OF THE GO-MULTIPLEX to 101 copies/μL qPCR METHOD GO-multiplex qPCR reactions include: ○ Used GO-multiplex and conventional ○ 12.5 μL SuperMix multiplex qPCR for SARS-CoV-2 detection ○ 0.5 μL each probe, to compare the sensitivities of the two ○ 1 μL GO-forward primer composites methods ○ 0.6 μL reverse primers ○ 1 μL DNA template, and EVALUATION OF THE ASSAY USING ○ 3.5 μL RNase-free ddH20 SARS-CoV-2 PSEUDOVIRUS SARS-CoV-2 pseudoviruses with RdRP and E Conventional multiplexes used similar target sequences from Maccura components, Biotechnology ○ substituting forward primers for 0.5 μL SARS-CoV-2 RNA extracted using MagicPure each and 5 μL ddH2O Simple Viral DNA/RNA Kit ○ maintaining a 0.2 μM concentration for RNA samples were diluted into five different forward primers in both methods. concentrations and reverse transcribed using Both qPCR methods: the Transcript First-Strand cDNA Synthesis ○ were run for 40 cycles on a qTOWER 2.2 SuperMix Kit thermocycler, All samples were tested simultaneously to ○ with denaturation at 94 °C for 30 compare the results of GO-multiplex and seconds, followed by cycles of 94 °C for multiplex qPCR techniques 5 seconds and 60 °C for 30 seconds. ○ Reporter dyes included JOE, ROX, and HEX; results with ≤37 Ct values were deemed positive. ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 3  ADSORPTION EFFICIENCY OF GO ON ssDNA ○ 1279 cm⁻¹: Epoxy C-O-C bending Forward primers labeled with reporter dyes at ○ 1099 cm⁻¹: C-O stretching the 5’ end and mixed separately with optimized GO solution ULTRAVIOLET-VISIBLE ABSORPTION ○ RdRP - JOE SPECTROSCOPY ○ E - ROX Identification of optical properties and ○ RNase P - HEX electronic transitions ○ Water - control Mixtures were divided into four portions and X-RAY PHOTOELECTRON SPECTROSCOPY incubated at different temperatures for 30 PATTERN mins (35°C, 50°C, 65°C, 80°C) and covered Identified the chemical composition and with tin foil to avoid fluorescence decay functional groups present on the surface of Fluorescence intensity measured using the graphene oxide (GO) Spectramax iD5 To analyze the carbon-oxygen bonding in the GO crucial for understanding its ability to RESULTS AND DISCUSSION interact with the primers in the qPCR. XPS spectra revealed the presence of various CHARACTERIZATION OF GO functional groups: ○ C=C (sp² hybridized carbon) at 284.6 eV. TRANSMISSION ELECTRON MICROSCOPE ○ C–C (sp³ hybridized carbon) at 285.7 eV. A transmission electron microscope (TEM) ○ C–O and C=O peaks, confirming the was used to reveal the structural form of GO functionalization of GO prepared in 2.5 mL and 10 mL H2O2 ○ 2.5 mL: abundant and homogenous sp2 lattice ○ 10 mL: disordered regions with few atypical sp2 lattices ATOMIC FORCE MICROSCOPY Used to reveal different morphological forms Figure A. TEM Image Figure B. TEM Image ○ GO prepared with 2.5 mL H₂O₂ of the GO prepared by of the GO prepared by Had an average lateral size of 2.5mL H2O2 10 mL H202 approximately 2 µm, representing larger and more uniform sheets. ○ GO prepared with 10 mL H₂O₂ Showed a reduction in lateral size RAMAN SPECTROSCOPY Identification of sp² and sp³ regions, detected at 1598 cm⁻¹, and 1374 cm⁻¹, respectively. FOURIER TRANSFORM INFRARED Figure C. AFM image Figure D. AFM image SPECTROSCOPY of the GO prepared by of the GO prepared by Identified key functional groups in GO 2.5mL H2O2 10 mL H202 samples prepared with 2.5 mL H₂O₂ ○ 3419 cm⁻¹: O-H stretching (hydroxyl groups) ○ 1734 cm⁻¹: C=O stretching (carbonyl groups) ○ 1626 cm⁻¹: C=C stretching (graphitic regions) ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 4  OPTIMIZATION OF TEMPERATURE FOR GO-FORWARD PRIMER COMPOSITES 50°C was considered the optimum temperature for constructing GO-forward primer composites. ○ At 35°C, no gene amplification of the 3 target genes. Increasing the temperature Figure E. Raman Figure F. FT-IR spectra to 50°C promoted gene amplification, but spectra of the GO of the GO prepared by further increasing it to 65°C and 80°C prepared by 2.5 mL 2.5 mL and 10 mL H202 increased the Ct values instead. and 10 mL H202 SPECIFICITY AND SENSITIVITY OF THE GO-MULTIPLEX QPCR The GO-multiplex qPCR