Introduction to Pharmaceutical Biotechnology PDF

Introduction to Pharmaceutical Biotechnology Dr Ala AbuHammad, PhD ([email protected] ) WHAT IS PHARMACEUTICAL BIOTECHNOLOGY?  Definition of Biotechnology: The use of living organisms, cells, or biological systems to develop products that improve human health and quality...

Introduction to Pharmaceutical Biotechnology Dr Ala AbuHammad, PhD ([email protected] ) WHAT IS PHARMACEUTICAL BIOTECHNOLOGY?  Definition of Biotechnology: The use of living organisms, cells, or biological systems to develop products that improve human health and quality of life.  Pharmaceutical Biotechnology: The application of biotechnology in drug development, production, and healthcare solutions. Dr Ala Abuhammad, PhD Oct-24 11 BIOTECHNOLOGY – A COCKTAIL OF BIOLOGY AND TECHNOLOGY?  Biotechnology can be called as cocktail of Biology and Technology.  The integrated use of biochemistry, microbiology and engineering sciences in order to achieve technological application of the capabilities of microorganisms, cultured tissue, cells, and parts their of [The European Federation of Biotechnology (EFB), 1981; O'Sullivan, 1981]. Dr Ala Abuhammad, PhD Oct-24 12 BIOTECHNOLOGY – REAL-WORLD APPLICATIONS: COVID-19 Vaccines Recombi- mABs nant DNA Medical examples Antibiotics (e.g. Penicillin) Gene Antibiotics Therapy (Penicillin) Diagn- ostics PCR testing Dr Ala Abuhammad, PhD Oct-24 13  CONT’D  Pfizer-BioNTech (Comirnaty) and Moderna (Spikevax) were the first COVID-19 vaccines approved in many countries and have shown high efficacy in preventing severe disease.  These vaccines use messenger RNA (mRNA), a type of genetic material that instructs cells to produce the spike protein found on the surface of the SARS-CoV-2 virus (the virus that causes COVID-19).  The mRNA is delivered into human cells, usually by lipid nanoparticles, which protect the fragile RNA. Once inside, the cells use the mRNA to make copies of the spike protein.  The immune system recognizes the spike protein as foreign and generates an immune response, including the production of antibodies and memory cells.  mRNA vaccines do not use live virus, so there is no risk of getting COVID-19 from the vaccine. Dr Ala Abuhammad, PhD Oct-24 14 CONT’D  Insulin (Humulin®)  Produced through recombinant DNA technology, Humulin was the first biotechnology- derived medicine approved by the FDA. It’s created by inserting the human insulin gene into bacteria (such as E. coli) to produce insulin on a large scale. This product revolutionized diabetes management, replacing animal-derived insulin with a purer and more effective version.  Erythropoietin (EPO) (Epogen®, Procrit®)  EPO is produced using recombinant DNA technology in mammalian cell lines, such as Chinese hamster ovary (CHO) cells, to mimic the natural hormone that stimulates red blood cell production.  It is crucial for patients who cannot produce enough erythropoietin, improving quality of life and reducing the need for blood transfusions.  Uses: Anemia treatment (especially in chronic kidney disease and cancer patients) Dr Ala Abuhammad, PhD Oct-24 15 CONT’D  Monoclonal Antibodies examples  Humira®  Monoclonal antibody therapy, where humanized antibodies target specific proteins involved in the inflammatory process (e.g., TNF-α in Humira's case).  Humira was one of the world’s best-selling drugs, demonstrating the power of monoclonal antibodies in targeting specific disease pathways with fewer side effects.  Uses: Autoimmune diseases (rheumatoid arthritis, Crohn’s disease, psoriasis)  Herceptin® (Trastuzumab)  A monoclonal antibody that targets the HER2 receptor, which is overexpressed in certain breast cancer cells, inhibiting their growth.  Herceptin is a breakthrough targeted therapy that specifically treats HER2-positive breast cancer, significantly improving survival rates for patients with this type of cancer.  Uses: Breast cancer treatment (HER2-positive breast cancer. Dr Ala Abuhammad, PhD Oct-24 16 CONT’D  Biotechnological applications in antibiotic production  Beta-lactam Antibiotics (e.g. Penicillin)  Originally discovered from the Penicillium mold, biotechnology has improved the fermentation processes and genetic engineering of strains to increase yield and create semi-synthetic derivatives, such as amoxicillin and cephalosporins, that are effective against a broader range of bacteria.  Glycopeptide Antibiotics (e.g. Vancomycin)  Description: A critical antibiotic used to treat serious infections caused by Gram- positive bacteria, including MRSA. Advances in biotechnology have led to improved production methods to meet increasing demand. Dr Ala Abuhammad, PhD Oct-24 17 CONT’D  Biotechnological applications in antibiotic production  Aminoglycoside Antibiotics (e.g. Gentamicin)  Produced by the bacterium Micromonospora purpurea, gentamicin is effective against a variety of bacterial infections. Biotechnology enhances the fermentation process to optimize yield and purity.  Lipopeptide Antibiotics (e.g. Daptomycin)  A lipopeptide antibiotic derived from the bacterium Streptomyces roseosporus, it is used to treat complicated skin infections and bacteremia. Biotechnology has allowed for the production of this compound in larger quantities. Dr Ala Abuhammad, PhD Oct-24 18 CONT’D  Biotechnological applications in antibiotic production  Aminoglycoside Antibiotics (e.g. Gentamicin)  Produced by the bacterium Micromonospora purpurea, gentamicin is effective against a variety of bacterial infections. Biotechnology enhances the fermentation process to optimize yield and purity.  