Frequency of sea and ica genes in bacteria from watery sources of Basrah governorate, University of Basrah, 2023/2024 PDF

University of Basrah College of Science Department of Biology Frequency of sea and ica genes in bacteria from watery sources of Basrah governorate A research submitted to the Department of biology in partial fulfilment of the requirements for the degree of...

University of Basrah College of Science Department of Biology Frequency of sea and ica genes in bacteria from watery sources of Basrah governorate A research submitted to the Department of biology in partial fulfilment of the requirements for the degree of Bachelor's in Microbiology By Wafiq Yasin Ismael Supervised By Prof. Dr. Munaff Jawdat Abd-Al Abbas 2023/2024  ‫بسم هللا الرحمن الرحيم‬ ‫ك لذي لع ْ ٍْل عَ لل ٌمي﴾‬ ‫﴿نَ ْرفَ ُع د ََر َج ٍ‬ ‫ات َّمن ن َّ َشا ُء ۗ َوفَ ْو َق ُ ل ُ‬ ‫صدق هللا العلي العظيم‬ ‫سورة يوسف‪ ،‬االية (‪)76‬‬ ‫‪2‬‬  Dedication In the vast sea of knowledge, my journey is begins. To Allah's Remnnant on His earth, the avenger of His enemies, AL-IMAM AL-MAHDI. To my hidden star, which has left me since I was a child, My late Mother. I dedicate this research. Wafiq 3  Acknowledgments First, thank to Allah for his kindness and care, he was help me by sending me the right people in the right time. I would like to express my gratitude to my supervisor Professor Dr. Munaff Jawdat Abd Al-Abbas for suggesting the research idea and providing valuable advice during the writing process. I extend my heartfelt thanks to Dr. Zeana Hashim Abd Al- Wahid for her help in the laboratory work. Finally, thank to my eyes and my back for their steadfastness during those long nights I spent on the chair facing the computer screen and working on this research. They are great blessings from Allah. 4 Abstract Due to the increasing use of plastic pipes and tanks to trsnsport and store water which are using locally for drinking or washing, the study aimed to search for enterotoxin-producing bacteria in home tap water, RO drinking water and home storage tanks of Basrah governorate. The results showed that 46% of totally bacteria from the three watery sources were positive for sea gene (enterotoxin encoding gene): 55.8% from home tap water, 39.3% from RO drinking water and 40.9% from home storage tanks. Ica operon (encoding for intercellular adhesion) was detected totally in 14.6% of bacteria from the three sources: 5.8% from home tap water, 15.1% from RO drinking water and 27.2% from home storage tanks. There were four samples that were positive for both sea gene and ica genes: 32-67A and E. coli from home tap water, 51-Acinetobacter junii from RO drinking water and 17-Kluyvera georagiana from home storage tanks. 5 Introduction Exotoxins are a group of soluble proteins that are secreted by some members of both Gram-negative and Gram-positive bacteria(Barbieri, 2009). These proteins generally consists of tow polypeptide, one is responsible for binding the protein to the host cell and the other is responsible for the toxic effect (Hrvey et al., 2012). Enterotoxins are class of exotoxins that effects on the intestinal epithelium and stimulate hypersecretion of water and electrolytes from it producing watery diarrhea. In addition, enterotoxins considered as superantigen which can stimulate large populations of T-cells and causes toxic shock syndrome toxin (TSST-1), therefore, enterotoxins cauces high secreted of T-cell cytokines such as interleukin-2 (IL-2), interferon-ƴ (IFN- ƴ) and tumor necrosis factor- α (TNF- α). (Baron., 1996; Hrvey et al., 2012; G Abril et al., 2020). genes encoding SEs are mostly mobile genetic elements. sea gene, encoding enterotoxin A is carried by a family of a temperate phages (Haghi et al., 2021; Betley and