correctly discerned SARS-COV-2 without any cross-reactivity, demonstrating its high specificity. The limit of detection of GO-multiplex qPCR was 10 copies reaction, which is 10-fold lower Figure G. than conventional multiplex qPCR, indicating High-resolution XPS GO-multiplex qPCR’s higher sensitivity Figure H. UV-vis C1s spectra of the GO compared to the conventional method. absorption spectrum of the GO EVALUATION OF THE ASSAY USING SARS-COV-2 PSEUDOVIRUS OPTIMIZATION OF GO SOLUTIONS Comparative evaluation of SARS-COV-2 Two different H₂O₂ volumes (2.5 mL and 10 pseudovirus detection was done using the mL) were tested during GO preparation to GO-multiplex qPCR method and Conventional adjust the ratio of sp² (graphitic) and sp³ multiplex qPCR method to evaluate the (defective) carbon regions and GO's specific performance of GO-multiplex qPCR on surface area. real-life samples ○ GO prepared using 2.5 mL H₂O₂ ○ Ct values of RdRP and E upon detection demonstrated significantly reduced cycle of 10 copies/uL RNA were undetectable threshold (Ct) values for RdRP, E, and using GO-multiplex qPCR and >37 using RNase P genes by 1.02, 0.59, and 0.89 Conventional multiplex qPCR, implying the cycles, respectively. Moreover, it also had latter’s failure to detect low viral loads a higher sp² region ratio and a larger specific surface area compared to GO ANALYSIS AND FUNCTIONALIZATION prepared using 10 mL H₂O₂. PRINCIPLES OF THE GO-FORWARD PRIMER ○ GO with 10 mL H₂O₂ showed variable COMPOSITES results, with some gene targets showing The Fluorescence quenching property of GO slight Ct increases (e.g., E gene). was utilized to evaluate its adsorption ○ GO prepared with 2.5 mL H₂O₂ provided efficiency on the forward primer. optimal performance due to its larger Incubation at 50°C maximizes the efficiency surface area and higher sp² region ratio, of GO adsorption to primers. making it the preferred choice for primer ○ The fluorescence quenching efficiency of adsorption and better qPCR efficiency. all three fluorescent reporters below 50°C and at 80°C was 15%, indicating that primers were not readily adsorbed to the GO surface UV absorption peaks of the forward primer, GO, and GO-forward primer composites were ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 5  analyzed to demonstrate forward primer respiratory viruses, expanding the range of coupling with GO. The maximum adsorption pathogens tested would enhance its clinical peaks of GO and GO-forward primers were at applicability and ensure the specificity of the 230 nm and 254 nm, respectively. test. CONCLUSION HIGHER TESTING COMPLEXITY This study successfully developed a Conventional testing using multiplex qPCR is GO-multiplex qPCR method that significantly complex enough and is not yet widely improves the detection sensitivity of applicable to the country. Integrating SARS-CoV-2, particularly for low-viral-load graphene oxide and its components into the samples. PCR may further complicate the process and Incorporating graphene oxide (GO) to form potentially limit its widespread implementation GO-forward primer composites, the method in all clinical laboratories. reduces the limit of detection by 10-fold (to 10 copies/reaction), making it more sensitive CRITIQUE OF STATISTICS than conventional multiplex qPCR. GO enhances the specificity of the assay by ANALYSIS OF REPRODUCIBILITY AND VARIANCE reducing non-specific primer interactions and Further statistical analysis is needed to preventing cross-reactivity with other evaluate the reproducibility and variance of common respiratory viruses. results from the GO-multiplex qPCR method GO-multiplex qPCR demonstrates better compared to conventional multiplex qPCR. amplification efficiency and lower cycle threshold (Ct) values compared to GROUP CONCLUSION conventional methods, making it a promising GO-multiplex qPCR significantly improves the tool for accurate SARS-CoV-2 detection. sensitivity and specificity of SARS-CoV-2 detection. GROUP CRITIQUE ○ 10 copies per reaction, which is 10 times more sensitive than conventional methods Graphene oxide (GO) enhances primer CRITIQUE OF STRENGTHS adsorption and reduces non-specific