Molecular Detection of Metallo-Beta-Lactamase and Alginate in Multidrug Resistance Pseudomonas aeruginosa (PDF)

JOURNAL of MEDICINE and LIFE JML | ORIGINAL ARTICLE Molecular detection of Metallo-Beta-Lactamase and alginate in multidrug resistance Pseudomonas aeruginosa isolated from the clinical specimen Govend Musa Qader 1, Khanzad Khudhur Jarjees 2 *, Rozhhalat Khudhur Jarjees 3 Author Affiliations 1. De...

JOURNAL of MEDICINE and LIFE JML | ORIGINAL ARTICLE Molecular detection of Metallo-Beta-Lactamase and alginate in multidrug resistance Pseudomonas aeruginosa isolated from the clinical specimen Govend Musa Qader 1, Khanzad Khudhur Jarjees 2 *, Rozhhalat Khudhur Jarjees 3 Author Affiliations 1. Department of Biology, College of Science, University of Salahaddin-Erbil, Kurdistan Region, Iraq 2. Department of Food Technology, College of Agricultural Engineering Sciences, University of Salahaddin-Erbil, Kurdistan Region, Iraq 3. Department of Pharmacy, Erbil Medical Technical Institute, Erbil Polytechnic University, Erbil, Kurdistan Region, Iraq * Corresponding Author: DOI Khanzad Khudhur Jarjees, 10.25122/jml-2021-0196 Department of Food Technology, College of Agriculture, University of Salahaddin, Dates Erbil, Iraq. Received: 18 June 2022 E-mail: [email protected] Accepted: 8 August 2022 ABSTRACT Pseudomonas aeruginosa pathogen is opportunistic. Several virulence factors and biofilms can cause its pathogenici- ty. Furthermore, infections triggered via multidrug-resistant P. aeruginosa among hospitalized patients are a public health concern. The primary antimicrobial agents in treating Gram-negative infection include Meropenem and Imipenem. Moreover, the spread of Carbapenem-resistant P. aeruginosa is a focal concern worldwide. The present research aims to determine the spread of Carbapenem-resistant P. aeruginosa, and the distribution of the Alginate and Metallo-beta-lactamase encoding gene in clinical isolates. In the present cross-sectional descriptive research, 50 wound and sputum clinical specimens were obtained. Isolates were all identified by applying cultural character- istics and biochemical tests. The Polymerase Chain Reaction (PCR) was conducted to distinguish algD, BLA-VIM, BLA-IMP, and 16SrRNA genes. Moreover, the phenotypic method was used to detect hemolysin. The disk diffusion technique was applied to screen clinical isolates for eight antimicrobial agents. The PCR results showed all isolates to be positive for algD and negative for BLA-VIM and BLA-IMP genes. Hemolysin and multidrug resistance prevalence was 100% and 76%, respectively. Furthermore, Meropenem proved to be the most efficient antibiotic against clini- cal isolates. Alginate and hemolysin are considered significant virulence factors for P. aeruginosa, playing a key role in triggering diseases and tissue or skin lesions. The emergence of Multidrug Resistant (MDR) isolates indicates that developing antibiotic stewardship in our regional community hospital is a top priority. Infection control measures could help control the distribution of virulence genes in P. aeruginosa isolates. Moreover, regular observation is needed to decrease public health threats, distributing virulence factors and Imipenem-resistance patterns in clinical isolates of P. aeruginosa. KEYWORDS: Alginate, Pseudomonas aeruginosa, Hemolysin, Metallo-beta-lactamase, Imipenem resistance isolates. ABBREVIATIONS: AMK – Amikacin; CAZ – Ceftazidime; CIP – Ciprofloxacin; CLSI – Clinical and Laboratory Standards Institute; ESBL – Extended Spectrum Beta-Lactamase; GEN – Gentamicin; IPM – Imipenem; LPS – Lipopolysaccharide; MBLs – Metallo-β-lactamases; MDR – Multidrug Resistant; PCR – Polymerase Chain Reaction; PIP – Piperacillin; RND – Resistance-Nodulation-Division; TSB – Tryptic Soy Broth; TTSS – Type III Secretion System. INTRODUCTION pyoverdin, pyocyanin, and alginate leads to the development of P. aeruginosa pathogenicity [2–5]. Mucoid strains may yield bio- P. aeruginosa forms several secreted and cell-related virulence films, representing communities of attached microorganisms on factors with a role in infection pathogenesis. Forming intrac- a surface. Biofilms have a crucial part in infectious diseases. Fur- table biofilm and secreting myriads of virulent factors such as ther, they have a favorable antibiotic resistance, with their matrix Type III secretion (TTSS) effectors, LasB elastase, LasA protease, playing a major role [6–8]. © 2022 JOURNAL of MEDICINE and LIFE. VOL: 15 ISSUE: 9 SEPTEMBER 2022 1105  JOURNAL of MEDICINE and LIFE Producing mucoid colonies using P. aeruginosa strains with Antimicrobial susceptibility testing alginate defends the organism against antimicrobials and the host's immune system response; thus, it facilitates the pulmonary Based on the Clinical and Laboratory Standards Institute system's chronic inflammation. Alginates, like lipopolysaccha- (CLSI) guideline , antimicrobial susceptibility was defined ride (LPS), act in the adherence of the bacterium to the respi- on Mueller-Hinton agar via the Kirby Bauer disk diffusion assay. ratory epithelium. They also operate as a barrier to certain The susceptibility profiles were determined for eight antibiotics, antibiotics. In other words, alginate formation reduces aminogly- namely Piperacillin/Tazobactam (100/10 μg), Piperacillin (PIP, cosides' absorption and early bacterial effect. Moreover, alginate 100 μg), Gentamicin (GEN, 10 μg), Ceftazidime (CAZ, 30 μg), hinders the diffusion of positively charged hydrophilic medicines Imipenem (IPM, 10 μg), Amikacin (AMK, 30 μg), Ciprofloxacin [7, 10]. The expression of the algD gene is influenced by environ- (CIP, 5 μg), and Meropenem (10 μg). mental factors, including nitrogen/carbon/phosphate limitation, In each antimicrobial susceptibility assay, P. aeruginosa ATCC slow growth rate, and oxygen concentration [11, 12]. 27835 was applied as quality control. Based on the CLSI criteria Alginate, structurally, is a simple linear polysaccharide; it and the manufacturer's protocols, the results were considered re- has a high molecular weight, and it contains two uronic acids: sistant or susceptible. β-D-mannuronic acid and its C5 epimer, α-Lguluronic acid. It is a capsule-like exopolysaccharide in P. aeruginosa and loosely ad- Hemolysin detection heres to P. aeruginosa cells, thus being found in the culture super- natant. Bacterial isolated colonies were all plated (Sheep blood agar In P. aeruginosa, antibiotic resistance involves several processes, 5%) at 37℃ for 24h to detect hemolysins. The lysis of red blood such as overexpressing active efflux systems, producing modifying cells (clear zone) was produced close to the cultured colonies fol- enzymes, and reducing external membrane permeability. lowing incubation, indicating positivity for hemolysins. P. aeruginosa infections grow intrinsically and could display attained resistance to various routinely prescribed antimicrobial Bacterial genomic DNA extraction medications. Furthermore, they are usually difficult to be treat- ed owing to the advent of multidrug-resistant P. aeruginosa iso- In Tryptic Soy Broth (Merck, Germany), bacterial