Lipopeptide Antibiotics (e.g. Daptomycin)  A lipopeptide antibiotic derived from the bacterium Streptomyces roseosporus, it is used to treat complicated skin infections and bacteremia. Biotechnology has allowed for the production of this compound in larger quantities. Dr Ala Abuhammad, PhD Oct-24 19 CONT’D  Notable approved gene therapy applications  Luxturna (Voretigene Neparvovec)  Condition Treated: Inherited retinal dystrophy (caused by mutations in the RPE65 gene).  How It Works: Luxturna delivers a functional copy of the RPE65 gene directly to retinal cells, allowing them to produce a protein necessary for vision, potentially restoring sight or slowing vision loss.  Approved by FDA (2017).  Zolgensma (Onasemnogene Abeparvovec)  Condition Treated: Spinal muscular atrophy (SMA), a severe genetic disorder leading to muscle weakness and loss of motor function.  How It Works: Zolgensma introduces a working copy of the SMN1 gene to replace the faulty or missing gene, allowing for normal production of the SMN protein, which is critical for motor neuron survival.  Approved by FDA (2019). Dr Ala Abuhammad, PhD Oct-24 20 CONT’D  Notable approved gene therapy applications  Zynteglo (Betibeglogene Autotemcel)  Condition Treated: Beta-thalassemia, a blood disorder that reduces the production of hemoglobin.  How It Works: Zynteglo adds functional copies of the HBB gene into a patient’s hematopoietic stem cells, enabling them to produce enough hemoglobin, reducing or eliminating the need for blood transfusions.  Approved by: EMA (2019) and FDA (2022). Dr Ala Abuhammad, PhD Oct-24 21 CONT’D  Diagnostics:  1. PCR (Polymerase Chain Reaction)  PCR amplifies specific DNA sequences, making it possible to detect even trace amounts of genetic material.  COVID-19 testing: Detects viral RNA from SARS-CoV-2.  Genetic mutations: Identifies mutations in genes for diseases like cystic fibrosis and cancer.  Infectious diseases: Detects pathogens like HIV, hepatitis, and tuberculosis.  2. ELISA (Enzyme-Linked Immunosorbent Assay)  ELISA uses antibodies and color change to detect the presence of specific proteins or antibodies in a sample.  HIV testing: Identifies HIV antibodies.  Hormonal assays: Measures hormones like insulin or thyroid hormones.  Allergy testing: Detects allergen-specific IgE antibodies.  3. Next-Generation Sequencing (NGS)  NGS sequences large amounts of DNA quickly, allowing for comprehensive genomic analysis.  Cancer diagnostics: Detects mutations across multiple cancer-related genes.  Prenatal screening: Identifies genetic abnormalities like Down syndrome in fetuses.  Rare genetic diseases: Helps in the diagnosis of rare inherited disorders. Dr Ala Abuhammad, PhD Oct-24 22 CONT’D  4. CRISPR-Based Diagnostics  CRISPR technology can detect specific genetic sequences by using a guide RNA to target and cleave DNA or RNA from pathogens or mutated genes.  COVID-19 rapid tests: CRISPR-based systems like SHERLOCK can detect the SARS-CoV-2 virus.  Point-of-care diagnostics: Potential for diagnosing infectious diseases like Zika or dengue quickly.  5. Microarray Technology  How It Works: DNA microarrays detect the expression of thousands of genes at once by hybridizing sample DNA to specific probes on a chip.  Cancer gene profiling: Identifies gene expression changes in tumor cells.  Pharmacogenomics: Assesses genetic variants that affect drug metabolism, allowing personalized medicine.  6. Biosensors  Biosensors detect biological molecules using a combination of a biological element (such as enzymes or antibodies) and a physical transducer.  Blood glucose monitoring: Detects glucose levels in diabetic patients.  Point-of-care diagnostics: Rapid tests for infections like malaria or urinary tract infections. Dr Ala Abuhammad, PhD Oct-24 23 CONT’D  7. Immunohistochemistry (IHC)  IHC uses antibodies to detect specific proteins in tissue sections, providing visual evidence of protein expression.  Cancer diagnostics: Detects biomarkers like HER2 in breast cancer.  Autoimmune disease diagnosis: Identifies autoantibodies in diseases like lupus.  8. Mass Spectrometry  How It Works: Mass spectrometry measures the mass of molecules, often used for protein identification and quantification.  Proteomics: Identifies protein biomarkers for diseases.  Drug testing: Detects metabolites or contaminants in biological samples.  9. Flow Cytometry  Flow cytometry measures the physical and chemical characteristics of cells in a fluid stream using lasers.  Leukemia and lymphoma diagnosis: Detects abnormal cell populations.  HIV monitoring: Measures CD4+ T cell levels in HIV patients. Dr Ala Abuhammad, PhD Oct-24 24 CONT’D  10. Metabolomics  Analyzes small molecules (metabolites) in biological systems (i.e. using mass spectrometry or NMR), measuring their levels reflecting the alterations in associated metabolic pathways.  Cancer and diabetes diagnosis: Detects metabolite biomarkers in the blood or urine.  Nutritional status and drug metabolism: Monitors metabolic response to therapies or diets.  