Bio Labs - BIOA01 PDF

ALL LABS Lab 1 Quiz 1. What was the order of divergence from oldest (1) to most recent (5)? 1 - Bacteria 2 - Insects 3 - Gymnosperms 4 - Birds 5 - Angiosperms 2. Rank the following taxonomic groups, from greatest global species div...

ALL LABS Lab 1 Quiz 1. What was the order of divergence from oldest (1) to most recent (5)? 1 - Bacteria 2 - Insects 3 - Gymnosperms 4 - Birds 5 - Angiosperms 2. Rank the following taxonomic groups, from greatest global species diversity (1) to least global species diversity (5) 1 - Insects 2 - Angiosperms 3 - Chelicatra 4 - Reptiles 5 - Mammals 3. For which branch of the tree of life do we see a lack of regionalism, with most species occurring everywhere in the world? Bacteria Insects Birds Gymnosperms 4. The following statement is false regarding symbiotic relationships between fungus and plants The first plant that colonized land had a symbiotic fungus already established. In symbiotic relationships, plants provide fungi with photosynthesized sugars. Many trees and herbaceous (non woody plants) form symbiotic relationships with fungal species. Symbiotic fungi will eventually kill the plant they form a symbiotic relationship with. In symbiotic relationships, fungi provide plants with better access to water and nutrients. 5. A fern commonly found in the Highland Creek valley is Sensitive fern. Deer fern. Sword fern. There are no fern species in the Highland Creek valley. 6. Of all the taxonomic groups covered on this field trip, angiosperms have the highest percent of invasive species. True  False 7. The taxonomic group Chelicerata is one of the oldest extant animal groups True False 8. Amphibians are endotherms or "warm blooded". True False 9. Humans are mammals. True False 10. A mating ball is: A mating event that involves a single female garter snake and more than one male snake. A formal gathering of garter snakes, where male and female pairs will form. A mating behaviour of male gartner snakes, where the male impresses the female with his ability to form a tight ball. A mating event that involves a single male garter snake and more than one female snake. A mating ritual where the female garter snake coils herself tightly. Assignment Lab 2 Quiz 1. Which term describes a tree that illustrates a hypothesized sequence of evolutionary branchings? sister group system cladogram analogous traits 2. The presence of a complete fossil record is required to develop a phylogenetic tree True False 3. What term describes the science of biological classification?  phylogeny taxonomy classification nomenclature 4. The wings of bats, birds and bees is an example of convergence since the three groups did not inherit the characteristics from their common ancestor. True False 5. The more genetic differences between two species, the more distantly related those two species are. True False 6. The more genetic differences between two species, the more closely related those two species are. True False 7. Look at the following tree, which statement best describes the evolution of flies? Flies evolved another derived trait for character 8. Flies are the outgroup and therefore are distantly related to all other insect groups depicted in this tree. Flies possess the derived trait for character 5. Flies reverted to the ancestral character for character 8. Flies most recent common ancestor was shared with mantids. 8. Order the following steps to show the best way to resolve evolutionary relationships using cladistic analysis. 1 Thoughtful identification of homologous characters 2 Choosing an outgroup and coding the character states as either ancestral or derived  3 Grouping by shared derived characters to form the most parsimonious cladogram, producing a hypothesis 9. In Exercise 2B (Resolving Evolutionary relationships in the "Boltidae"), the nail ("organism" E) possesses only ancestral traits. True False 10. In Exercise 3, how many species are being compared during your MEGA analysis? 7 8 6 10 9 Assignment 1. Look at the phylogenetic tree of the six hypothetical beetle taxa you constructed for this lab. Which taxa is the sister taxa to Taxa D? Taxa E Taxa B Taxa A Taxa C The outgroup 2. Look at the phylogenetic tree of the six hypothetical beetle taxa you constructed for this lab, what shared derived traits do Taxa A and Taxa C have in common? Select all that apply. Visible tibal lines Hind wing anal lobe that is absent Biloped apex of left mandible Convex body form Bilobed tegmen 3. Look at the phylogenetic tree of the six hypothetical beetle taxa you constructed for this lab, what shared ancestral traits do Taxa B and Taxa D have in common? Select all that apply. Hindwing anal lobe present Tibal lines not visible Unilobed