strains lates. Many studies have used the term multidrug-resistant were sub-cultured, then incubated at 37℃ for 48 h. Following the P. aeruginosa to describe isolates resistant to at least three types manufacturer's instructions, the DNA extraction kit (Geneaid/ of antimicrobial drugs, most commonly carbapenems, amino- Korea) was used to extract the DNA from P. aeruginosa colonies. glycosides, antipse1udomonal penicillins, cephalosporins, and The extracted DNA was then subjected to PCR reactions, target- quinolones. ing BLA-VIM, BLA-IMP, and algD genes. The primary antimicrobial agents to treat P. aeruginosa in- fections are carbapenems, such as Imipenem, doripenem, and Molecular analysis of BLA-VIM, BLA-IMP, and Meropenem. Such antibiotics are grouped as β-lactam an- algD by polymerase chain reaction (PCR) tibiotics. Carbapenems have a broad spectrum of activity as a major drug to treat P. aeruginosa infections. However, carbapenem Table 1 shows how primer sequences and amplification pro- hydrolyzing enzymes, including MBLs, can effectively hydrolyze tocols work [27, 28]. Then to identify BLA-VIM and BLA-IMP, all beta-lactam antibiotics, except for monobactams. Multiplex PCR was used as a method to amplify specific gene tar- Mechanisms of carbapenem resistance occur for several rea- get sequences in a thermocycler (Techne/UK). The master mix sons, including reduced outer membrane permeability, decreased preparation was executed in a total volume of 25 µl (12.5 µl Gotaq expression or defect in outer membrane porines including OprD, Green Master Mix (Promega/USA), 3 µl of genomic DNA, 1 µl presence of chromosomal AmpC beta-lactamase gene, produc- for each BLA-IMP and BLA-VIM primer, and 5.5 µl nuclease-free tion of beta-lactamase enzymes, and increase in the activity of water). For BLA-VIM and BLA-IMP amplification reactions, the pump efflux systems [19–21]. Therefore, the present descriptive mixtures were heated for 4 min at 95℃ before thermocycling, research is performed to assess the profiles of antibiotic resistance DNA denaturation for 30 sec at 94℃, primer annelation for 1 min and the prevalence of BLA-VIM and BLA-IMP genes in imipe- at 60℃, and extensions for 1 min at 72℃. In the next step, the nem-resistant P. aeruginosa, as well as detecting hemolysin factor mixtures were kept at 72℃ for 6 min after finishing 30 cycles. and alginate encoding genes from clinical isolates. For algD identification gene, all strains were checked by Uniplex PCR. The PCR premix for the algD gene was in a total volume of 25 μl, 12.5 μl (Gotaq Green Master Mix (Promega/ MATERIAL AND METHODS USA), 3 μl genomic DNA, 1.5 μl for each primer, and 6.5 μl nuclease-free water). The PCR was performed as initial dena- P. aeruginosa Isolation and identification turation for 5 min at 94℃. Next, the 35-cycle amplification for 35 secs at 94℃ was executed followed by an annellation for 1 min Fifty P. aeruginosa isolates were obtained from sputum and at 61℃, an extension at 72℃ for 1 min, and, lastly, another ex- wound samples of admitted patients in the Teaching Rizgari tension for 10 min at 72℃ (Table 1). Hospital between January and April 2019. Isolates were iden- The PCR product amplicons were finally analyzed using tified based on the standard bacteriological approaches, such agarose gel electrophoresis (2%), and the DNA was stained with as colony morphology, pyocyanin pigment production, Gram Safe dye (Bioland/USA). In addition, the presence and absence staining, growth at 44℃, and biochemical tests. Moreover, of the virulence and