Personalized medicine: Tailors treatment based on individual metabolic profiles. Dr Ala Abuhammad, PhD Oct-24 25 HOW WILL BIOTECHNOLOGY CHANGE OUR LIVES IN THE YEARS AHEAD?! Advancement How It Will Change Lives Examples Customized treatments based on genetics, improving Targeted cancer therapies like trastuzumab Personalized Medicine effectiveness and reducing side effects. (Herceptin) for HER2-positive breast cancer. Cures for genetic diseases by correcting defective genes Zolgensma for spinal muscular atrophy Advanced Gene Therapy (e.g., using CRISPR technology). (SMA). Tissue and organ regeneration for transplants, solving Stem cell therapies for heart regeneration, Regenerative Medicine organ donor shortages. lab-grown organs. More targeted therapies, like immunotherapy, offering CAR T-cell therapy for leukemia and Improved Cancer Treatments more effective and less harmful treatments. lymphoma. Early detection of diseases through advanced molecular Liquid biopsies for early cancer detection, Enhanced Diagnostics diagnostics, leading to better outcomes. genetic testing for predispositions. Faster development of vaccines (e.g., mRNA vaccines), Pfizer-BioNTech and Moderna COVID-19 Vaccine Innovation improving response to pandemics. vaccines. More efficient production of biopharmaceuticals, Insulin production using recombinant DNA Biomanufacturing lowering costs and increasing accessibility. technology. Dr Ala Abuhammad, PhD Oct-24 26 BIOTECHNOLOGY – REAL-WORLD APPLICATIONS: Biodegrad able Plastics Forensic Biofuels Science Beyond Pharmacy Genetica Biorem- lly Modified ediation Crops (GMOs): Aquacul ture Dr Ala Abuhammad, PhD Oct-24 27 CONT’D  Biofuels: Production of ethanol from crops like corn and sugarcane, or the use of algae to produce sustainable biofuels.  Bioplastics: Polylactic acid (PLA) bioplastics are produced using fermented plant sugars, offering a more sustainable alternative to petroleum-based plastics.  Genetically Modified Crops (GMOs): Crops like Bt corn and Roundup Ready soybeans are engineered for pest resistance and herbicide tolerance, improving yields and reducing pesticide use.  Bioremediation: Using microorganisms to clean up oil spills, heavy metals, or pollutants in the environment (e.g., the Exxon Valdez oil spill cleanup).  DNA Fingerprinting: Biotechnology is used in criminal investigations to match DNA samples, identify suspects, and solve cases.  Genetically Modified Fish: AquAdvantage salmon is an example of a genetically modified fish that grows faster than its wild counterpart, enhancing food production in aquaculture. AquAdvantage salmon is a genetically engineered fish, a GE Atlantic salmon developed by AquaBounty Technologies in 1989. The typical growth hormone-regulating gene in the Atlantic salmon was replaced with the growth hormone-regulating gene from Pacific Chinook salmon, with a promoter sequence from ocean pout. Dr Ala Abuhammad, PhD Oct-24 28 HOW WILL BIOTECHNOLOGY CHANGE OUR LIVES IN THE YEARS AHEAD?! Advancement How It Will Change Lives Examples Genetically modified crops with enhanced yield, disease Bt cotton (pest resistance), Golden Rice Agricultural Biotechnology resistance, and nutritional value. (vitamin A enrichment). Environmental Bioremediation techniques to clean up polluted Use of bacteria to clean oil spills, Biotechnology environments, restoring ecosystems. phytoremediation with plants. Sustainable production of biofuels and bioplastics, reducing Bioethanol from corn, bioplastics from plant Industrial Biotechnology dependence on fossil fuels. materials (e.g., PLA). Improved food safety and nutritional content through Probiotics in yogurt, fortified foods (e.g., Food Biotechnology fermentation and biofortification. vitamin-enriched cereals). Enhanced breeding and health management practices Genetically modified salmon (faster Animal Biotechnology leading to better livestock productivity. growth), disease-resistant chickens. Data analysis for better understanding of biological Genomic data analysis for crop Bioinformatics processes and faster innovation in research. improvement, drug discovery platforms. Production of chemicals and materials from renewable Production of enzymes for detergents, Biomanufacturing resources, leading to more sustainable industry practices. biodegradable materials from microbes. Dr Ala Abuhammad, PhD Oct-24 29 WHY BIOTECHNOLOGY?  Sometimes the only way to produce certain products: Biotechnology enables the production of complex biological molecules, like insulin or monoclonal antibodies, that are challenging to synthesize chemically.  High selectivity (targeting): Biotechnological processes often yield highly specific products, while reducing unwanted by-products.  Fewer by-products: Biotechnology can create cleaner processes with fewer waste materials compared to traditional chemical synthesis.  Mild reactor conditions: Biotechnology operates under moderate conditions (e.g., temperature, pressure), making it more energy-efficient and safer.  Process intensification: In biotechnology, a single biological process can replace multiple chemical steps, streamlining production and reducing costs. Dr Ala Abuhammad, PhD Oct-24 30 WHY BIOTECHNOLOGY?  Sustainability: o Reduced energy consumption: Biotechnological processes typically operate under mild conditions, cutting down energy use. o Reduced CO₂ emissions: Use of renewable resources, like biomass, helps lower greenhouse gas emissions. o Reduced waste: Many biotech processes generate biodegradable by-products, minimizing environmental impact.  