Transcription, Translation, and Protein Trafficking Lecture Notes PDF

Transcription, translation, and protein trafficking Bryan C. Bjork, Ph.D. [email protected] Department of Bioch...

Transcription, translation, and protein trafficking Bryan C. Bjork, Ph.D. [email protected] Department of Biochemistry & Molecular Genetics IBSSD 1511/1520: Module 3, Lectures 2 & 3 Sept. 24, 2024 Recommended Reading: Illustrated Reviews: Cell and Molecular Biology, Chapters 8, 9 and 11, and Lippincott's ILLUSTRATED REVIEW OF BIOCHEMISTRY, 8th edition, by Abali, Cline, Franklin, and Viselli (2021) Chapter 30 & 31.  Introduction Gene expression begins with transcription of DNA into RNA How does RNA differ from DNA? - ribose instead of 2-deoxyribose - uracil instead of thymine - single stranded Are all RNAs translated into proteins? - NO; both protein-coding RNAs (mRNAs) and functional non-coding RNAs (e.g., rRNAs) Translation of mRNAs into proteins is the next step in gene expression and follows a specific genetic code Trafficking of proteins to their final destination is necessary to ensure their proper function I. TRANSCRIPTION  I.A. Types of RNA molecules 4 major classes of RNA: ribosomal RNA (rRNA) - ~80% long non-coding RNA (lncRNA) transfer RNA (tRNA) - ~15% - sense & antisense RNA (asRNA) messenger RNA (mRNA) - ~ 5% microRNA (miRNA)  Ribosomal RNA or rRNA Non-coding functional RNAs Synthesized in nucleolus Typically many copies per genome  in humans: 300-400 copies (chr 13, 14, 15, 21, & 22) Four eukaryotic rRNAs: 28S, 18S, 5.8S and 5S Associate with proteins to form ribosomes  Required for protein synthesis rRNAs account for ~80% of total RNA  Transfer RNA or tRNA Non-coding functional RNAs Synthesized in nucleus Each tRNA carries a specific amino acid  at least one specific tRNA for each of the 20 amino acids Required for protein synthesis Site of amino acid attachment Makes up ~15% of total RNA Anticodon  Messenger RNA or mRNA Protein-coding RNAs Synthesized in nucleus “Genetic information carriers”  relay information from nucleus to cytosol Also referred to as “transcripts” Very heterogeneous in size and sequence Represent only ~5% of total RNA  MicroRNA or miRNA Non-coding functional RNAs ~22 nucleotides in length Generally bind to 3’UTR of specific mRNAs Regulate gene expression by repressing protein production or triggering mRNA degradation Partial homology = post-transcriptional control of expression Perfect match = mRNA degradation by cleavage  I.B. Gene structure Transcriptional Start Site (+1) Gene: minimum sequence of DNA required to encode for proteins and functional RNAs Normally contains: Promoter coding exons non-coding introns regulatory sequences (5’ and 3’ ends) Sequence usually read from 5’ to 3’ (left to right) -- upstream vs. downstream  Consensus sequences - promoter Highly conserved DNA sequences that are bound by proteins Cis-acting elements – DNA sequences involved in controlling gene expression via protein-DNA interactions (e.g., TATA box, CAAT box, others) Trans-acting elements – Proteins that bind cis-acting DNA sequences (e.g., transcription factors  Promoter region Determines the site of initiation of RNA synthesis Transcriptional start site (+1): RNA transcript begins Promoter regions: upstream of start site Often contains a TATA box or other core promoter elements - facilitate binding of general TFs and recruitment of RNA polymerase II Often an upstream CAAT box GC box and other transcription factor binding sites Splice acceptor and donor consensus sequences Delineate introns from exons found at 5’ and 3’ ends of introns required for removal of introns out of primary transcript In pre-mRNA sequence: introns nearly always AG GU begin with GU=splice donor site introns nearly always end with AG=splice acceptor site  I.C. Transcription – Basics