antibiotic-resistant genes were determined the identification was confirmed by 16S rRNA. In addi- using a UV transilluminator (Syngene/UK). Also, the PCR tion, some bacteria isolates were stored at -70℃ in a microtube product band for BLA-VIM, BLA-IMP, and algD genes was iden- containing tryptic soy broth (TSB) and 20% glycerol for further tified on the gel compared to the standard DNA ladder/1kb studies. (Norgenbiotek/Canada). © 2022 JOURNAL of MEDICINE and LIFE. VOL: 15 ISSUE: 9 SEPTEMBER 2022 1106  JOURNAL of MEDICINE and LIFE Table 1. The oligonucleotide sequences for the antibiotic-resistant and virulence genes. Target gene Primer sequences (5' – 3') PCR product size Reference BLA-IMP F 5'GGCATAGAGTGGCTTAATTCTC3' 250 bp BLA-IMP R 5'GGCCAAGCTTCTATATTTGC3' Saberi et al., 2017 BLA-VIM F 5'CAAATTGGACTTCCTGTAACG3' 273 bp BLA-VIM R 5'TATAGAGGTGGGCCATTCAG3' algD F 5'ATG CGA ATC AGC ATC TTT GGT3' 1310 bp Benie et al., 2017 algD R 5'CTA CCA GCA GAT GCC CTC GGC3' RESULTS DISCUSSION In the present cross-sectional descriptive research, 45 bacteri- The frequency of the algD gene was 100%. This finding was al isolates from wound infections and 5 strain isolates from sputum in line with earlier studies, indicating that the gene exists in about samples were collected. The clinical specimens were then inocu- all specimens. lated into the routine and selective culture media for P. aeruginosa The researchers [30–32] reported 98%, 95.24%, and (Figure 1). Biochemical tests were performed to identify the colo- 92.3% isolates to be positive for the algD gene, respectively. nies, which was confirmed by 16SrRNA. Many hypotheses have attempted to clarify biofilm resistance The PCR results revealed that all bacterial isolates carried (poor antibiotic penetration, nutrient limitation, high cell densi- the alg D gene, and none was positive for BLA-VIM and BLA-IMP ty, slow growth, adaptive stress response); however, no data ex- genes (Figure 2). ist explaining this phenomenon to date. Fazlul has reported All isolates appeared to be resistant to Piperacillin, Ceftazidime, 48.33% and 7.5% of P. aeruginosa isolates to produce Hemolysin and Piperacillin/Tazobactam in the current research. In contrast, and Metallo beta-lactamase. the resistance to Imipenem, Meropenem, Amikacin, Gentamicin, VIM and BLA-IMP genes were not detected; this finding Tobramycin, and Ciprofloxacin, respectively were 5%, 5%, was in line with that of ALjaafreha. Further, Shahi has reported 9%, 15%, 15%, and 9%. In contrast, intermediate resistance to none of the isolates to be BLA-VIM genes positive. According Imipenem and Gentamicin was 16% and 3%. In addition, 76% of to previous and current studies, the differences observed in the the isolates were multidrug-resistant. incidence of BLA-VIM and BLA-IMP genes can be explained by Figure 1. Clear beta-type hemolysis around the P. aeruginosa colonies on blood agar media. © 2022 JOURNAL of MEDICINE and LIFE. VOL: 15 ISSUE: 9 SEPTEMBER 2022 1107  JOURNAL of MEDICINE and LIFE Figure 2. Electrophoresis of the amplicon products for the virulence gene in P. aeruginosa; Lane: 1 ladder of 1kb, Lane 2-10: algD (1310 bp) gene. the use of Imipenem and improper application of antibiotics in CONCLUSIONS different regions [29, 34]. In Pseudomonas aeruginosa, mechanisms such as OprD, AmpC, In this study, the increase and spread of potentially very and MexAB, as non-carbapenemase resistance mechanisms, may pathogenic and Carbapenem-resistant strains incorporated with develop carbapenem resistance [35–38]. Pump efflux systems multidrug-resistant patterns