Mekalanos, 1985; Coleman et al., 1989). Therefore, it perhsps transport horizontaly to others genetically close bacterial species and transformed them from non-pathogenic to pathogenic (Ingmer et al., 2019). enterotoxin that encoding by sea is highly stable with standing the activity of most protolytic enzymes and resistance to extreme conditions (Wu et al., 2016; Denayer et al., 2017; Schwan., 2019).The enterotoxin has been detected in S. aureus from several sources including food and clinical sample, S. hominis, S. xylosus, S. epidermidis, S. haemolyticus and S. saprophyticus (Haghi et al., 2021; Cunha et al., 2006; Pinheiro et al., 2015; Nasaj et al., 2020; Banaszkiewicz et al., 2022). There are suggested that SAgs produced by Staphylococcus aureus might contibute to the pathogenesis of noninfectious diseases by activating T cells that are specific for self-antigens such as Kawasaki' s disease (KD) and autoimmune disease (Thomas et al., 2007). 6 Biofilm is a community of microorganisms adhering to a surface and surrounded by a complex matrix of extracellular-polymeric substances including proteins and polysaccharides (Bridier et al., 2011). Bacteria in biofilms can employ several survival strategies to evade the host defense systeme by staying dormant and hidden from the immune system, they may cause local tissue damage and later cause an acute infection, bacteria adapt to environmental anoxia and nutrient limitation by exhibiting an altered metabolism, gene expression, and protein production which can lead to a lower metabolic rate and a reduced rate of cell division. (Hall-Stoodley and Stoodley., 2009). these adaptations make the bacteria more resistant to antimicrobial therapy by inactivating the antimicrobial targets or reducing the requirements for the cellular function that the antimicrobials interfere with (Donlan and Costerton., 2002). During a biofilm infection, simultaneous activation of both innate and acquired host immune responses may occur, neither of which are able to eliminate the biofilm pathogen but instead accelerate collateral tissue damage (Moser et al., 2017). Consequently, biofilm-related diseases are typically persistent infections developing slowly, rarely resolved by the immune system and respond inconsistently to antimicrobial treatments (Vestby et al., 2020). There are three major stages for biofilm formation: Attachment, Maturation and Dispersion (Figure 1). First, bacteria must be close enough and attach to the surface then the bacteria begin to adhere to the surface through weak Vander Wall' s forces between bacterial cell and the surface, in this step flagella and type IV pili-mediated motilities are important. Flagella are important for initial interactions between bacteria and surface by aggregation of the attached cells microcolonies. (O'Toole and Kolter, 1998; Sutherland, 2001a; Palmer et al., 2007). 7 The genes encoding for intercellular adhesion is ica operon. This operon composed of four open reading frames icaA, icaD, icaB and icaC (Gerke et al., 1998) icaR is a regulator that located up stream of the icaA start codon and controlling the ica A,DBC transcription (Conlon et al., 2002) icaA is responsible of N-acetylglucosaminyl-transferase activity while icaD directs the correct folding of the membrane insertion of icaA and may act as a link between icaA and icaC (Gerke et al., 1998) icaB is deacetylase enzyme that responsible of deacetylation of mature PIA (Vuong et al., 2004). The transmembrane protein icaC is responsible of elongation of the growing polysaccharide (Rohde et al., 2007). icaR is a repressor that stop ica expression by binding to the icaA promoter region (Jefferson et al., 2004). Figure 1: Biofilm formation stages (Rabin et al., 2015) 8 Methods