IMPROVED SPECIFICITY AND SENSITIVITY amplification. The GO-multiplex qPCR reduces the detection ○ Detection of SARS-CoV-2 even in low limit by 10-fold, allowing the detection of very sample concentrations/low viral loads low viral loads, which is crucial for early ○ Avoids cross-reactivity with other diagnosis. Moreover, the use of GO, unlike the commonly known respiratory viruses. conventional multiplex qPCR, helps prevent ○ It can be applied to other diagnostic non-specific primer interactions, leading to assays for earlier detection of pathogens more accurate results without cross-reactivity A significant decrease in Ct values was with other respiratory viruses. observed in 13.44 μg/mL GO concentration with the ideal incubation temperature at 50°C. HIGHER EFFICIENCY RATE GO-multiplex qPCR demonstrated faster APPLICATION TO CURRENT CLINICAL amplification cycles and higher efficiency than PRACTICE conventional multiplex qPCR, contributing to rapid and reliable SARS-CoV-2 detection. EARLIER DETECTION AND DIAGNOSIS The high sensitivity of GO-multiplex qPCR for CRITIQUE OF LIMITATIONS detecting low viral loads makes it especially useful for early SARS-CoV-2 diagnosis and for LIMITED PATHOGEN EVALUATION monitoring patients with mild or minimal Although the study showed no symptoms. cross-reactivity with certain common ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 6  LOWER RATE OF POSSIBLE DISEASE TRANSMISSION REFERENCES Early detection of the disease could lead to Hu, C., Zhang, L., Yang, Z., Song, Z., Zhang, Q., & earlier development of mitigation protocols that could aid in controlling transmission and He, Y. (2021). Graphene oxide-based management of asymptomatic cases. qRT-PCR assay enables the sensitive and ESTABLISH MOLECULAR TECHNIQUES specific detection of miRNAs for the The introduction of GO Multiplex qPCR can screening of ovarian cancer. Analytica help establish molecular techniques as the new standard in detecting diseases and Chimica Acta, 1174, 338715. pathogens. Furthermore, this would also https://doi.org/10.1016/j.aca.2021.338715 require more specialized training and advanced clinical laboratory settings, which Wiersinga, W. J., Rhodes, A., Cheng, A. C., can greatly improve the Philippine standard of clinical testing. Peacock, S. J., & Prescott, H. C. (2020). Pathophysiology, transmission, diagnosis, RECOMMENDATIONS FOR FURTHER STUDIES and treatment of coronavirus disease 2019 Further studies should incorporate statistical (COVID-19): A review. JAMA, 324(8), tests (confidence intervals and hypothesis testing, ANOVA, etc.) to determine whether 782–793. the differences in performance between the https://doi.org/10.1001/jama.2020.12839 GO-multiplex qPCR and conventional multiplex qPCR under different conditions are World Health Organization. (2020). Laboratory statistically significant. testing of 2019 novel coronavirus To improve the statistical significance of the assay, a larger sample size should be included (2019-nCoV) in suspected human cases: to ensure the precision of the results. Further studies should include testing the Interim guidance. GO-multiplex qPCR using real clinical samples https://www.who.int/publications/i/item/lab where the factors, including sample quality, clinical contamination, and differences in viral oratory-testing-of-2019-novel-coronavirus loads, are expected to affect results. -(-2019-ncov)-in-suspected-human-cases The GO-multiplex qPCR should be used to detect pathogens other than SARS-CoV-2 to -interim-guidance-17-january-2020 assess the potential of GO in molecular Zeng, Y., Zhou, L., Yang, Z., Yu, X., Song, Z., & He, diagnostics. GO can be studied for its enhanced ability in Y. (2022). High sensitivity SARS-CoV-2 diagnostic assays other than multiplex qPCR detection using graphene oxide-multiplex and for developing new or improved diagnostic tools. qPCR. Analytica Chimica Acta, 1234, 340533–340533. https://doi.org/10.1016/j.aca.2022.340533 ALQUIROS, AVENIDO, BALINGIT, BARLIS, BLANCO, CABAILO, CADACIO, CARMEN, CORCUERA, DAGA 4GMT BATCH 2025 7  QPCR PRIMER DESIGN REVISITED Stephen Bustina & Jim Huggett results that are more accurate and dependable