are concerned since a probable re- play an important role in the antibiotic resistance of Pseudomonas sult would have increased clinical severity and would be accom- aeruginosa isolates to various antibiotics. Pseudomonas aeruginosa has the panied by significant restrictions in antibiotic therapy. Imipenem potential to express 12 types of multidrug efflux pumps called Mex. resistance isolates comprise virulence factors, including hemoly- Mex efflux systems belong to the Resistance-Nodulation-Division sin and alginate, responsible for serious infections. (RND) family. MexAB-OprM is the only secretory pump found in all Pseudomonas aeruginosa isolates and causes the inherent resistance of these bacteria to antibiotics. Ertapenem, Meropenem and ACKNOWLEDGEMENTS Doripenem are substrates of the MexAB-OprM efflux system. Therefore, increasing the expression of MexAB-OprM pump Conflicts of interest efflux system plays an important role in the antibiotic resistance The authors declare no conflict of interest. of Pseudomonas aeruginosa isolates to beta-lactam antibiotics, espe- cially carbapenems [39, 40]. Another resistance mechanism in Ethics approval Pseudomonas aeruginosa is AmpC cephalosporins, a chromosomally The study protocol was approved by the Ethics Committee encoded enzyme whose basic expression is resistance to beta-lact- for Human Research at Salahaddin University (HREC-SUE), ams except for cefpime, ceftazidime and carbapenems. Therefore, College of Science (approval No: 4S/87, 2022). meropenem and imipenem resistant profiles can be created due to increased expression of MexAB-OprM flow pump genes, de- Authorship creased expression or purine expression of OprD, and overexpres- KKJ contributed to conceptualizing, the methodology, sion of AmpC carbapenemase, respectively. In this regard, some writing the original draft and data analysis. GMQ contributed authors have suggested the possibility of inferring the mechanism to conceptualizing, methodology and writing the original draft. of resistance from the antibiogram [41–43]. RKJ contributed to data collection, data curation and editing With the spread of ESBL-producing gram-negative bacteria the manuscript. KKJ, GMQ AND RKJ contributed to data col- and carbapenemase-producing organisms that cause infection in lection and curation. GMQ and KKJ contributed to editing the patients in intensive care units, the use of carbapenems seems manuscript. necessary. All isolates in the current research were resistant to Tazobactam/Piperacillin. Metallo beta-lactamase P. aeruginosa REFERENCES were resistant to different antimicrobial agents, except for Tazobactam/Piperacillin. The multidrug-resistant phenotype is 1. May TB, Shinabarger D, Maharaj R, Kato J et al. "Identification of residues anticipated in Metallo beta-lactamase producers since they hy- in the Pseudomonas aeruginosa elastase propeptide required for chaperone and drolyze all beta-lactams, apart from aztreonam, and are related secretion activities", Microbiology, 2004; 150(12) 3969–3977. https://doi. to gene cassettes, protecting various resistance genes. org/10.1099/mic.0.27340-0 2. Kessler E, Safrin M, Abrams WR, Rosenbloom, J, and Ohman DE. To identify regulatory genes and structural changes in "Inhibitors and specificity of Pseudomonas aeruginosa LasA", The Journal of Carbapenem-resistant encoded proteins, further studies should Biological Chemistry. 