and Materials Eighty nine DNA samples were collected from different watery sources in Basrah governorate and identified previously by Abd Al-Wahid and Abd Al-Abbas (2019). This samples were tested for sea, icaA and icaD genes by polymerase chain reaction(PCR)(Applied Biosystem). Amplification of sea gene The PCR primers, reagents and program were in Table (1, 2 and 3). Table (1): sea gene primers and the size of their product. ( Omoe et al., 2005: Haghi et al., 2021) Primers Sequence of primers Size of product Sea Forward CCTTTGGAAACGGTTAAAACG 127bp Sea Reverse TCTGAACCTTCCCATCAAAAAC Table (2): Reagent (25 µl) of PCR for amplifying sea gene Reagent Volume (µl) Go taq green master mix 12 DNA template 1 Primer forward 1 Primer reverse 1 Nuclease free water 10 Total volume 25 9 Table (3): Thermal cycler program of sea gene amplification Stage Temperature Time Cycles Initial denaturation 94° C 5 min 1 Denaturation 94° C 35 sec Annealing 55° C 35 sec 35 Extention 72° C 35 sec Final extention 72° C 10 min 1 Socking 4° C Amplification of ica genes The PCR primers, reagents and program were in Table (4, 5, 6 and 7). Table (4): icaA primers and the size of their product (Arciola et al., 2001) Primers Sequence of primers Size of product icaA Forward TCTCTTGCAGGAGCAATCAA 188bp icaA Reverse TCAGGCCACTAACATCCAGCA Table (5): icaD primers and the size of their product (Arciola et al., 2001) Primers Sequence of primers Size of product icaD Forward ATGGTCAAGCCCAGACAGAG 198bp icaD Reverse CGTGTTTTCAACATTTAATGCAA 10 Table (6): Reagent (25 µl) for icaA or icaD genes amplification Reagent Volume (µl) Go taq green master mix 12 DNA template 1 Forward primer 1 Reverse primer 1 Nuclease free water 10 Total volume 25 Table (7): Thermal cycler program of icaA or icaD genes Stage Temperature Time Cycles Initial denaturation 94° C 5 min 1 Denaturation 94° C 30 sec Annealing 55.5° C 30 sec 50 Extention 72° C 30 sec Final extention 72° C 1 min 1 Socking 4° C 11 Results The bands of sea gene in agarose gel electrophoresis are showed in Figure (2), icaA bands in Figure (3) and icaD bands in Figure (4). The results in table (8, 9 and 10) swowed that sea gene was totally detected in 46% of the bacteria from the three sources: 55.8% from home tap water, 39.3% from RO drinking water and 40.9% from home storage tanks. In general sea gene was detected in 9 of 32-67A-40Z-82B- 99A-80A-15-48B-95A-E. coli (10.1%), 4 of 47A-94B-22-95B-Klebsiella pneumonia (4.4%), 3 of 79-96A-89A-Enterobacter ludwigii (3.3%), 2 of 1Z-16-Enterobacter cloacae (2.2%), 2 of 91-92-Kluyvera cryocresceus (2.2%), 2 of 93-24B-Pseudomonas aeruginosa (2.2%), 1 of 9A- Enterobacter xiangfargenesis (1.1%), 1 of 21A-Pseudomonas spp (1.1%), 1 of 85-Escherichia fergasonii (1.1%), 1 of 21-Aeromonas jundii (1.1%), 1 of 44A-Acinetobacter pittii (1.1%), 1 of 51-Acinetobacter junii (1.1%), 1 of 69-Pseudomonas otitidis (1.1%), 1 of 96C-Leclercia adecarboxylata (1.1%), 1 of 17-Kluyvera georagiana (1.1%), 1 of 59A-Pseudomonas putida (1.1%), 1 of 59B-Pantoea agglomerans (1.1%), 1 of 66- Enterobacter homaechei (1.1%) and others 7 of 43B-53B-18-44-55A-61B- 67B-Unidentified (7.8%). Ica operon (icaA and/or icaD) was detected (14.6%) in totally bacteria from the three sources: 5.8% from home tap water, 15.1% from RO drinking water and 27.2% from home storage tanks. Generally, icaA and/or icaD were in 4 of 32-67A-39B-46A-E. coli (4.4%), 1 of 15B- Coronobacter sakazakii (1.1%), 1 of 49-Enterobacter ludwigii (1.1%), 1 of 51-Acinetobacter junii (1.1%), 1 of 41C-Enterobacter cancerogenus (1.1%), 1 of 38-Klebsiella oxytoca (1.1%), 1 of 17-Kluyvera georagiana (1.1%), 1 of 41C-Acinetobacter calcoaceticus (1.1%) and others 2 of 48A- 41-Unidentified species (2.2%). 