apex of left mandible Convex body form Unilobed tegmen  4. Look at the phylogenetic tree of the six hypothetical beetle taxa you constructed for this lab. True or False: Taxa A and E form a monophyletic group. True False 5. Describe the evolution of the hindwing anal lobe in this group of hypothetical beetle taxa. Ensure you include the terms ancestral character state and derived character state correctly in your description. Start with: According to this phylogenetic tree, the common ancestor for these six hypothetical beetle taxa possessed.. According to this phylogenetic tree, the common ancestor for these six hypothetical beetle taxa possessed no hindwing anal lobe. Taxa B, D and E evolved and a hindwing anal lobe became present making it a derived character state. 7. Reflect on your experience resolving the evolutionary relationships within the hypothetical taxa Boltidae. What is one challenge you encountered? Relate this challenge to a real challenge encountered by scientists constructing phylogenetics trees. One challenge I encountered while resolving the evolutionary relationships within the hypothetical taxa Boldidae was with writing the small numbers which describe where the character evolved in an organized correct manner. I found it a little challenging and scientists might also encounter this challenge as classifying organisms which have similar features can be challenging especially if you're classifying many organisms or things and traits indicating a shared ancestor and traits that evolved independently. 9. Birds are descendants of crocodiles. True False 10. Birds and crocodiles are sister taxa. True False 11. Refer to the tree below. Refer specifically to the Tetrapod lineage (supported by the shared derived character ‘Four limbs’). A. What is the main difference between the Tetrapod lineage depicted in this tree based on morphology and the tree that you constructed based on mitochondrial DNA (i.e., are Tetrapods monophyletic in both trees)? (0.1 mark) B. How ‘reliable’ is the latter hypothesis of relationships (0.1 mark)? Ensure you have defined bootstrap values in your answer (0.1 mark).  The main difference between the Tetrapod lineage depicted in this tree based on morphology and the tree that I constructed based on mitochondrial DNA is that in this diagram rodents and rabbits are grouped together whereas in the tree constructed based on the mitochondrial DNA rodents and rabbits are a sister group. Tetrapods are monophyletic in both trees. The latter hypothesis of relationships is somewhat reliable as this tree is based on morphology and the other is constructed based on the mitochondrial DNA which provides more detail as there are more characters in molecular data that can vary among the species. The closer the bootstrap value is to 100, the higher the node readability and in in the tree we constructed bootstrap values varied with some being 99, 77, 76, 53, 90, and 61. Over all the bootstrap values were high. Specifically looking at the bootstrap value for the Tetrapod lineage, the bootstrap value was 53 which is not so good compared to the other values. Lab 3 Quiz 1. In today's experiment, why are we putting water in the flask? to keep the plant alive. to resist changes in pH in the system being studied. to resist changes in temperature in the system being studied. to prevent air bubbles. 2. In today's experiment, we will be testing how photosynthetic rate is affected by carbon availability the herbicide DCMU oxygen level wavelength of light 3. In today's experiment, the treatment containing only the sodium bicarbonate is the negative control.  True False 4. The following statements are true regarding photosynthesis (select all that apply): Photosynthesis is a biochemical process. Photosynthesis requires inorganic compounds to build organic compounds. Plants are the only organisms that photosynthesize. Photosynthesis is powered by light energy. 5. Look at the diagram. What label belongs in the box with the question mark? electron transport chain carbohydrates carbon dioxide water Oxygen 6. When cutting the aquatic plant, you will initially measure and cut (while the plant is submerged) 15cm from the growing tip of the plant. According to this image, which end will you measure from? This image does not show the growing tip of the aquatic plant. Point B Point A 7. The oxygen produced by the aquatic plant in the experimental treatment displaces the water in the 1mL pipette to the volume indicated by the red arrow after 60  minutes. What is the photosynthetic rate (mL/min) of this aquatic plant? You are permitted to use a calculator to answer this question. 