due to the abundance of pre-made tests currently available. This is due to two main factors. ABSTRACT ○ commercial or assay conditions may not have undergone experimental validation or optimization. Primers are arguably the single most critical components of ○ It cannot be assumed that a primer set will yield any PCR assay, as their properties control the exquisite identical outcomes across varying experimental specificity and sensitivity that make this method uniquely conditions powerful. Consequently, poor design combined with failure - assay performance may fluctuate based on to optimise reaction conditions is likely to result in reduced the extraction methods used for template technical precision and false positive or negative detection purification. of amplification targets. Despite the framework provided by - the reagents used in the PCR reaction the MIQE guidelines and the accessibility of wide-ranging - the thermal cycler used to conduct the support from peer-reviewed publications, books and online assays sources as well as commercial companies, the design of many published assays continues to be less than optimal: ISSUES RELATED TO ASSAY DESIGN primers often lack intended specificity, can form dimers, However, when it comes to designing assays, there are compete with template secondary structures at the primer certain hindrances in developing an appropriate assay binding sites or hybridise only within a narrow temperature because of the following reasons: range. We present an overview of the main steps in the ○ Lack of familiarity with the primer design process primer design workflow, with data that illustrate some of ○ uncertainty regarding the critical parameters the unexpected variability that often occurs when theory is ○ insufficient access to appropriate design tools translated into practice. We also strongly urge researchers ○ time-consuming to report as much information about their assays as possible in their publications. IMPORTANCE OF PRIMERS OBJECTIVES OF THE STUDY This is a peer-reviewed literature study that focuses on The critical variable for primer performance is its annealing the following: temperature (Ta), rather than its melting temperature (Tm) ○ The overview of the main primer-related issues regarding qPCR designing Optimal annealing temperatures (Ta) differ with buffers, ○ The process of the primer design workflow making results from one master mix non-transferable. ○ The main criteria on assay performance. BLAST searches alone don’t ensure primer specificity and ○ Analyze the performance of real-time assay may overlook critical hybridization events. Non-specific amplification can occur at optimal Ta due to INTRODUCTION primer dimers and mismatched pairs. Peer-reviewed literature is replete with studies on Mismatch effects on duplex stability depend on sequence oligonucleotide primer sequences for PCR. The context and are poorly predicted by general methods. efficiencies, stability, and cost of enzymes are increasing. It allows for the relatively easy creation of large amounts PRINCIPAL CONSIDERATIONS FOR ASSAY DESIGN of data as a result. It is imperative to display the genuine A well-designed assay should avoid generating primer results because there are more than 15,000 papers about dimers, achieve close to 100% efficiency, and be highly qPCR. specific. If primers perform well across a wide temperature range, DEVELOPMENT OF NEW PRIMER DESIGN FOR A SPECIFIC the assay is likely to be robust; conversely, if amplification ASSAY occurs only at a narrow temperature range, it may be less Despite being more difficult and time-consuming, creating reliable. an assay specifically for the experiment tends to yield 1  The design process involves a detailed workflow that requires careful consideration of not just the primers but TARGET IDENTIFICATION also the uniqueness, structure, and location of the An appropriate target should be identified for an assay to amplicon. This aims to create an optimal primer/amplicon be useful pairing for precise nucleic acid quantification. Problem encountered: Numerous identical, Reliable qPCR also requires a thorough review of most in closely-related, or