of RNA synthesis Occurs in nucleus Follows boundaries of transcribed gene Genomic template: 3’-to-5’ DNA strand The new RNA molecule: single-stranded and contains uracil grows in 5’-to-3’ direction complementary to template strand  I.C.1. RNA polymerases DNA-dependent enzymes Read DNA in 3’-to-5’ direction Proof-reading activity Type of RNA Cellular RNA polymerase synthesized localization 45S precursor rRNA (cleaved to RNA polymerase I Nucleolus produce 28S, 18S and 5.8S) RNA polymerase II All mRNAs and Nucleus miRNAs tRNAs and 5S Nucleus RNA polymerase III rRNA  From gene to mRNA +1 Coding sequence 5 5’ UTR exon intron exon intron exon 3’ UTR poly(A) signal  I.C.2. Sequence features of a typical mRNA +1 Coding sequence 5 5’ UTR exon intron exon intron exon 3’ UTR poly(A) signal Exons: protein coding region – part of final protein product Introns: non-coding region – removed prior to translation 5’ and 3’ UTRs: untranslated regions – in DNA sequence Polyadenylation signal: the polyadenylation site signals addition of many adenosine ribonucleotides to the 3’ end of an mRNA following transcription important for stability of mRNA and efficiency of translation not part of final protein product The main point of control for gene expression is the initiation of transcription Regulation of gene expression: Complexity within the Central Dogma of molecular biology I.C.3 Regulation of gene expression: Frequency of transcription initiation Epigenetics – chromatin remodeling RNA Stability RNA Processing Protection from degradation Alternative splicing/promoter/polyA signal usage Translational control Post-translational control Effects of mutations  I.C.4. Upstream regulatory regions (5’ of TSS) Basal or core promoter: elements required for background or default level of expression in all cells.  next to transcriptional start site (TSS) STFs Protein/DNA interactions at: TATA box (proximal element): specifies start site and ensures fidelity of TBP initiation  bound by general transcription factors TFIID CAAT or GC boxes (upstream sequences): determine frequency of transcription initiation  bound by specific transcription factors (CTF, CTF SP1)  I.C.4. Upstream regulatory regions (5’ of TSS) Enhancers/ repressors (cis-acting):  regulated expression to refine basal gene expression  Often found far away from TSS (up to Mbs away) Protein factors (Trans-acting) bind DNA at these sites to: Increase or decrease rate of transcription initiation Confer temporal- and/or tissue-specific regulation Facilitate epigenetic changes Position-independent (upstream or downstream) of promoter Orientation-independent (on either DNA strand)  Trans-acting transcriptional activators or repressors Protein-protein and protein-DNA interactions connect enhancers or silencers with the promoter often via DNA bending and looping. Appropriate modulation of gene expression for different cell types in response to environmental cues or at the correct time in development. Input of multiple STFs binding to different cis-regulatory and promoter elements and other transcriptional cofactors allow fine-tuning of cell-type specific gene expression levels and timing. Steps in mRNA synthesis by RNA pol II *** Chromatin must be opened *** Chromatin remodeling proteins (i.e., Histone acetyltransferases) + ATP Exposes promoter for initiation of transcription Step 1: Transcription Initiation: assembly of preinitiation complex recruitment of RNA polymerase II (RNAP) local unwinding of DNA A. Binding of TATA-binding A protein (TBP) and recruitment of TFIID B. Binding of other general TFs, recruitment of RNAP, local B RNAP unwinding of DNA C. Synthesis of short transcript, C phosphorylation of RNAP tail RNAP and release of RNAP from the PC STEP 2: Elongation: local unwinding of DNA by RNAP movement of RNAP along template strand rewinding of DNA following passage of RNAP Creation of transcript in 5’-to-3’ direction STEP 3: Termination: when RNAP encounters a stop signal (AATAAA in DNA) release of enzyme and transcript Are we done? What else is required for mRNAs to be translated into protein?  