1997 272, (15): 9884–9889. https://doi.org/10.1128/ be performed in addition to studies in the field of identification IAI.73.3.1695-1705.2005 and expression of genes of this resistance. Extensive studies 3. Lee VT, Smith RS, Tummler B, and Lory S. "Activities of Pseudomonas aeruginosa effectors secreted by the type III secretion system in vitro and during should also be performed to further identify the causes of the infection", Infection and Immunity, 2005; 73(3): 1695–1705. https://doi. regular occurrence of virulence-related genes in MDR isolates. org/10.1074/jbc.272.15.9884 © 2022 JOURNAL of MEDICINE and LIFE. VOL: 15 ISSUE: 9 SEPTEMBER 2022 1108  JOURNAL of MEDICINE and LIFE 4. Hauser AR. "The type III secretion system of Pseudomonas aeruginosa: infection 27. Saberi M, Zamani H, Salehzadeh A. Prevalence of IMP and VIM Metallo- by injection," Nature Reviews Microbiology, 2009; 7(9) 654–665. https://doi. Beta-Lactamase in Pseudomonas aeruginosa Isolated from Clinical and org/10.1038/nrmicro2199 Environment Specimens in Intensive Care Units (ICU) of Rasht Hospitals, 5. Jarjees KK. Molecular detection of type III secretory toxins in Pseudomonas Iran. J Med Microbial Infec Dis. 2017; 3(3-4): 62-66. aeruginosa isolates. Cellular and Molecular Biology. 2020; 66; (5): 9-14. 28. Benie, CKD., Dadie A, Guessennd N, Kouame ND et al. Molecular https://doi.org/10.14715/cmb/2020.66.5.2 identification and virulence factors of Pseudomonas aeruginosa strains isolated 6. O'Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial from animal products. Journal of Bacteriology and Mycology. 2017; 4 (3): development. Annu Rev Microbiol. 2000; 45:49-79. 91-95. https://doi.org/ 10.15406/jbmoa.2017.04.00094 7. Høiby N, Johansen HK, Moser C, Song ZJ et al. Pseudomonas aeruginosa and 29. ALjaafreha, LY. Tawalbeh M.and Shehabi AA. (2020). Otitis External the biofilm mode of growth. Microb Infect. 2001; 3:1–13. https://doi. Infections Among Jordanian Patients with Emphasis on Pathogenic org/10.1016/S1286-4579(00)01349-6 Characteristics of Pseudomonas aeruginosa Isolates. The Open Microbiology 8. Prasanna SS, Doble M. Medical biofilms–Its formationand prevention using Journal, 2019, 13: 292-296. https://doi.org/ 10.2174/1874285801913010292 organic molecules. J Indian Inst Sci 2008; 88:27-35. 30. Heba Y. Obeidat, DN. Abu-Qatouseh LF, Asem A, Shehabi AA. Antimicrobial 9. Fadhil L, Al-Marzoqi AH, Zahraa MA, Shalan AA. Molecular and resistance and putative virulence genes of Pseudomonas aeruginosa isolates from phenotypic study of virulence genes in a pathogenic strain of Pseudomonas patients with respiratory tract infection. GERMS 2018; 8(1): 32. https://doi. aeruginosa isolated from various clinical origins by PCR: profiles of genes and org/ 10.18683/germs.2018.1130 toxins. Res J Pharm, Biol Chem Sci. 2016; 7: 590–598. 31. Jahromi, SIP, Mardaneh J, Sharifi IA, Pezeshkpour V et al. Occurrence of 10. Mohktari1 K, Amini K. (2020). Molecular Identification of Virulence Genes a Multidrug Resistant Pseudomonas aeruginosa Strains in Hospitalized Patients in Pseudomonas aeruginosa Isolated from Human and Animal Samples and Their in Southwest of Iran: Characterization of Resistance Trends and Virulence Antibiotic Resistance Pattern. Iranian Journal of Medical Microbiology. Determinants. Jundishapur J Microbiol. 2018; 11(4): 57341. https://doi.org/ 2020; 13 (03): 294-297. https://doi.org/ 10.30699/ijmm.13.4.294 10.5812/jjm.57341 11. Bayer AS, Eftekhar F, Tu J, Nast CC and Speert DP. Oxygen-dependent up- 32. Georgescu M, Gheorghe I, Curutiu C, Lazar V et al. Virulence and resistance regulation of mucoid exopolysaccharide (alginate) production in Pseudomonas features of Pseudomonas aeruginosa strains isolated from chronic leg ulcers. aeruginosa. Infect. Immun. 