0.1 mL/min 60 mL/min 0.017 mL/min 1 mL/min 0.0017 mL/min 8. The oxygen produced by the aquatic plant in the control treatment displaces the water in the 1mL pipette 0.9mL, is reset to zero, and then displaces it further to volume indicated by the red arrow after 60 minutes. What is the photosynthetic rate (mL/min) of this aquatic plant? You are permitted to use a calculator to answer this question. 1 mL/min 0.0017 mL/min 60 mL/min 0.017 mL/min 0.1 mL/min 9. While setting up your photosynthesis experiment, you will want to check the following to ensure your experiment runs properly. Check all that apply. There is no air between the liquid in the tubes and the rubber stopper. Classroom lights are left on. Pipette is set to zero. All cutting of the plant stem has been completed while the stem is submerged Assignment 1. What is your research hypothesis for this experiment? If DCMU competes for the binding site of the photosynthetic electron transfer chain protein, then the rate of photosynthesis in the aquatic plant Elodea Densa will decrease. 2. Which of the following statements is not true regarding the experimental procedure for the photosynthesis lab you performed in Lab 3? All groups in your lab practical contributed to a single data set. The experiment ran for 60 minutes. Both the control and experimental treatment tubes, Tube #1 and Tube #2, contained the bicarbonate solution. Total amount of carbon dioxide (CO2) was measured for each tube. The plants used in the control and experimental treatment groups were set equal distance from the light source 3. Which of the following statements is not true regarding the experimental procedure for the photosynthesis lab you performed in Lab 3? All groups in your lab practical contributed to a single data set. A Student t-test will be performed to determine if there is a significant difference between the control and experimental treatment groups. Photosynthetic rate was calculated in mL/min for each tube by dividing the total amount of oxygen produced (mL) for each tube by 60 minutes. The experiment ran for 60 minutes. Only the control tube, Tube #1, contained bicarbonate solution. 4. In 250-500 words, describe the methods used to perform the photosynthesis experiment in your lab group. The Methods sections describes the experimental procedures, including any controls, in your own words. This section should be written in the past tense (and first-person if applicable). The description should be complete enough to allow someone to repeat your work. The Methods section should describe the chronological process that you used to complete the experiment, how all of the data was collected and analyzed in your practical group. It should be written in complete sentences, not bulleted lists. After gathering the necessary lab supplies, my group put on safety goggles and grabbed some gloves to start the experiment. Next, two 250 mL Erlenmeyer flasks were acquired and 200 mL of water was added to each flask from the sink. Additionally, we were given two glass tubes, which we labeled tubes 1 and 2. Test tube 1 was then filled with 75 mL of bicarbonate solution only and the tube was then placed into one of the Erlenmeyer flasks. Afterwards, we filled test tube 2 with 75 mL of bicarbonate solution and herbicide and put it in the second Erlenmeyer flask. My group next took some water from the sink and, using forceps, picked up two aquatic plants (Elodea densa) and placed them into the white tray that had been given to us. We measured the distance of 15 cm from each plant's growing tip with a ruler and, with the plants still immersed in the white tray, cut them at that length with a pair of scissors. Then, using forceps, I put one of the cut aquatic plants into test tube 1, making sure that the plant's cut stem was at the top and completely immersed, and the growing tip was at the bottom. I did the same process for the second aquatic plant and placed it in the second test tube but made sure to use a different pair of forceps. Using a separate pair of forceps, I followed the same procedure for the second aquatic plant and put it in the second test tube. Then, while the stem was still immersed in test tube 1, a group member put scissors inside and cut off 0.5 cm of it. For test tube 2, we followed the identical procedure using a different set of scissors. After the plants were cut and placed in their appropriate tubes, I placed a rubber stopper onto each test tube, making sure there were no air bubbles. We ensured that each tube spilled some solution. We then used paper towels to wipe up the spill. Then, for each test tube, we used the syringe on the rubber stopper to extract solution from the test tube until the pipette's solution level was zero. Next, we positioned the Erlenmeyer flasks such that they