I.D. Processing of pre-mRNA First transcript produced is larger than final mRNA product.  primary transcript, pre-mRNA, or heterogeneous nuclear RNA (hnRNA) RNA processing occurs in nucleus prior to export: addition of 5’ cap addition of poly(A) tail splicing of introns  I.D.1. Addition of 5’ cap Modified guanine nucleotide (5’-m7Gp) is added to 5’ end of transcript shortly after the start of transcription protects against degradation facilitates binding of mRNA to ribosomes during protein synthesis  I.D.2. Addition of poly(A) tail Polyadenylation signal: AAUAAA (3’ end of pre-mRNA) recognized by endonuclease mRNA cleaved ~20 nucleotides downstream serves as template for addition of up to 250 adenosines (A) = poly(A) tail Important for nuclear export, translation, and stability of mRNAs  I.D.3. Splicing of introns Three-step process leading to removal of introns Requires assembly of spliceosome Spliceosome = pre-mRNA + 5 small nuclear RNAs and proteins (snRNPs) + ~ 50 proteins Splicing of introns Splice donor and acceptor sites Branch site (-OH of Adenosine) Step 1: Spliceosome recognizes splice donor and acceptor sites Ends of intron brought together Splicing of introns Step 2: Hydroxyl group of branch site Adenosine attacks donor site  intron cleaved at 5’ end (splice donor end)  Formation of phosphodiester bond and lariat-like structure Splicing of introns Step 3: Cleaved 3’ end of exon 1 attacks the 5’ end of exon 2 Intron removed and exon ends joined by phosphodiester bond Spliceosome disassembled Mature mRNA formed Export of mature mRNA: nuclear pores Prokaryotes Eukaryotes Which nucleotide sequence would result from transcription of the following double-stranded DNA sequence? 5’–GATTCGAAGCT–3’ 3’–CTAAGCTTCGA–5’ A.5’–CTAAGCUUGCT–3’ B.5’–GATTCGAAGCT–3’ C.5’–UCGAAGCUUAG–3’ D.5’–GAUUCGAAGCU–3’ The addition of a poly(A) tail is important A. to allow RNA splicing to occur B. for stability and nuclear export of mRNAs C. to protect against endonuclease activity D. to terminate synthesis of pre-mRNA by RNAP The sequence element that defines the 5’ end of an intron is the A. branch site. B. splice donor site. C. splice acceptor site. D. polyadenylation signal. Histone acetylation is required for __________ of transcription? A. activation B. repression Which of the following sequence elements determines the site of transcription initiation? A. Enhancer B. 3’ UTR C. Exon D. Polyadenylation signal E. Promoter Which nucleotide sequence would result from transcription of the following double-stranded DNA sequence? 5’–GATTCGAAGCT–3’ 3’–CTAAGCTTCGA–5’ A.5’–CTAAGCUUGCT–3’ B.5’–GATTCGAAGCT–3’ C.5’–UCGAAGCUUAG–3’ D.5’–GAUUCGAAGCU–3’ The addition of a poly(A) tail is important A. to allow RNA splicing to occur B. for stability and nuclear export of mRNAs C. to protect against endonuclease activity D. to terminate synthesis of pre-mRNA by RNAP The sequence element that defines the 5’ end of an intron is the A. branch site. B. splice donor site. C. splice acceptor site. D. polyadenylation signal. Histone acetylation is required for __________ of transcription? A. activation B. repression Which of the following sequence elements determines the site of transcription initiation? A. Enhancer B. 3’ UTR C. Exon D. Polyadenylation signal E. Promoter II. TRANSLATION  The genetic code is a dictionary Genetic code = set of rules used by ribosomes to interpret information found in DNA and RNA to produce proteins. Link between specific sequence of nucleotides and a sequence of amino acids Codon = sequence of three