1990, 58, 1344–1349. https://doi.org/10.1128/ BMC Infectious Diseases 2016; 16(1):92. https://doi.org/10.1186/s12879- iai.58.5.1344-1349.1990 016-1396-3 12. Tang HB, DiMango E, Bryan R, Gambello M, Iglewski BH, et al. 33. Stewart PC. Mechanisms of antibiotic resistance in bacterial biofilms. Int. Environmental conditions which influence mucoid conversion in Pseudomonas J. Med. Microbiol. 2002; 292 (2): 107-113. https://doi.org/10.1078/1438- aeruginosa PAO1. Infect. Immun. 1991; 59: 471–477. https://doi. 4221-00196 org/10.1128/iai.59.2.471-477.1991 34. Shahi FA, Hashemi Kh, Abdolmaleki Z, Shahi Sh et al. Antibacterial effects 13. Sumita J, Ohman ED. Role of an alginate lyase for alginate transport in of Quercus Brantii fruits and Stachys lavandulifolia methanol extracts on mucoid Pseudomonas aeruginosa. Infect Immun 2005; 73: 6429– 36. https://doi. imipenemase-type metallo-beta lactamase-producing Pseudomonas aeruginosa. org/10.1128/IAI.73.10.6429-6436.2005 Research Journal of Pharmacognosy (RJP) 2017; 4(3): 59-66. 14. Strateva T and Yordanov D. Pseudomonas aeruginosa – a phenomenon of 35. Santella G, Pollini S, Docquier JD, Almuzara M et al. Carbapenem resistance bacterial resistance. Journal of Medical Microbiology. 2009; 58: 1133–1148. in Pseudomonas aeruginosa isolates: an example of interaction between different https://doi.org/10.1099/jmm.0.009142-0 mechanisms. Rev Panam Salud Publica. 2011; 30(6): 545-8. https://doi.org/ 15. Al-Charrakh AH, Al-Awadi SJ, Mohammed AS. Detection of metallo-β- 10.1590/s1020-49892011001200008 lactamase producing Pseudomonas aeruginosa isolated from public and private 36. Vanegas JM, Cienfuegos AV, Ocampo AM, López L et al. Similar frequencies hospitals in Baghdad, Iraq. Acta Med Iran. 2016; 54(2):107-13. of Pseudomonas aeruginosa isolates producing KPC and VIM carbapenemases in 16. Falagas ME, Koletsi PK, Bliziotis IA. The diversity of definitions of multidrug- diverse genetic clones at tertiary-care hospitals in Medellín, Colombia. J Clin resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Microbiol. 2014; 52(11): 3978-86. https://doi.org/10.1128/JCM.01879-14 Pseudomonas aeruginosa. J Med Microbiol. 2006; 55 (12):1619–29. https://doi. 37. Akhi MT, Khalili Y, Ghotaslou R, Yousefi S et al. Evaluation of carbapenem org/10.1099/jmm.0.46747-0 resistance mechanisms and its association with Pseudomonas aeruginosa 17. Poole K. Pseudomonas aeruginosa: resistance to the max. Front Microbiol. 2011; Infections in the Northwest of Iran. Microb Drug Resist. 2017. https://doi. 2(65). https://doi.org/10.3389/fmicb.2011.00065 org/10.1089/mdr.2016.0310 18. Cornaglia G, Giamarellou H, Rossolini GM. Metallo-beta-lactamases: a last 38. Maryam, M. Haghkhah, M. Antimicrobial Resistance Profiles and Virulence frontier for beta-lactams? Lancet Infect Dis. 2011; 11(5): 381-393. https:// Genes of Pseudomonas aeruginosa Isolates Originated from Hospitalized Patients doi.org/10.1016/S1473-3099(11)70056-1 in Shiraz, Iran. Med Microbiol Infect Dis. 2018, 6 (2-3): 72-76. https://doi. 19. Meletis G, Exindari M, Vavatsi N, Sofianou D, Diza E. Mechanisms org/ 10.29252/JoMMID.6.2.3.72 responsible for the emergence of carbapenem resistance in Pseudomonas 39. 39. Tomás M, Doumith M, Warner M, Turton JF et al. Efflux pumps, OprD aeruginosa. Hippokratia. 2012; 16 (4): 303-7. PMC3738602. porin, AmpC beta-lactamase, and multiresistance in Pseudomonas aeruginosa 20. Safaei HG, Moghim Isfahani BH, Fazeli H et al. Distribution of the Strains isolates from cystic fibrosis patients. Antimicrob Agents Chemother. 