were 15 cm apart from the lamp. After that, the lamps were switched on and the classroom lights were turned off. After allowing the experimental system to equilibrate for five minutes, we used the syringe provided with each test tube to reset the pipette to zero. For the next 60 minutes, my group measured the gas output every five minutes. We switched off our lamps after 60 minutes and added the total mL of oxygen generated in each test container. After that, we divided the total amount of oxygen produced after 60 minutes by 60 to get each test tube's photosynthetic rate in mL per minute. Also need to specifically mention the control group 5. Summarize the key trends for your lab practical's experiment by answering the following questions in complete sentences: What was the photosynthetic rate for your group's control group and experimental group? Describe any differences that you observed in the photosynthetic rate between the control and experimental group over 60 minutes (refer to your graph). For the data collected by your entire lab practical, what is the average photosynthetic rate for the control group? For the data collected by your entire lab practical, what is the average photosynthetic rate for the experimental group? The photosynthetic rate for my group's control group was 0.00475 mL/min. The photosynthetic rate for my group's experimental group was 0.00317 mL/min. A difference that is noticeable is that the the photosynthetic rate in my experimental group was significantly lower than the photosynthetic rate in the control group. For the data collected by the entire lab practical, the average photosynthetic rate for the control group is 0.0056 mL/min. For the data collected by the entire lab practical, the average photosynthetic rate for the control group is 0.0031 mL/min. Lab 4 Quiz 1. In today's experiment, you will be using which type(s) of microscope(s)? electron microscope dissecting microscope compacted light microscope compound light microscope 2. What is the maximum useful magnification for a compound light microscope? 100X 1000X 10000X 10X 3. The term [________] refers to the ability to distinguish two adjacent objects as separate and distinct. contrast resolving power brightness magnification 4. Identify the part of the microscope that the arrow is Base Curve Arm Back 5. Identify the part of the microscope that the arrow is pointing to.  Condenser Base Stage Light Source 6. Identify the part of the microscope that the arrow is pointing to. Condenser Fine Focusing Knob Course Focusing Knob Arm 7. What can be used to clean the microscope lenses when they get dirty? Kim wipes Paper towel Tissue Paper Lens paper 8. Put the following steps in the correct order. To prepare a wet mount: 1. Put cover slip onto the slide. 2. Put drop of water onto microscope slide. 3. Take clean microscope slide. 4. Put specimen into the drop of water. all options are correct 3, 1, 2, 4, 3, 2, 4, 1 3, 4, 2, 1 9. How will you be able to differentiate between an organism made up of prokaryotic cells and one made up of eukaryotic cells? Check all that apply. It will not be possible to differentiate between these two cell types. If visible, individual cells will contain a nucleus and organelles, if they are eukaryotic. Individual cells will be smaller in size, relative to eukaryotic cells, if they are prokaryotic. Prokaryotic cells are so small that you will not be able to see them so all organisms must be eukaryotic. 10. If you are observing a prokaryote in the pond water under the 10X objective lens that is 3 ocular micrometers (OMUs) long, what is the size of the organism in µm? 6µm 75µm 25µm 1.5µm 180µm Assignment 1. 1 OMU X 0.025 mm/OMU = 0.025mm/OMU 0.025 X 1000 = 25 μm/OMU 8 OMU X 0.006 mm/OMU = 0.048mm/OMU 0.048 X 1000 = 48 μm/OMU Lab 5 Quiz 1. A P1000 can measure (check all that apply): 900mL 0.3mL 0.09mL 900µl 2. You use PCR to determine if you have the gene responsible for breast cancer. You then run another PCR to see if you have a gene that contributes to the early onset of Alzheimer's. What would be the same in your two PCR reactions? Check all that apply. primers template buffer nucleotides (dNTPs) 3. You use PCR to determine if you have the gene responsible for breast cancer. You then run another PCR to see if you have a gene that contributes to the early onset of Alzheimer's. What would be different in your two PCR reactions? nucleotides buffer primers template DNA 4. PCR involves, in the correct order, annealing, extension, denaturation extension, denaturation, annealing denaturation, extension, annealing denaturation, annealing, extension 5. If you start with 2 copies of a gene and run PCR for 8 cycles, how many copies should you have? 256 (with margin: 0) 1,024 (with margin: 0) 512 (with margin: 0) 64 (with margin: 0) 6. Which protein plays an important role in the PCR technique? DNA polymerase ligase helicase single stranded binding proteins 7. Someone with the genotype tt would have the phenotype mild taster taster none of the options non-taster 8. In humans, how many organelles contain DNA? 2 0  3 1 9. Which of the following would be a reverse primer for the following sequence? 