Economics (long term): o Cost of fossil-based products: As crude oil prices rise, fossil-based chemical processes become more expensive. o Use of renewable raw materials: Biotechnology can utilize sustainable sources like agricultural residues, energy crops, and algae, making it economically viable in the long run. Dr Ala Abuhammad, PhD Oct-24 31 TYPES OF BIOTECHNOLOGY?  The "color classification" (e.g., Red, Green, White, Blue, etc.) is a widely used, informal framework to categorize different fields of biotechnology based on their applications.  This classification has been adopted by educators, professionals, and various organizations to make it easier to discuss and understand the diverse applications of biotechnology. Dr Ala Abuhammad, PhD Oct-24 32  BIOTECHNOLOGY APPLICATIONS – ETHICAL CONSIDERATIONS & IMPLICATIONS the key ethical considerations in biotechnology applications & their implications  Genetic Privacy  Concerns about misuse of genetic information and discrimination based on genetic data.  Example: Genetic testing revealing predispositions to diseases.  Biodiversity Loss  Genetic modification of crops and animals may reduce biodiversity and disrupt ecosystems.  Example: Monoculture practices in genetically modified crops.  Animal Welfare  Ethical treatment of animals used in research and biotechnology applications.  Example: Concerns over genetically engineered animals for food production.  Access and Equity  Ensuring equitable access to biotechnological advancements to prevent disparities.  Example: Access to gene therapies and expensive treatments. Dr Ala Abuhammad, PhD Oct-24 33 BIOTECHNOLOGY APPLICATIONS – ETHICAL CONSIDERATIONS & IMPLICATIONS  Informed Consent  Patients and subjects must be informed about the risks and benefits of biotechnological procedures.  Example: Genetic testing for inherited conditions without proper counseling.  Dual Use Concerns  Biotechnology can be used for harmful purposes, such as bioweapons or unethical research.  Example: Potential misuse of CRISPR technology for creating harmful pathogens.  Food Safety and Labeling  Ethical concerns surrounding labeling of genetically modified foods and consumer choice.  Example: GMO labeling initiatives and public debate over food safety.  Human Enhancement  Ethical dilemmas regarding biotechnology use for non-therapeutic enhancements.  Example: Genetic modification for enhanced physical or cognitive traits. Dr Ala Abuhammad, PhD Oct-24 34  INTRODUCTION – RECOMBINANT DNA TECHNOLOGY  Recombinant DNA Technology is a technology that uses enzymes to cut and paste together DNA sequences of interest.  The technology used for producing artificial DNA through the combination of different genetic materials (DNA) from different sources.  Recombinant DNA technology is popularly known as genetic engineering.  The recombinant DNA technology emerged with the discovery of restriction enzymes in the year 1968 by Swiss microbiologist Werner Arber. Dr Ala Abuhammad, PhD Nov-24 4  Process Of Recombinant DNA Technology  Step-1. Isolation of Genetic Material.  The first and the initial step in Recombinant DNA technology is to isolate the desired DNA in its pure form i.e. free from other macromolecules.  Step-2. Cutting the gene at the recognition sites.  The restriction enzymes play a major role in determining the location at which the desired gene is inserted into the vector genome. These reactions are called ‘restriction enzyme digestions’.  Step-3. Amplifying the gene copies through Polymerase chain reaction (PCR).  It is a process to amplify a single copy of DNA into thousands to millions of copies once the proper gene of interest has been cut using restriction enzymes.  Step-4. Ligation of DNA Molecules.  In this step of Ligation, the joining of the two pieces – a cut fragment of DNA and the vector together with the help of the enzyme DNA ligase.  Step-5. Insertion of Recombinant DNA Into Host.  In this step, the recombinant DNA is introduced into a recipient host cell. This process is termed as Transformation. Once the recombinant DNA is inserted into the host cell, it gets multiplied and is expressed in the form of the manufactured protein under optimal conditions. Dr Ala Abuhammad, PhD Nov-24 5 BASIC PRINCIPLE OF RECOMBINANT DNA TECHNOLOGY  The principle of recombinant DNA technology encompasses a series of systematic steps that facilitate the manipulation and analysis of genetic material.  This technology enables researchers to isolate, modify, and transfer specific genes, playing critical and potential roles related to genetic functions and applications in various fields such as medicine and agriculture.  The following points outline the foundational steps involved in this technology. Dr Ala Abuhammad, PhD Nov-24 6  1. GENE CLONING AND DEVELOPMENT OF RECOMBINANT DNA  Gene Cloning: This is a specific application of recombinant DNA technology. It refers to the process of making multiple copies of a particular gene (making clones, colonies!).  This initial step involves isolating the gene of interest (GOI) from the source organism.  Finding a specific gene in a DNA – finding a needle in a haystack!  The target DNA is then ligated into a suitable vector, such as a plasmid, to create recombinant DNA.  This recombinant DNA can replicate independently within a host cell, allowing for the generation of multiple copies of the desired gene.  