significant 1different sequences under silico criteria and diligent validation of all wet lab the same common name parameters. Solutions: 1. Amplification target should be clear 2. Refer to the accession or individual transcript number of any sequence used for assay design PREFIXES NC_ and NG_ Genomic sequences NM_ Curated mRNA sequence WORKFLOW FOR QPCR PRIMER DESIGN NT_ and NW_ Automated genomic XM_ Automated RNA sequences The precision of PCR (Polymerase Chain Reaction) as a diagnostic and forensic tool hinges on absolute certainty regarding the target being amplified.Recent interest in RT-PCR for RNA profiling in forensic samples highlights the necessity for assays to be species-, RNA-, and tissue-specific. CONSIDERATIONS FOR ASSAY DESIGN a. Importance of RNA-targeting in forensic tissue profiling using RT-PCR. b. Significance of primer design in achieving RNA specificity: Importance of exon-intron structure. Risks of DNA contamination due to polymerase activity through introns. ISSUES WITH ASSAY RELIABILITY Problems with exon-specific primers binding to introns. Potential inaccuracies in published primer sequences. Need for careful optimization and validation of assays in clinical settings. ASSAY PROPERTIES: PRIMERS Most qPCR assays ○ 95 deg Celsius - melting temperature ○ 60 deg Celsius - annealing and elongation temperature Since most polymerases work best at 72 deg celsius, it is advised that primers are hybridized at higher temperatures, 63 +/- 2 deg celsius. This speeds up polymerisation time and overall PCR run. PRIMERS prime the specific amplification of a single target in a background or more-or-less related potential alternatives 2  pivotal component of a qPCR assay. It is recommended to use primers that: ○ Hybridize at higher temperature ○ Has lowest Cq ○ Has the least amount ( ideally none) of priner dimers. MAJOR CONSIDERATIONS IN DESIGNING PRIMERS ANNEALING TEMPERATURE Defines the temperature at which the maximum amount of primer is bound to its target Dependence on Master mix used Primer concentrations ○ Symmetric vs asymmetric primers ANNEALING TEMPERATURE There is no one size fits all rule when using a master mix. ○ The effectivity of primers depend on the master mix used An experiment using 7 different mastermix is used on 2 sets of primers through a temperature gradient ○ Primer set A robust temp gradient profile with only one mastermix: Master mix 6 with a higher Cq than the rest ○ Primer set B demonstrates the difference brought by the master mix used Master mix showed the same robustness as the ones at primer set A while 4 appeared to be less robust. PRIMER CONCENTRATION Anealing temperature is a critical variable that determines primer performance In the experiment, the three assays done showed: ○ difference in Cq ○ a single peak on their melt curves showing the same specificity A primer designed in silico does not effectively define its temperature tolerance, efficiency, or specificity ○ it must always be followed by experimental validation and optimisation. MASTER MIX DEPENDENCE 2 primers sets at 2 concentrations are used with 5 different master mixes. ○ Assay A: Master mix B to E recorded higher Cq in higher primer concentration in contrast to Master mix A that has a lower Cq on the higher concentration ○ Assay B: all Master Mixes showed to have lower Cq in higher primer concentration 3  Optimal primer annealing and concentration is SYBR GREEN ASSAY determined by the master mix used Recommended size: 80-150 bp Has greater affinity for A-T rich areas PRIMER SYMMETRICITY Intercalates at low dye:base pair ratios SYMMETRIC PROBE-BASED ASSAY usually used on qPCRs Recommended size: 60-90 bp cause the reannealing of the template strands causes the probe to bind to the template strands which AMPLICON CONSIDERATIONS: SECONDARY sequesters the polymerase STRUCTURES results in exponentially grown double stranded DNA (1). Areas of extensive secondary structure can reduce amplification efficiency ASYMMETRIC Hybridization kinetics will prefer intramolecular binding, can prevent reannealing of template strands obstruct primer binding, and reduce priming efficiency harder to optimize