5’- CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGA GGCGGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGATTGCAAACCAAGCCAACCT -3’ 5' - TTCACCAAGAAAACGAAGG - 3' 5' - AGGTTGGCTTGGTTTGC - 3' 5’ - CCTTCGTTTTCTTGGTGAA - 3' 5' - GCAAACCAAGCCAACCT - 3’ 10. Annealing is: the process of rupturing a cell to release its contents. the elongation of a primer (once annealing has occurred) by addition of complementary dNTPs. the separation of paired complementary DNA strands through the application of heat. Heat will disrupt the hydrogen bonds that exist between the complementary base pairs of double stranded DNA. the binding of single-stranded DNA primers to complementary DNA template sequences, once the template DNA has been denatured or is single-stranded. Assignment 1. You need to move 200uL of liquid from your stock solution to an empty centrifuge tube. Describe in detail all the necessary steps required to do this. To move 200 uL of liquid from my stock solution to an empty centrifuge tube, I would first need to get a P200 micropipette and adjust it so that it picks up 200 uL of liquid. I would then attach an appropriate-sized disposable tip to the micropipette and then press the plunger button slowly until the first stop with my thumb, then submerge the tip inside the solution. Then I would release the plunger button and dispense the pipetted volume into an empty centrifuge tube by pressing the plunger to stop 1, then continue to press the plunger all the way to stop 2 to deliver the last drops of liquid. I would label the tube as well and then use the tip ejector button to eject the tip into a waste container. 2. Imagine you are in your BIOA01 lab and your lab partner is using a micropipettor. What actions would cause you step in and advise your lab partner that they are not  following the proper operating procedures when using these instruments? Choose all that apply. Your lab partner is about to use the P20 to pipette 15uL of liquid. Your lab partner dispenses liquid by pressing plunger to the second stop. Your lab partner is about to use the P200 to pipette 250uL of liquid. Your lab partner ejects tips into the designated "used tip" container. Your lab partner is holding the micropipettor horizontally once they have drawn up liquid. Your lab partner does not change the tip of the micropipettor when moving to a different liquid. 3. What volume of liquid would be dispensed by a P200 set to this volume? 125uL 4. What volume of liquid would be dispensed by a P200 set to this volume? 25uL 5. What volume of liquid would be dispensed by a P1000 set to this volume? 250uL 6. What volume of liquid would be dispensed by a P1000 set to this volume? 100uL 7. In your own words describe all of the steps involved in EXERCISE 2: DNA Extraction from Cheek Cells and EXERCISE 3: Amplify Portion of PTC gene with PCR. Include enough detail that someone could use your steps to complete these exercises of Lab Ensure you have provided details that explain: 1. Why do we use Chelex when extracting DNA?  2. Does the pellet or the supernatant include the extracted DNA following Step #13 of Exercise 2? 3. How and when are all five PCR components added to the tubes? 4. What happens to the DNA at each stage of the PCR program? 8. Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAA AGATGGACCCCCACCCACGAGGAGCATCGGCGATAAAGGCTAAAGGTATCATTCAAGAT GCCTCTGCCGACA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCC AACCACGTCTTCAA 3' 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' Lab 6 Quiz 1. Gel electrophoresis separates molecules based on (check all that apply): size DNA fragments separate randomly in a gel. molecular weight nucleotide sequence charge number of base pairs 2. Which of the following best describes a solution after it has been in a centrifuge? the solution is mixed evenly. the solution is separated into a matrix or pellet and a supernatant. the solution must be heated. the solution is shaken. 3. In this experiment, restriction enzymes were used following PCR amplification to cut specific sequences of DNA. True  False 4. If you are heterozygous (Tt) for the PTC gene how many bands will be present in your undigested sample? one two none Three 5. Once you have visualized your gel, if you have multiple bands in your undigested sample this might indicate that (check all that apply): your PCR was unsucessful the sample underwent digestion by restriction enzymes you have contamination your gel electrophoresis was unsuccessful 6. If you are homozygous recessive for the PTC gene what size band(s) will be present in your digested sample? 