The members of a clone are genetically identical, because cell replication produces identical daughter cells each time. Dr Ala Abuhammad, PhD Nov-24 7 DNA isolation - extraction Dr Ala Abuhammad, PhD Nov-24 8 HOW TO LOCATE THE GENE OF INTEREST?!  To locate a specific gene of interest (GOI) in a DNA sample, scientists use a combination of techniques that allow them to target, identify, and isolate that gene with precision. Here’s how it’s generally done: 1. Identify the Sequence or Features of the Gene of Interest √ First, researchers need to have some information about the GOI, such as part of its DNA sequence, or at least some of its functional features (like protein it codes for). √ If they know the sequence, they can design specific primers or probes that match the gene's unique regions. 2. Polymerase Chain Reaction (PCR)  PCR is one of the most common methods for locating and amplifying a GOI if its sequence is known.  Primers: Short, single-stranded DNA sequences are designed to match the sequences flanking the GOI. They’re complementary to the beginning and end of the gene, allowing the DNA polymerase enzyme to only amplify that specific region.  PCR selectively amplifies the GOI, producing millions of copies of it, making it easy to detect in a DNA sample.  This technique is highly specific and allows scientists to locate and isolate the GOI even in a large DNA sample. 3. Hybridization with a Gene Probe 4. DNA Sequencing and Bioinformatics 5. Screening a DNA Library 6. Fluorescent In Situ Hybridization (FISH)  FISH is a technique often used to locate a gene’s position on a chromosome within a cell. Dr Ala Abuhammad, PhD Nov-24 9 Cutting of DNA!  Into large fragments by mechanical shearing  Restriction enzymes are the scissors of molecular genetics. Dr Ala Abuhammad, PhD Nov-24 10 Restriction enzymes  Restriction enzymes are endonucleases (Endo (inside), nuclease(cuts nucleic acid), which catalyze the cleavage of the phosphodiester bonds within both strands of DNA.  They require Mg2+ for activity and generate a 5 prime (5') phosphate and a 3 prime (3') hydroxyl group at the point of cleavage. Dr Ala Abuhammad, PhD Nov-24 11 Restriction enzymes – BIOLOGICAL FUNCTION  Restriction enzyme is part of the cell’s restriction-modification system in bacteria.  The phenomenon of restriction modification in bacteria is a small scale immune system for protection from infection by foreign DNA.  Bacteria can protect themselves only after foreign DNA has entered their cytoplasm (as bacteriophages). Dr Ala Abuhammad, PhD Nov-24 12  DNA can be cut by restriction enzymes in two different ways! One way is to cut DNA to leave overhangs of unpaired DNA Another way is to cut DNA to leave a “blunt” end based, or “sticky” ends (overhangs). They are called sticky in which there are no overhangs. ends because the DNA bases of each unpaired end have an affinity for each other based on complementary base-pairing rules. Dr Ala Abuhammad, PhD Nov-24 13  Recognition sequence  The distinguishing feature of restriction enzymes is that they only cut at very specific sequences of bases. This specific DNA sequence is called recognition sequence.  A recognition sequence is the specific sequence of DNA that a restriction enzyme recognizes and cleaves.  Restriction enzymes are traditionally classified according to the subunit composition, cleavage position, sequence-specificity and cofactor requirements.  A restriction enzyme requires a specific double stranded recognition sequence of nucleotides to cut DNA.  Recognition sites are usually 4 to 8 base pairs in length.  Cleavage occurs within or near the site. Dr Ala Abuhammad, PhD Nov-24 14  Palindrome  A palindrome is a word or sequence that reads the same forward and backward (for example, “radar”). Palindromes are how restriction enzymes recognize their target sequences. They read the same when read in the 5′ to 3′ direction on both strands.  The majority of restriction enzymes recognize and cut DNA at palindromic sequences.  The vast majority of restriction enzymes do recognize palindromic sequences, as this allows for the recognition of both strands of the DNA simultaneously. However, some restriction enzymes may target non-palindromic sequences, but these are relatively uncommon. Dr Ala Abuhammad, PhD Nov-24 15  Enzyme activity GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA Scanning CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT Recognition Sequence GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT AATTCGCATCGGATCCGAATCCGCTCTTTCAA Cleavage GGACGCTAGCTGATG CCTGCGATCGACTACTTAA GCGTAGCCTAGGCTTAGGCGAGAAAGTT Dr Ala Abuhammad, PhD Nov-24 16  Naming of restriction enzymes  Restriction enzymes are named according to the organism from which they are isolated.  This is done by using the first letter of the genus followed by the first two letters of the species and additional letter or number represent the strain or serotypes.  Only certain strains or sub-strains of a particular species may produce restriction enzymes.  Example of restriction enzymes EcoRI Escherichia coli R G/AATTC BamHI Bacillus amyloliquefaciens H G/GATCC HindIII Haemophilus influenzae Rd A/AGCTT PstI Providencia stuartii CTGCA/G PmeI Psuedomonas mendocina GTTT/AAAC Dr Ala Abuhammad, PhD Nov-24 17 2. Transfer of vector into the host  After creating recombinant DNA, the vector must be introduced into a host organism. This process is known as transformation (in bacteria) or transfection (in eukaryotic cells).  