Evaluate with actual reaction conditions (Ta, salt and more difficult to determine the proper primer ratio, magnesium ion concentrations) amount of starting material and the number of amplification cycles MFOLD WEBSITE generates one of the strands by linear ampÍlification and a Known as the simplest way to check fraction of its total product as double-stranded DNA Helps predict nucleic acid folding, hybridization, and limited by the concentration ratio of the primers used (1). melting temperatures Amplicons should always be checked for secondary LATE PCR structure, as areas of extensive secondary structure can uses asymmetrical primers but takes into account the be an important cause of reduced amplification efficiency. effect of the actual primer concentration on primer annealing AMPLICON CONSIDERATIONS: GENERALITIES generates single-stranded products with predictable Things often work out different than theory asserts and in kinetics for many cycles beyond the exponential phase the end, all that matters is how a design work in the this permits the use of low-Tm probes laboratory inherently more allele-discriminating, generate lower If all else fails, as long as the assay is specific, most other background, and can be used at saturating concentrations conditions can be tweaked to achieve a satisfactory without interfering with the efficiency of amplification efficiency For cases of only 85% efficiency, it is acceptable to report ASSAY PROPERTIES: AMPLICONS the results with supporting evidences AMPLICONS ASSAY OPTIMIZATION Piece of DNA or RNA that is known as product and/or Essential for: source of amplification ○ Accurate quantification of small nucleic acid Final product of PCR differences If it is merely 85% efficient, results can already be ○ Sensitive pathogen detection reported together with supplemental evidence in order to ○ Discriminating between polymorphisms or mutations show standard curves, report precision, and limits of quantification and of detection KEY FACTORS FOR OPTIMISATION PCR Protocol: Ensures proper cycling conditions. AMPLICON CONSIDERATIONS: SIZE AND COMPOSITION Reagents: Quality and composition affect results. GC content should be close to 50%, wherein Guanine Instrumentation: Equipment must be reliable and repeats should be avoided accurate. Too long of an amplicon can lead to incomplete Analysis Methodologies: Accurate data interpretation is amplification critical. In order to avoid later cq readings and reduced efficiency, short amplicons should be prevented to differentiate UNDERSTANDING SENSITIVITY amplicon and primer dimer Not tied to a specific Cq value; it reflects the assay's Example: ability to detect low copy number targets. ○ A: 149 bp A well-optimized qPCR can amplify even single DNA ○ B: 121 bp molecules, ensuring high efficiency and precision. ○ C: 76 bp B has the best Cq value QUANTIFICATION BY QPCR 4  assumes a linear relationship between the logarithm of the initial template quantity and the Cq value obtained WIDE DYNAMIC RANGE during amplification. Wide dynamic range of a well-designed assay is one of This permits calculations of an assay’s amplification the key features of qPCR assays efficiency and delineating its limits of detection and quantification. HIGH PRECISION BETWEEN EXPERIMENTAL EXPERIMENTS & CONSISTENCY ACROSS REPLICATE HALLMARKS OF AN OPTIMIZED QPCR EXPERIMENTS different laboratories should obtain similar results when High amplification efficiency (95–105%) using the same master mix to detect the same gene, Linear standard curve (R2 > 0.980) even if they amplify different regions. High precision between experimental experiments ○ Example Consistency across replicate experiments No primer dimers Wide dynamic range HIGH AMPLIFICATION EFFICIENCY (95–105%) Generating a standard curve using serial dilutions of a template and determining the slope from the linear regression of a plot of Cq (y-axis) vs log [quantity]. ○ Example: 10-fold dilution: Cq values should increase by about 3.32 cycles for every 10-fold decrease in DNA. This means if the assay has a slope of -3.32, it shows that it is 100% efficient. An acceptable evaluation of PCR efficiency