12  7 6 5 4 3 2 1 1500bp 500bp 127bp 300bp 200bp 127bp 100bp Figure 2: bands of sea gene in electrophoresis (1.5%). Lan 1: Ladder (1500bp). Lan 2,3,4,5,6 and 7: positive at 127bp 7 6 5 4 3 2 1 1500bp 500bp 188bp 188bp 300bp 200bp 100bp Figure 3: bands of icaA gene in electrophoresis (1.5%). Lan 1: Ladder (1500bp). Lan 2, 3, 4, 5, 6 and 7: positive at 188bp. 13  6 5 4 3 2 1 1500bp 500bp 189bp 198bp 300bp 200bp 100bp Figure 4: bands of icaD gene in electrophoresis (1.5%). Lan 1: Ladder (1500bp). Lan 5 and 6: positive at 198bp. 14 Table (8): Frequency of sea gene and ica genes in bacteria isolated from home tap water No Bacterial species sea icaA and/or icaD n(%) n(%) 1 21A-E. coli - - 2 32-E. coli* + + 3 36-E.coli - - 4 47B-E. coli - - 5 63-E. coli - - 6 67A-E. coli* + + 7 40Z-E.coli + - 8 82B-E.coli + - 9 99A-E. coli + - 10 80A-E.coli + - 11 6-Klebsiella pneumonia - - 12 33-Klebsiella pneumonia - - 13 47A-Klebsiella pneumonia + - 14 94B-Klebsiella pneumonia + - 15 1Z-Enteribacter cloacae + - 16 53A-Eterobacter cloacae - - 17 16-Enterobacter cloacae + - 18 21B-Pseudomonas spp + - 19 29-Pseudomonas spp - - 20 40B-Pseudomonas spp - - 21 9A-Enterobacter xiangfarigensis + - 22 11-Pseudomonas otitidis - - 23 50A-Enterobacter homaechei - - 24 85-Escherichia fergasonii + - 25 73-Aeromonas sobria - - 26 76-Aeromonas hydrophila - - 27 94A-Coronobacter sakazaki - - 28 21-Aeromonas jundii + - 29 89A-Enterobacter ludwigii + - 30 93-Pseudomonas aeruginosa + - 31 67B-Unidentified + - 32 43B-Unidentified + - 33 53B-Unidentified + - 34 43A-Unidentified - - Total n(%) 19(55.8) 2(5.8) *= Contains both sea gene and ica genes 15 Table (9): Frequency of sea gene and ica genes in bacteria from drinking water(RO) No Bacterial species sea icaA and/or icaD n(%) n(%) 1 15-E. coli + - 2 37A-E. coli - - 3 86-E. coli - - 4 45-E. coli - - 5 65C-E. coli - - 6 90-E. coli - - 7 3A-Enterobacter ludwigii - - 8 49-Enterobacter ludwigii - + 9 79-Enterobacter ludwigii + - 10 96A-Enterobacter ludwigii + - 11 14A-Coronobacter sakazakii - - 12 15B-Coronobacter sakazakii - + 13 20-Klebsiella pneumonia - - 14 30A-Klebsiella pneumonia - - 15 65A-Acinetobacter junii - - 16 51-Acinetobacter junii* + + 17 3B-Enterobacter homaechei - - 18 7-Enterobacter cloacae - - 19 12-Aeromonas veronii - - 20 23-Aeromonas jandaei - - 21 24B-Pseudomonas aeruginosa + - 22 26-Pseudomonas spp - - 23 44A-Acinetobacter pittii + - 24 69-Pseudomonas otitidis + - 25 91-Kluyvera cryocresceus + - 26 96C-Leclercia adecarboxylata + - 27 24A-Enterobacter cancerogenus - + 28 38-Klebsiella oxytoca - + 29 18-Unidentified + - 30 30B-Unidentified - - 31 44-Unidentified + - 32 55A-Unidentified + - 33 61B-Unidentified + - Total n(%) 13(39.3) 5(15.1) *= Contains both sea gene and ica genes 16 Table (10): Frequency of sea gene and ica genes in bacteria isolated from home storage tanks No Bacterial species sea icaA and/or icaD n(%) n(%) 1 39B-E. coli - + 2 86-E. coli - - 3 46A-E. coli - + 4 48B-E. coli + - 5 78-E. coli - - 6 95A-E. coli + - 7 27A-Klebsiella pneumonia - - 8 35-Klebsiella pneumonia - - 9 22-Klebsiella pneumonia + - 10 95B-Klebsiella pneumonia + - 11 10-Pseudomonas mosselii - - 12 2-Pseudomonas otitidis - - 13 17-Kluyvera georagiana* + + 14 41C-Acinetobacter calcoaceticus - + 15 59A-Pseudomonas putida + - 16 59B-Pantoea agglomerans + - 17 66-Enterobacter homaechei + - 18 68-Aeromonas veronii - - 19 92-Kluyvera cryocresceus + - 20 46-Unidentified - - 21 48A-Unidentified - + 22 41-Unidentified - + Total n(%) 9(40.9) 6(27.2) *= Contains both sea gene and ica genes Importantly, the species positive for both sea gene and ica genes were 2 of 32-67A-E. coli from home tap water, 1 of 51-Acinetobacter junii from RO drinking water and 1 of 17-Kluyvera georagiana from home storage tanks. 