Various techniques, such as heat shock, electroporation, or viral vectors, can be employed to facilitate this transfer, ensuring the host cells can incorporate the recombinant DNA. Dr Ala Abuhammad, PhD Nov-24 18 3. Selection of transformed cells  Following the introduction of the recombinant DNA, it is crucial to identify and select the cells that have successfully incorporated the vector.  This is typically achieved using selectable markers, such as antibiotic resistance genes, which allow transformed cells to survive in selective media while non-transformed cells are eliminated. The selected cells can then be expanded for further analysis. Dr Ala Abuhammad, PhD Nov-24 19 4. Transcription And Translation Of The Inserted Gene  Once the transformed cells are identified, the next step involves the expression of the inserted gene.  This includes transcription, where the gene is transcribed into messenger RNA (mRNA), and translation, where the mRNA is translated into a functional protein. Dr Ala Abuhammad, PhD Nov-24 20 5. Genetic analysis and sequencing  Recombinant DNA technology also enables researchers to study the genetic makeup of organisms.  By isolating and producing specific genes in large quantities, researchers can analyze genetic information through sequencing. Two primary methods are used:  Expressed Tag Sequencing (ETS): This method focuses on identifying expressed sequences (exons) that are translated into proteins.  Sequence Annotation: This approach includes the analysis of both exons and introns, providing a comprehensive view of the gene structure. Dr Ala Abuhammad, PhD Nov-24 21  Applications Of Recombinant DNA Technology: 1. Production of Therapeutic Proteins – Enables large-scale production of proteins like insulin for treating diseases such as diabetes. 2. Monoclonal Antibodies – Developing targeted therapies for diseases like cancer using engineered antibody- producing cells. 3. Genetically Modified Organisms (GMOs): Improves crop yield and pest resistance by introducing beneficial genes (e.g., Bt cotton). 4. Model Organisms – Creating transgenic animals (e.g., mice) to study human diseases and test potential therapies. 5. Gene Therapy – Correcting genetic disorders (e.g., SCID) by replacing faulty genes with functional ones. 6. Personalized Medicine – Studying genetic variations to customize treatments for improved efficacy and reduced side effects. 7. Biotechnological Solutions – Engineering microbes for sustainable applications like biofuel production or environmental cleanup Dr Ala Abuhammad, PhD Nov-24 22 Ethical Considerations And Safety Concerns 1. Biosafety Risks:  Potential unintended release of genetically modified organisms (GMOs) into the environment, disrupting ecosystems.  Risk of engineered pathogens causing biohazards or misuse for bioterrorism. 2. Genetic Privacy and Security:  Possibility of unauthorized use of genetic data, raising concerns about consent and confidentiality.  Ethical dilemmas in genetic profiling and discrimination based on genetic information. 3. Ethics of Genetic Modification:  Moral concerns about altering the genetic makeup of organisms, including humans (e.g., germline editing).  Fear of creating "designer babies" or exacerbating social inequality. 4. Impact on Natural Biodiversity:  GMO crops potentially outcompeting native species, reducing biodiversity.  Risk of gene flow between GMOs and wild relatives leading to "superweeds." Dr Ala Abuhammad, PhD Nov-24 23 Ethical Considerations And Safety Concerns 5. Animal Welfare:  Ethical issues in using animals for genetic modification experiments or creating transgenic species. 6. Accessibility and Equity:  Unequal access to the benefits of recombinant DNA technology between developed and developing nations.  High costs of therapies limiting availability for disadvantaged populations. 7. Regulation and Oversight:  Need for stringent guidelines and global cooperation to ensure safety and prevent unethical practices Dr Ala Abuhammad, PhD Nov-24 24 INTRODUCTION TO PCR  What is PCR?  PCR is a laboratory technique used to amplify specific DNA sequences.  Allows researchers to replicate DNA exponentially in-vitro.  PCR is a laboratory version of DNA Replication in cells!  The laboratory version is commonly called “in vitro” since it occurs in a test tube while “in vivo” signifies occurring in a living cell.  PCR can make billions of copies of a target sequence of DNA in a few hours! Dr Ala Abuhammad, PhD Dec-24 5  DNA REPLICATION IN CELLS (IN-VIVO)  DNA replication is the copying of DNA.  It typically takes a cell just a few hours to copy all of its DNA.  DNA replication is semi-conservative (i.e. one strand of the DNA is used as the template for the growth of a new DNA strand).  This process occurs with very few errors (on average there is one error per 1 billion nucleotides copied).  More than a dozen enzymes and proteins participate in DNA replication.  Key enzymes involved in DNA Replication  DNA Polymerase  Helicase  DNA Ligase  Topoisomerase  Primase  Single strand binding protein Dr Ala Abuhammad, PhD Dec-24 6 PCR Significance  Why is it important?  Revolutionized molecular biology and biotechnology.  Its applications are vast and PCR is now an integral part of Molecular Biology  Essential for diagnostics, drug development, and genetic research.  Inventor: Invented by Kary Mullis in 1985, earning him the Nobel Prize. Kary Mullis (1944-2019) Dr Ala Abuhammad, PhD Dec-24 7 PCR PRINCIPLES AND STEPS  The basis of PCR is temperature changes and the effect that these temperature changes have on the DNA.  