requires a minimum of three replicates and four, ideally five, orders A. Exon/intron structure of the gene, with assay 1 (HIF-AF: of magnitude of template concentration CCGAGGAAGAACTATGAA and HIF-AR:TGGTTACTGTTGGTATCA) A PCR reaction with lower efficiency will have lower amplifying sequences in exons 5 and 6 and assay 2 (HIF-BF: sensitivity AAGAACTTTTAGGCCGCTCA and HIF-BR:TGTCCTGTGGTGACTTGTCC) amplifying sequences in LINEAR STANDARD CURVE (R2 > 0.980) exons 7 and 8 R2 value B. There are no secondary structures issues at the primer ○ Square correlation between the response values and binding sites. the predicted response values C. Both assays are robust, with the 55°–65° gradient recording ○ Measures how successful a fit is in explaining the similar qs of 24.68 ± 0.07 and 24.32 ± 0.12, respectively. Melt variation of the data curve analysis shows a single peak. ○ Plot Cq values (y-axis) against logarithmic values of D. Standard curves are comparable, showing linearity at least known concentrations of the target DNA (x-axis) over five orders of magnitude. NO PRIMER DIMERS Essential for achieving high amplification efficiency. Ensures reliable Cq (Cycle Quantification) values. CONCLUSION A well-informed and reliable assay design is fundamental to any study aiming at quantifying nucleic acids. Good primers are necessary for dependable qPCR. This typically refers to ○ Ranges from 0 to 1, with values closer to 1 showing temperature tolerance, complete specificity, and the lack of a strong correlation. hairpin structures or cross-dimerization potential. High-quality Example: primers are necessary for reliable qPCR. While commercially R² of 0.998 = model explains 99.8% of the available assays are available, developing custom assays that variation in the data (relationship between the are suited to particular research goals is frequently a more Cq value and the amount of target DNA). beneficial long-term approach.Additionally, by doing their 5 own validation and optimization studies, researchers can determine an assay's efficacy on their own. As researchers, we think that any assay development process must include validation. The application and validation reports need to be included in the study. In this way, these customized assays might serve as a basis for primer creation in subsequent research. Furthermore, looking at things more broadly, the synthesis of the resources that are already available can spur the development of novel test methods that are both widely usable and easily accessed across a wide range of research applications. Additional resource material: qPCR (real-time PCR) protocol explained 6  SEQUENTIAL SEQUENCING BY SYNTHESIS AND THE NEXT-GENERATION SEQUENCING REVOLUTION Mathias Uhlen and Stephen R. Quake OUTLINE INTRODUCTION INTRODUCTION ABSTRACT The impact of next-generation sequencing (NGS) cannot be HIGHLIGHTS overestimated. The technology has transformed the field of life science, contributing to a dramatic expansion in our THE CONCEPT OF SEQUENCING BY SYNTHESIS (SBS) understanding of human health and disease and our NEXT-GENERATION SEQUENCING (NGS) REVOLUTION understanding of biology and ecology. The vast majority of the SEQUENCING BY SYNTHESIS (SBS) CONCEPT major NGS systems today are based on the concept of HISTORICAL DEVELOPMENT ‘sequencing by synthesis’ (SBS) with sequential detection of KEY TECHNOLOGICAL ADVANCEMENTS nucleotide incorporation using an engineered DNA polymerase. MAJOR NGS PLATFORMS SIGNIFICANT PROJECTS ENABLED BY NGS Based on this strategy, various alternative platforms have been developed, including the use of either native nucleotides or THE CONCEPT OF MASSIVELY PARALLEL SEQUENCING (MPS) reversible terminators and different strategies for the FIRST NEXT-GENERATION SEQUENCES attachment of DNA to a solid support. In this review, some of the THE CONCEPT OF MASSIVELY PARALLEL SEQUENCING key concepts leading to this remarkable development are (MPS) discussed. IMPORTANT APPLICATIONS THE DEVELOPMENT OF FLUORESCENCE CHEMISTRIES ABSTRACT INTRODUCTION OF MASSIVELY PARALLEL SEQUENCING KEY DEVELOPMENT OF MASSIVELY PARALLEL NGS and SBS have revolutionized DNA sequencing with