17 Discussion The importance of the present study was in the frequency of enterotoxin-producing bacteria of the three watery sources, revealing the toxin to find the route to inter the human abdomen causing a very infection (Ortega et al., 2010), specially to those isolates from RO drinking water. However drinking water must be free of pathogenic bacteria or their toxins because they are used daily by humans for washing and drinking. In addition, the presence of enterotoxin gene (sea) and adhesion genes (icaA and/or icaD) together in the bacteria isolated from the three sources are enhance their morbidity by making bacteria able to adhere and grouped on the walls of the water pipes or plastic tanks that are widely used locally. Therefore, bacteria in this case can secrete High concentrations of enterotoxin than if it were as a single cells. 18 References Abd Al-Wahid, Z. H. and Abd Al-Abbas, M. J. (2016). Detection of E.coli Strains Isolated from water sources and diarrhea cases by Random Amplified polymorphic DNA in basrah Governorate. International Journal of Sciences, 8(3), 68-83. Arciola, C. R., Lucilla Baldassarri, L. and Montanaro, L. (2001). Presence of icaA and icaD Genes and Slime Production in a Collection of Staphylococcal Strains from Catheter-Associated Infections. J. Clin. Microbiol. 39 (6): 2151–2156. Barbieri, J. T., (2009) Encyclopedia of Microbiology, Third Edition. University of Texas Medical Branch at Galveston. Baron, S., (1996). Medical Microbiology, 4th edition. Editor-in-Chief: Moselio Schaechter. Banszkiewicz, S., Walecha-Zacharska, E., Schubert, J., Tabis, A, Krol, J., Stefaniak, T., Wesierska, E., and Bania, J. (2022). Staphylococcal enterotoxin genes in coagulase-negative Staphylococci-stability, expression and genomic context. International journal of molecular sciences, 23(5), 2560. Betley, M.J., and Mekalanos, J.J., (1985). Staphylococcal enterotoxin A is encoded by phage. Science 229: 185-187. Bridier, A., Briandet, R., Thomas, V. and Dubois-Brissonnet, F. (2011). Resistance of bacterial biofilms to disinfectants: a review. Biofouling, 27, 1017-1032. Coleman, D. C., Sullivan, D. J., Russel, R. J., Arbuthnott, J. B., Carey, B. F. and Pomeroy, H. M., (1989). Staphylococcus aureus bacteriophages mediating the simultaneous lysogenic conversion of δ-lysin, Staphylokinase and enterotoxin A: molecular mechanism of triple conversion. J. Gen. Microbiol. 135: 1679-1697. 19 Conlon, K. M., Humphreys, H. and O'Gara, J. P. (2002). icaR encodes a transcriptional repressor involved in environmental regulation of ica operon expression and biofilm formation in Staphylococcus epidermidis. Journal of bacteriology, 184, 4400-4408. Cunha, M. D. L. R. D. S. D., President, E., Calsolari, R. A. O., and Araújo júnior, J. P. (2006). Detection of enterotoxin genes in coagulase- negative Staphylococci isolated from foods. Brazilian Journal of Microbiology. 37: 70-74. Denayer, S., Delbrassinne, L., Nia, Y. and Botteldoorn, N. (2017). Foodborne outbreak investigation and molecular typing: high diversity of Staphylococcus aureus strains and importance of toxin detection. Toxins, 9(12), 407. Donlan, R. M. and Costerton, J. W. (2002). Biofilms: survival mechanisms of clinically relevant microorganisms. Clinical microbiology reviews, 15(2), 167-193. G Abril, A., G Villa, T., Barros- Velázquez, J., Cañas, B., Sánchez- Pérez, A., Calo- Mata, P. and Carrera, M., (2020), Staphylococcus aureus Enterotoxins and their Detection in Dairy Industry and Masitits, Toxins, 12(9), 537. Gerke, C., Kraft, A., Süßmuth, R., Schweitzer, O. and Götz, F. (1998). Characterization of theN-Acetylglucosaminyltransferase Activity Involved in the Biosynthesis of the Staphylococcus Epidermidis Polysaccharide Intercellular Adhesin. Journal of Biological Chemistry, 273, 18586-18593. Haghi, F., Zeighami, H., Hajiloo, Z, Torabi, N. and Derakhshan, (2021). High frequency of enterotoxin encoding genes of Staphylococcus aureus isolated from food and clinical samples. Journal of health population and nutrition, 40(1), 27. Hall‐Stoodley, L. and Stoodley, P. (2009). Evolving concepts in biofilm infections. Cellular microbiology, 11(7), 1034-1043. 