In a PCR reaction, the following series of steps is repeated 20-40 times (note: 25 cycles usually takes about 2 hours and amplifies the DNA fragment of interest 100,000 fold)  The Three Main Steps of PCR:  Denaturation (94-98°C): Double-stranded DNA separates.  Annealing (50-65°C): Primers bind to target DNA sequence.  Extension (72°C): Taq polymerase synthesizes new DNA strands. Dr Ala Abuhammad, PhD Dec-24 8 PCR PRINCIPLES AND STEPS Dr Ala Abuhammad, PhD Dec-24 9  DETECTION AND READOUT IN PCR  PCR detection and readout allow us to identify, measure, and analyze amplified DNA.  Common Detection and Readout Methods in PCR:  1. Fluorescence-Based Detection:  Used in qPCR and Multiplex PCR.  Dyes (e.g., SYBR Green) or probes (e.g., TaqMan) bind to double-stranded DNA. As DNA amplifies, fluorescence increases, and the amount of fluorescence is proportional to the amount of DNA present. A typical graph where fluorescence intensity is plotted  Readout: Amplification curves and cycle against reaction cycle number. qPCR reaction graph threshold (Ct) values. showing fluorescence plotted against the number of cycles. Dr Ala Abuhammad, PhD Dec-24 10 DETECTION AND READOUT IN PCR PCR Amplification Graph Dr Ala Abuhammad, PhD Dec-24 11 DETECTION AND READOUT IN PCR qPCR plot showing the effect on Ct of increasing starting template DNA copy numbers in the starting reaction mix. The sample with 10 millions copies of target DNA (red line) has a lower Ct value than the sample with 10 copy numbers (green line to the right of the graph) Dr Ala Abuhammad, PhD Dec-24 12  DETECTION AND READOUT IN PCR Ladder to calibrate  2. Gel Electrophoresis: amplified fragment size  Used in conventional and RT-PCR.  Visualizes amplified DNA as bands based on size.  After the PCR process, the amplified DNA is separated using gel electrophoresis. The DNA fragments are stained with a dye (e.g., ethidium bromide) and visualized under UV light. Bands corresponding to the target DNA indicate successful detection.  The figure shows: End point PCR gel electrophoresis showing the results of four samples tested. From these results it can be seen that Samples 1, 3 and 4 tested positive for the DNA of interest. Sample 2 was negative for the DNA of interest. Dr Ala Abuhammad, PhD Dec-24 13  KEY COMPONENTS OF PCR  Template DNA: The DNA of interest to be amplified; that contains the target sequence we want to copy.  Primers: Short oligonucleotides for targeting specific DNA regions (short, single-stranded DNA molecules).  Taq Polymerase: A Heat-stable enzyme for DNA synthesis.  Nucleotides (dNTPs): All four deoxynucleotide triphosphates building blocks of DNA.  Buffer: Maintains the optimal conditions for the reaction/ the DNA polymerase to function effectively.  Thermal cycler (a device that can change temperatures dramatically in a very short period of time)  Thin walled tubes Dr Ala Abuhammad, PhD Dec-24 14  PCR VARIANTS AND MODIFICATIONS  Quantitative PCR (qPCR): Measures DNA concentration in real-time during amplification using fluorescent dyes or probes. Also known as real-time PCR.  The name "real-time" highlights the ability to observe and measure DNA synthesis dynamically, without delay, as the reaction progresses. This characteristic is vital for applications requiring precise and rapid nucleic acid quantification, such as diagnostics and gene expression studies.  Therapeutic Monitoring: Measuring viral load in patients undergoing antiviral treatments (e.g., HIV or hepatitis).  Pharmacogenomics: Quantifying gene copy numbers to predict patient response to drugs like warfarin (gene target - CYP2C9) or trastuzumab (gene target - HER2 ).  Quality Control: Ensuring consistency in biologics and biosimilars production by quantifying genetic content. Dr Ala Abuhammad, PhD Dec-24 15  The Advantages Of Real-time PCR Include: 1. Ability to monitor the progress of the PCR reaction as it occurs in real time 2. Ability to precisely measure the amount of amplicon at each cycle, which allows highly accurate quantification of the amount of starting material in samples 3. An increased dynamic range of detection Figure 1. Relative fluorescence vs. cycle number. Amplification plots are created when the fluorescent signal from each sample is plotted 4. Amplification and detection occurs against cycle number; therefore, amplification plots represent the in a single tube, eliminating post- accumulation of product over the duration of the real-time PCR PCR manipulations. experiment. The samples used to create the plots are a dilution series of the target DNA sequence. Dr Ala Abuhammad, PhD Dec-24 16  PCR VARIANTS AND MODIFICATIONS  Reverse Transcriptase PCR (RT-PCR): For RNA to DNA conversion. Detecting RNA viruses like influenza or SARS-CoV-2 (e.g., mRNA COVID- 19 vaccines were validated using RT-PCR).  Note: RT-PCR (Reverse Transcriptase PCR) and qPCR (Quantitative PCR) can be combined, and this technique is commonly referred to as real- time RT-PCR or qRT-PCR. Dr Ala Abuhammad, PhD Dec-24 17 PCR VARIANTS AND MODIFICATIONS  Multiplex PCR: Amplifies multiple targets simultaneously by multiplying several fragments in a single DNA sample by using a number of primers.  Reduces time and resources by providing multi-target results in one assay, useful for high-throughput drug screening and diagnostics.  