SEQUENCING high-throughput, massively parallel analysis. SOLEXA AND HELICOS BIOSCIENCES SBS uses engineered polymerases for stepwise nucleotide incorporation. AMPLIFIED DNA ON SOLID SUPPORT Innovations like reversible fluorescent terminators have refined SOLID PHASE SEQUENCING this technique. EMULSION PCR Cost of sequencing was reduced from billions to under $1000 BRIDGE PCR per genome. Applications include population genetics, cancer research, and ALTERNATIVE SYSTEMS FOR MPS ancient DNA studies. MPS WITHOUT SBS Significant contributions to microbial ecology and rare disease diagnostics. APPLICATIONS OF MASSIVELY PARALLEL SEQUENCING (MPS) Fuels an era of big data in biology and data-driven research. WHOLE GENOME SEQUENCING Expected to play a pivotal role in personalized medicine and REFERENCE-BASED SEQUENCING multi omics research. BARCODE SEQUENCING CONCLUDING REMARKS AND FUTURE PERSPECTIVE HIGHLIGHTS IMPACT OF SBS IN LIFE SCIENCES EXPANSION OF UNDERSTANDING Next-generation sequencing (NGS) involving massively parallel DATA DRIVEN ERA DNA analysis has made an enormous impact on life science, MAJOR PROJECTS medicine, and biotechnology, through a multitude of OPEN ACCESS DATA applications. EXPONENTIAL GROWTH OF SEQUENCING DATA The vast majority of the major NGS systems are based on the PERSONALIZED MEDICINE concept of ‘sequencing by synthesis’ (SBS) with sequential MULTIOMICS INTEGRATION detection of nucleotide incorporation using an engineered DNA ADVANCEMENTS IN BLOOD PROFILING polymerase. TECHNICAL IMPROVEMENTS The basic principles of SBS include attachment of DNA HOLISTIC UNDERSTANDING fragments to a solid support, conversion to a single-strand REVOLUTIONARY TRANSFORMATION template and the annealing of a primer, the incorporation of GROUP 3 - 4GMT | MANALO. MENDOZA. NAVAL. NEPOMUCENO. ONA. PALAD. PANGANIBAN. PATAYAN. PENUS. PEREZ.  complementary nucleotides by a polymerase, and detection of 1993: SBS’s Concept was introduced (Nyren et al.) this incorporation. 1998: Solution-based Pyrosequencing (Ronaghi, Uhlén, and The development of NGS spans several decades of innovations, Nyrén) from early systems using natural nucleotides to later systems 2000: First commercial SBS instrument (Pyrosequencing) for massively parallel sequencing systems using reversible 2005: Massively Parallel Sequencing (MPS) concept (454 Life fluorescent nucleotides. Sciences) 2006: Reversible terminators introduced (Solexa/Illumina) IMPACT OF NGS KEY TECHNOLOGICAL ADVANCEMENTS Fluorescence chemistries and reversible terminators DNA amplification strategies: MPS technology significantly impacts life science research, with a. Solid-phase sequencing daily studies published and the number of DNA sequences in b. Emulsion PCR public databases increasing since its commercial introduction in c. Bridge-PCR 2005. Single-molecule sequencing The cost of sequencing the human genome has significantly decreased using the MPS technology. The first human genome, estimated at $2-3 billion, was published in 2001, but today, MAJOR NGS PLATFORMS sequencing a human genome with MPS costs less than $1000, 454 Pyrosequencing (2005) representing a cost reduction exceeding one millionfold. Solexa/Illumina (2006) Helicos (single-molecule sequencing) NGS also enabled the discovery of a new human ancestor called PacBio (long-read sequencing) the Denisovans, with population studies revealing widespread Ion Torrent DNA remains of both Neanderthal and Denisovan DNA in our BGI/MGI genomes. It enabled cancer diagnosis and treatment, as well as diagnosis of children with unknown disease-causing mutations, leading to SIGNIFICANT PROJECTS ENABLED BY NGS Neanderthal genome sequencing the design of drug treatments. 1000 Genomes Project The Cancer Genome Atlas THE CONCEPT OF SEQUENCING BY SYNTHESIS (SBS) Human Cell Atlas 100,000 Genomes Project (rare disease) NEXT-GENERATION SEQUENCING (NGS) REVOLUTION Transformed life science research Dramatically expanded understanding of human health, disease, THE CONCEPT OF MASSIVELY PARALLEL SEQUENCING (MPS) biology, and ecology Enabled cost-effective whole genome sequencing (from $2-3 FIRST NEXT-GENERATION SEQUENCERS billion to