20 Harvey, R. A., Cornelissen, C. N. and Fisher B. D. (2012). Microbiology, Third Edition. Lippincott. Ingmer, H., Gerlach, D. and Wolz, C. (2019). Temperate Phages of Staphylococcus aureus. Microbiology spectrum, 7(5), 10.1128. Jefferson, K. K., Pier, D. B., Goldmann, D. A. and Pier, G. B. (2004). The teicoplanin-associated locus regulator (TcaR) and the intercellular adhesin locus regulator (IcaR) are transcriptional inhibitors of the ica locus in Staphylococcus aureus. Journal of bacteriology, 186, 2449- 2456. Moser, C., Pedersen, H. T., Lerche, C. J., Kolpen, M., Line, L., Thomsen, K. and Jensen, P. Ø. (2017). Biofilms and host response–helpful or harmful. Apmis, 125(4), 320-338. Nasai, M., Saeidi, Z., Tahmasebi, H., Dehbashi, S., and Arabestani, M. R. (2020). Prevalence and distribution of resistance and enterotoxin/enterotoxin-like genes in different clinical isolates of coagulase- negative Staphylococcus. European journal of medical research, 25, 1-11. Omoe, K., Hu, D. L., Takahashi-omoe, H., Nakane, A. and Shinagawa, K. (2005). Comprehensive analysis of classical and newly described Staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol Lett, 246(2), 191- 198. Ortega, E., Abriouel, H., Lucas, R. and Gálvez, A. (2010). Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins, 2(8), 2117–2131. O'Toole, G. A. and Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Molecular microbiology, 30, 295-304. 21 Palmer, J., Flint, S. and Brooks, J. (2007). Bacterial cell attachment, the beginning of a biofilm. Journal of industrial microbiology biotechnology, 34, 577-588. Pinheiro, L., Brito, C. I., de Olivera, A., Martins, B. Y., Pereira, V. C., and da Cunha, M.del. (2015). Staphylococcus epidermidis and Staphylococcus haemolyticus: Molecular detection of cytotoxin and enterotoxin genes. Toxins. Rabin, N., Zheng, Y., Opoku-Temeng, C., Du, Y., Bonsu, E. and Sintim, H. O. (2015). Biofilm formation mechanisms and targets for developing antibiofilm agents. Future Medicinal Chemistry, 7, 493-512. Rohde, H., Burandt, E. C., Siemssen, N., Frommelt, L., Burdelski, C., Wurster, S., Scherpe, S., Davies, A. P., Harris, L. G. and Horstkotte, M. A. (2007). Polysaccharide intercellular adhesin or protein factors in biofilm accumulation of Staphylococcus epidermidis and Staphylococcus aureus isolated from prosthetic hip and knee joint infections. Biomaterials, 28, 1711-1720. Schwan, W. R. (2019). Staphylococcus aureus Toxins: armaments for a significant pothogen. Toxins. 11(8), 457. Sutherland, I. W. (2001). Biofilm exopolysaccharides: a strong and sticky framework. Microbiology, 147, 3-9. Thomas, D., Chou, S., Dauwalder, O., and Lina, G. (2007). Diversity in Staphylococcus aureus enterotoxins. Chemical immunology and allergy, 39, 24-41. Vestby, L. K., Grønseth, T., Simm, R. and Nesse, L. L. (2020). Bacterial Biofilm and its Role in the Pathogenesis of Disease. Antibiotics (Basel, Switzerland), 9(2), 59. Vuong, C., Kocianova, S., Voyich, J. M., Yao, Y., Fischer, E. R., DeLeo, F. R. and Otto, M. (2004). A crucial role for exopolysaccharide modification in bacterial biofilm formation, immune evasion, and virulence. Journal of Biological Chemistry, 279, 54881-54886. 22 Wu, S., Duan, N., Gu, H., Hao, L., Ye, H., Gong, W. and Wang, Z. (2016). A Review of the methods for detection of Staphylococcus aureus enterotoxins. Toxins, 8(7), 176. 23