nucleotides that specifies a given amino acid Each codon represents a single amino acid  II.A.1. From nucleotides to codons Codons expressed in mRNA language of A, C, G and U Reminder: sequence always written AND read in 5’-to-3’ direction, 3 nucleotides at a time Varying combinations of four nucleotides produce all three-base codons: 43  64 different codons 61/64 code for the 20 amino acids 3/64 codons are termination signals: UAG, UGA, UAA  II.A.2. Characteristics of the code 1. Specific: a given codon always encodes the same amino acid e.g., UUG = leucine 2. Universal: conserved across species very few variations: - mitochondrial code - certain types of yeast & bacteria  II.A.2. Characteristics of the code 1. Specific: a given codon always encodes the same amino acid e.g. UUG = leucine 2. Universal: conserved across species 3. Degenerate (or redundant): an amino acid may be specified by more than one codon i.e., leucine = UUA, UUG, CUU, CUC, CUA, CUG 5’ Second base 3’ Third base First base  II.A.2. Characteristics of the code 1. Specific: a given codon always encodes the same amino acid e.g. UUG = leucine 2. Universal: conserved across species 3. Degenerate (or redundant): an amino acid may be specified by more than one codon i.e. leucine = UUA, UUG, CUU, CUC, CUA, CUG 4. Non-overlapping and comma-free: read continuously from a fixed point sequence of bases always processed three at a time  reading frame  Open Reading Frame (ORF) Genomic DNA Promoter 5’ UTR Protein coding sequence 3’ UTR DNA CATGCTATGACACGATATGAGATATGCATAGAAAGCGAATATAGATAGTGC Transcription RNA CAUGCUAUGACACGAUAUGAGAUAUGCAUAGAAAGCGAAUAUAGAUAGUGC Frame 1 CAUGCUAUGACACGAUAUGAGAUAUGCAUAGAAAGCGAAUAUAGAUAGUGC Frame 2 CAUGCUAUGACACGAUAUGAGAUAUGCAUAGAAAGCGAAUAUAGAUAGUGC X Frame 3 CAUGCUAUGACACGAUAUGAGAUAUGCAUAGAAAGCGAAUAUAGAUAGUGC X  Requirements for translation 1. mRNA: template must be present 2. Amino acids: all amino acids present in finished protein must be available  balanced diet 3. tRNAs: translators of the genetic code 4. Aminoacyl-tRNA synthetases: family of enzymes required for attachment of specific amino acids to corresponding tRNAs to form aminoacyl- tRNAs  tRNAs and aminoacyl-tRNA synthetases tRNAs and amino acids: tRNA, no amino acid  uncharged tRNA + amino acid  charged and activated (aminoacyl-tRNA) Aminoacyl-tRNA synthetases: enzymes that charge tRNAs highly specific (1 enzyme per aa codon) proofreading activity mischarged amino acids are recognized and replaced  Required for translation 5. Functionally competent ribosomes: site of protein synthesis large complex of rRNAs and proteins Free in cytoplasm OR attached to ER 6. Protein factors: specific initiation (eIFs), elongation (eEFs) and termination factors required for protein synthesis 7. Energy sources: ATP and GTP both required  Ribosomes Catalyzes formation of Binds mRNA peptide bonds between AND amino acids (Peptidyl responsible for transferase) accuracy of translation  Ribosomes Peptidyl site: tRNA carrying the Exit site: growing chain deacylated tRNA Aminoacyl site: binds incoming aminoacyl- tRNAs  Translation: protein synthesis 1. Initiation: assembly of ribosomal subunits with initiator aminoacyl-tRNA, eukaryotic initiation factors (eIFs) and mRNA 40S subunit + initiator tRNA + mRNA + 60S subunit  Regulation of Translational Initiation Rate-limiting step is binding of the 5’ m7Gp Cap of the mRNA by the methylguanosine cap binding complex (CBC). Some eIFs can be control points to regulate initiation: Globin synthesis in reticulocytes is regulated by heme availability – adequate supplies prevent phosphorylation and repression of eIF2. CBC 2. Elongation: ribosome moves along mRNA in a multistep process Binding of incoming aminoacyl-tRNA A site freed - cycle to A site begins again v i eEFs ii Peptide bond formation - Translocation of catalyzed by eEFs ribosome along iii peptidyl-transferase iv mRNA - aminoacyl- activity of 60S (GTP + tRNA carrying growing eEFs) chain transferred to P site (GTP + eEFs) Transfer of growing chain to aminoacyl-tRNA in A site II.C. Steps of translation: protein synthesis mRNA is translated in 5’-to-3’ direction in cytosol 3. Termination: ribosome reaches sequence of termination codon Binding of eukaryotic release factor (eRF) to A site Release of polypeptide chain from ribosome Dissociation of ribosome-mRNA complex + recycling of components STOP CODONS: UAA, UAG, UGA How do alterations to the DNA sequence affect protein synthesis?  II.D. Sequence alterations Single nucleotide change (or point mutation): silent mutation: same amino acid missense mutation: different amino acid nonsense mutation: premature stop codon  II.D. Sequence alterations Insertion/deletion of one or more nucleotides: trinucleotide repeat expansion: amplification of a sequence frame-shift mutation: changes reading frame  addition or deletion Splice site mutation: alters pattern of removal of intron(s) from pre-mRNA  retention or skipping  Mutations that affect mRNA splicing Mutations within introns AND exons can affect the normal process of mRNA splicing to produce mRNA/protein with aberrant nucleotide/amino acid composition Transcription Exon 1 Exon 2 Exon 3 Splicing Exon 1 Exon 2 Exon 3 How could DNA mutations alter normal splicing and what effects on gene products may result?  Mutations that affect mRNA splicing Mutations within introns AND exons can affect the normal process of mRNA splicing to produce mRNA/protein with aberrant nucleotide/amino acid composition Transcription Exon 1 XExon 2 X Exon 3 Exon 1 Exon 3 Exon 1 Exon 2 Exon 3  Overview of gene mutation types DNA HAS ALL YOU ASK FOR Splicing II.E. Antibiotics that inhibit protein synthesis Exploit differences between eukaryotic and prokaryotic translation II.E. Antibiotics that inhibit protein synthesis III. POST-TRANSLATIONAL MODIFICATION  Post-translational modifications Modification of polypeptide chains either: during translation  co-translational following translation  post-translational Change properties of protein: Stability Localization Activity/function Two categories of modifications: Trimming Covalent modifications  III.A. Trimming Proteolytic cleavage or trimming: removal of defined portions of a protein by endoproteases ** The most common modification is the cleavage of the leading Methionine from most proteins Examples:  Enzymes secreted as inactive precursors (zymogens) i.e., trypsinogen (pancreas)  trypsin (intestine)  Activation of proproteins i.e., preproinsulin  proinsulin  insulin  III.B. Covalent modifications Reversible covalent attachments of various chemical groups, sugars, lipids, or proteins to specific amino acids Phosphorylation Hydroxylation Glycosylation Collagen α-chains must be hydroxylated at proline and lysine residues Catalyzed by Requires vitamin C kinases/ reversed by as a coenzyme phosphatases Plasma membrane May activate OR or secreted proteins inhibit activity of are glycosylated proteins IV. TRAFFICKING Proteins are synthesized either on FREE ribosomes or BOUND ribosomes  To be free or not to be… that is the question! Proteins synthesized on BOUND ribosomes: inserted into cell membrane function within lysosomes secreted outside the cell Proteins synthesized on FREE ribosomes: Nucleus Mitochondria Peroxisomes Cytosol  Signal sequences Structural features found within the sequence of protein being produced  “address label or ZIP code” recognized by organelles direct protein to appropriate location for further modification For proteins synthesized on BOUND ribosomes, specific amino acid sequences direct them from: ER  Golgi  final destination  Default pathways Failure to incorporate