221 bp 441 bp 177 bp 44 bp 7. What is true regarding faint bands that run below the 44 bp band? Check all that apply. they indicate that your digestion with restriction enzymes was successful they are called primer dimers they indicate that your PCR was successful they are the results of primers amplifying themselves 8. Analyze the image below. If this was your genotype, what phenotype would you conclude that you were based on these results? taster tt nontaster  Tt 9. The [ Select ] of [ Select ] explains that during gamete formation, only one allele for each gene goes a particular gamete. Principle of segregation 10. If in todays' experiment, your results were as follows which alleles would you conclude were recessive? yellow and smooth purple and wrinkled yellow and wrinkled purple and smooth Assignment 1. If two individuals that are tasters (both homozygous) had a child, what is the probability of the child being taster? 25% 50% 75% 100% 2. If an individual that is a non-taster had a child with a taster (heterozygous), what is the probability that the child will be a non-taster? 100% 50% 0% 25% 3. If two individuals that are non-tasters had a child, what is the probability of the child being a non-taster? 100% 25% 50% 75%  4. After completing Exercise 5: Investigating Mendelian Inheritance by Phenotyping Corn Kernels, select all statements that are true. Smooth is a dominant trait. Yellow is a dominant trait. Purple is a recessive trait. In a cross of two purple parents with the genotype (Pp), 1/4 of the offspring will be yellow kernels. Wrinkled is a recessive trait. 5. You amplify a fragment of your PTC gene and use the restriction enzyme HaeIII to determine your PTC genotype. After the restriction enzyme digest you use gel electrophoresis and see the following band(s) on a gel, match the results to a statement that accurately describes the observed results. Two bands are visible at approximately 221bp and 44bp - The genotype of the individual is tt One bands is visible at 44bp - This is the primer dimer Two bands are visible at approximately 221bp and 177bp - The genotype of the individual is Tt There are no visible bands - The reaction was missing a component required for PCR amplification 6. This question and the following 2 questions will relate to the following information! Here is the sequence for the gene that is responsible for purple kernel colour in corn: 5'-T A G A A A A G G A A G G T G G C T T C T G A T G C C T C T G C C G A C A G T G G TCCCAAAGATATCCCCCACCCACGAGGATCCAACCACGTCTT C A A -3' If this gene has the following sequence instead, no protein will be produced that will allow the cells to produce the purple pigment. If a kernel of corn is homozygous for this gene variant, then the kernel will be yellow: 5'-T A G A A A A G G A A G G T G G C T T C T G A T G C C T C T G C C G A C A G T G G TCCCAAAGAAATCCCCCACCCACGAGGATCCAACCACGTCTT C A A -3' The restriction enzyme EcoRV is known to cleave DNA at the following restriction site: You will need to go through the steps of designing an experiment to determine what the genotype of a purple kernel of corn is. One way to begin is to perform a PCR of the DNA from a purple kernel of corn so there is plenty of DNA to work with in your experiment. Which of the following sets of primers would be used for amplify our sequence of interest? 5'-TAGAAAAGGAAGGTG-3' and 5'-TTGAAGACGTGGTTG-3' 5'-TGAAAAAGGAAGGTG-3' and 5'-TGTAAGACGTGGTTG-3' 5'-ATCTTTTCCTTCCAC-3' and 5'-AACTTCTGCACCAAC-3' 5'-TAGAAAAGGAAGGTGC-3' and 5'-TTGAAGACGTGGTTGC-3' 7. While doing your DNA extraction and PCR for the experiment mentioned in the previous question, select all of the following statements that are true: We isolate DNA from aboth yellow and purple kernels together Impurities such as Mg2+ would be removed using Chelex We add only our sample DNA to our PCR tube for a successful PCR reaction We use a thermal cycler to amplify our target DNA We use a 37 degree water bath to lyse the corn cells open 8. Once you've amplified your sequence of interest, you can introduce the restriction enzyme EcoRV (described above) to cut your DNA to help identify its genotype. Match the following genotypes with the number and size of bands you would expect to see for each. Homozygous dominant - Two bands: one 51bp and one 35bp Heterozygous - Three bands: one 86bp, one 51bp and one 35bp Homozygous recessive (yellow kernels) - One band: 86bp