2010; of Multidrug-resistant, Extensively Drug-resistant, and Pandrug-resistant 54(5): 2219-24. https://doi.org/10.1128/AAC.00816-09 Pseudomonas aeruginosa Isolates from Burn Patients. Adv Biomed Res 2017; 40. Aghazadeh M, Hojabri Z, Mahdian R, Nahaei MR, Rahmati M, et al. Role of 6:74. https://doi.org/ 10.4103/abr.abr_239_16 efflux pumps: MexAB-OprM and MexXY(-OprA), AmpC cephalosporinase 21. Emaaneini M, Kalantar-Neyestanki D, Jabalameli L, Hashemi, M, et al. and OprD porin in non-metallo-β-lactamase producing Pseudomonas aeruginosa Molecular analysis and antimicrobial resistance pattern of distinct strains isolated from cystic fibrosis and burn patients. Infection, Genetics and of Pseudomonas aeruginosa isolated from cystic fibrosis patients in Iran. Iranian Evolution. 2014; 24:187-92. https://doi.org/10.1016/j.meegid.2014.03.018 Journal of Microbiology. 2019; 11: (2): 98-107. PMC6635311. 41. Lee J-Y, Ko KS. OprD mutations and inactivation, expression of efflux 22. Forbes BA, Sahm DF, Weissfeld AS. Bailey & Scott's Diagnostic Microbiology. pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant United States: Mosby; 1998. Pseudomonas aeruginosa isolates from South Korea. International Journal 23. Sales AJ, Fathi R, Mobaiyen H, Bonab FR, et al. Molecular Study of the of Antimicrobial Agents. 2012; 40(2):168-72. https://doi.org/10.1016/j. Prevalence of CTX-M1, CTX-M2, CTXM3 in Pseudomonas aeruginosa ijantimicag.2012.04.004 Isolated from Clinical Samples in Tabriz Town, Iran. Electronic Journal of 42. Shigemura K, Osawa K, Kato A, Tokimatsu I et al. Association of Biology, 2017; 13(3): 253-259. overexpression of efflux pump genes with antibiotic resistance in Pseudomonas 24. Magalhães MJTL, Pontes G, Serra PT, Balieiro A et al. Multidrug resistant aeruginosa strains clinically isolated from urinary tract infection patients. Pseudomonas aeruginosa survey in a stream receiving effluents from ineffective J Antibiot (Tokyo). 2015; 68(9):568-72. https://doi.org/10.1038/ja.2015.34 wastewater hospital plants. BMC Microbiol 2016; 16:193. https://doi. 43. Samaneh, R, Ramazanzadeh R. Prevalence of blaOxacillinase-23- and org/10.1186/s12866-016-0798-0 blaOxacillinase-24/40-type Carbapenemases in Pseudomonas aeruginosa Species 25. Fricks-Lhmaa CM, Hendriksona M, Allgaiera H, Zhuoa Jp et al. Differeces in Isolated from Patients with Nosocomial and Non-Nosocomial Infections in biofilm formation and antimicrobial resistance of Pseudomonas aeroginosa the West of Iran. Iran J Pathol. 2018; 13(3):348-356. PMC6322529. isolated from airway of mechanically ventilated patients and cystic 44. Voor in't holt AF, Severin JA, Lesaffre EM, Vos MC. A systematic review and fibrosis patients. Int J Antimicobs Agents. 2011; 4 (37): 309. https://doi. meta-analyses show that carbapenem use and medical devices are the leading org/10.1016/j.ijantimicag.2010.12.017 risk factors for carbapenem-resistant Pseudomonas aeruginosa. Antimicrob Agents 26. Fazlul MKK, Najnin A, Farzana Y, Rashid MA et al. Detection of virulence Chemother. 2014; 58: 2626-37. https://doi.org/10.1128/AAC.01758-13 factors and β lactamase encoding genes among the clinical isolates of 45. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-β-lactamases: the Pseudomonas aeruginosa. Journal of International Pharmaceutical Research quiet before the storm? Clin Microbiol Rev. 2005; 18(2): 306-25. https://doi. 2018; 45. https://doi.org/10.48550/arXiv.1902.02014 org/10.1128/CMR.18.2.306-325.2005 © 2022 JOURNAL of MEDICINE and LIFE. VOL: 15 ISSUE: 9 SEPTEMBER 2022 1109