Pathogen Detection: Identifying multiple pathogens in a single diagnostic test (e.g., simultaneous detection of drug-resistant genes in tuberculosis).  Genetic Screening: Testing for mutations in multiple genes related to diseases or drug metabolism (e.g., BRCA1/2 mutations for cancer risk).  Long-range PCR uses a variety of polymerases, to generate larger DNA ranges.  Amplifies large DNA fragments (>5–10 kb).  Uses high-fidelity polymerases for accuracy and completeness.  Enables study of large genomic regions, structural variations, and sequencing templates.  Touchdown PCR: Optimizes specificity through gradual temperature decrease.  Improves amplification accuracy and specificity, essential for critical pharmaceutical and clinical studies.  Precision Drug Development: Amplifying genes with high GC content or challenging regions, aiding in the identification of druggable targets.  Rare Mutation Detection: Enhancing specificity for low-abundance or rare genetic variations critical in cancer drug discovery Dr Ala Abuhammad, PhD Dec-24 18  DETECTION AND READOUT IN PCR VARIANTS  Fluorescence- based methods Type of PCR Purpose Detection Method Readout/Output provide real-time DNA amplification for DNA bands indicating insights, while Conventional PCR downstream Gel electrophoresis. presence/size. applications. traditional Reverse Transcriptase Converts RNA to DNA for DNA bands derived from methods like gel Gel electrophoresis. PCR amplification. RNA. electrophoresis Measures DNA confirm the final Fluorescent dyes (e.g., Amplification curves (Ct Quantitative PCR (qPCR) concentration in real- product. SYBR Green) or probes. values). time. Amplifies multiple Fluorescent probes or Multiple DNA bands or Multiplex PCR targets simultaneously. gel electrophoresis. fluorescence curves. Enhances specificity Gel electrophoresis or Target-specific bands or Touchdown PCR through temperature fluorescence detection. curves. steps. Absolute quantification Partition-based Digital quantification Digital PCR of DNA molecules. fluorescence. (copies/µL). Dr Ala Abuhammad, PhD Dec-24 19 KEY DECISIONS WHEN DESIGNING A PCR EXPERIMENT  What’s the Goal? Think about why you’re doing PCR. Is it to clone a gene, diagnose a disease, or sequence DNA? The purpose shapes the experiment.  DNA Quality Matters: Use clean, high-quality DNA. If the DNA is damaged or contains contaminants, PCR might fail.  Good Primer Design: Primers are like guides for the polymerase. They should be the right length, match the DNA sequence you’re targeting, and not stick to themselves (to avoid primer-dimers). Dr Ala Abuhammad, PhD Dec-24 20 CHOOSING THE RIGHT DNA POLYMERASE DNA POLYMERASE: THE 4 KEY FEATURES  Thermostability  PCR heats up to high temperatures. Polymerases must stay active at the high temperatures used in PCR.  For example, the thermostable polymerase (Taq) lasts 40 minutes at 95°C, while Deep Vent polymerase can stay active for hours at even higher temperatures.  Accuracy (Fidelity):  Some experiments need super-accurate DNA copying (e.g., for cloning) without mistakes,  High-fidelity enzymes like Pfu or Q5® are great for cloning because they proofread and fix errors.  Speed and Length (Processivity):  If you’re amplifying a long DNA fragment, use a polymerase designed for long-range PCR.  Refers to how fast and efficiently the polymerase adds DNA bases.  Some polymerases, like KAPA2G, work faster and handle tricky DNA regions (like GC-rich areas) better than standard Taq.  Specificity:  Ensures the correct DNA sequence is amplified without errors.  Hot-start Taq polymerase helps by staying inactive until heated, preventing unwanted reactions during preparation. Dr Ala Abuhammad, PhD Dec-24 21 HOW TO GET THE BEST PCR RESULTS  Set the Right Annealing Temperature:  This is when primers attach to the DNA.  Too low? You’ll get random results.  Too high? Primers won’t bind. Try a gradient to find the sweet spot.  Adjust Mg²⁺ Levels: Magnesium helps the polymerase work. Too much or too little can mess up the reaction. Dr Ala Abuhammad, PhD Dec-24 22 SOLVING COMMON PCR PROBLEMS  Nothing Shows Up: Check if the DNA is good, primers are correct, or if cycling conditions are wrong.  Extra Bands on the Gel: The primers might stick to the wrong places. Try adjusting the temperature or using a specialized polymerase.  Weak Bands: Use more DNA or run the reaction for more cycles. Dr Ala Abuhammad, PhD Dec-24 23 TIPS FOR SUCCESSFUL PCR  Avoid Contamination: Use clean tools, separate workspaces, and include a control reaction with no DNA to check for contamination.  Set Up Reactions Carefully: Use a master mix to avoid pipetting errors and ensure all reactions are consistent.  Check Results: Run your PCR product on a gel to confirm it’s the right size and pure. Dr Ala Abuhammad, PhD Dec-24 25 Applications Of PCR In Pharmaceutical Biotechnology  Diagnostics:  Detecting genetic mutations (e.g., BRCA1/BRCA2 in breast cancer).  Pathogen detection (e.g., COVID-19 testing).  Drug Development:  Genotyping for personalized medicine.  Screening for genetic diseases.  Therapeutics:  Identifying therapeutic targets.  Generating DNA for gene therapy. Dr Ala Abuhammad, PhD Dec-24 26 LIMITATIONS OF PCR 1. Requires precise temperature cycling equipment. 2. Sensitive to contamination, leading to false positives. 3. Amplifies DNA errors if present in the template. Dr Ala Abuhammad, PhD Dec-24 27