the appropriate signal sequences leads protein along two possible default pathways 1. Proteins synthesized on BOUND ribosomes  secreted outside of cell 2. Proteins synthesized on FREE ribosomes  remain in cytosol  IV.A.1. Proteins synthesized by bound ribosomes Targeting of proteins to ER, Golgi or plasma membrane requires N-terminal hydrophobic signal sequence NH2-terminal signal or leader sequence initially targets ribosome to ER N-terminal  amino-terminal region Hydrophobic: contains AAs that do not undergo hydrogen bonding with water  Signal recognition particle - SRP Leader sequence: recognized by signal recognition particle (SRP)  cytosolic complex made of proteins and RNA ⇒ Binding of leader sequence by SRP facilitates docking/attachment of ribosome to ER membrane  Proteins synthesized by bound ribosomes 1. Binding of SRP-polypeptide to SRP receptor on surface of ER 2. Entry of nascent polypeptide into ER lumen 3. Cleavage of leader sequence by proteases upon entry into ER  Proteins synthesized by bound ribosomes Once translation is complete: dissociation of ribosome/mRNA Newly synthesized peptide in ER lumen  IV.A.1. N-glycosylation in the ER Most proteins are co-translationally glycosylated upon entry into ER if they contain: Asn-X-Ser Asn-X-Thr Transfer of 14-sugar branched oligosaccharide from the membrane lipid dolichol to Asn (asparagine): “N-linked” - glycosylation of amide Nitrogen of Asn Proteins may contain multiple sites.  IV.A.2. From transitional element to Golgi Once translation is completed  peptides move through ER cisternae toward transitional elements Area of smooth ER (devoid of ribosomes)  From transitional element to Golgi Transitional element membrane surrounds and encloses proteins. Enclosed membrane buds off to form transport vesicles Fuse with next membrane-enclosed structure: Golgi complex  IV.A.2. Golgi complex The Golgi complex is comprised of three main regions: cis, medial and trans Transport vesicles fuse with cis-Golgi network  proteins taken up into lumen CIS MEDIAL TRANS  Golgi complex Proteins further processed in Golgi: glycosylation: addition of carbohydrates sulfation: addition of sulfur phosphorylation: addition of phosphate proteolysis: cleavage of peptide bonds  IV.A.3.a. Trafficking from the Golgi to lysosomes The Trans-Golgi Network (TGN) sorts and packages polypeptides to lysosomes, the cell membrane or for secretion out of the cell. Proteins destined to function within lysosomes are: glycosylated by addition of mannose sugar phosphorylated at C-6  mannose-6-phosphate (M6P) tag (specific N-linked glycosylation of Asn residues)  From Golgi to lysosomes Lysosomes: organelles involved in degrading macromolecules acidic internal pH (pH ~4.8) contain enzymes named acid hydrolases degrade unwanted macromolecules at an acidic pH Lysosomal membrane: keeps enzymes sequestered away from cytoplasmic macromolecules  Trafficking of acid hydrolases into lysosomes 1. Addition of mannose-6-phosphate to acid hydrolase precursors in Golgi 2. Concentration & segregation of modified acid hydrolases from other proteins  mannose-6-phosphate receptor in clathrin-coated pits 3. Formation of clathrin-coated vesicles and budding off from Trans Golgi 4. Fusion of transport vesicle with an endosome (from plasma membrane) 5. Loss of clathrin coat and dissociation of acid hydrolases from receptor (acidic pH of endolysosome) 6. Removal of phosphate from mannose-6- phosphate group (prevents rebinding to receptor) 7. Recycling of receptors to Golgi  Clinical relevance Lysosomal storage diseases: I cell disease (GNPTAB muts): impaired targeting of ALL acid hydrolases to lysosomes due to defective phosphorylation of mannose. Hurler & Hunter syndromes (Mucopolysaccharidosis types I & II) (IDUA or IDS muts) Tay-Sachs disease (HEXA muts) Gaucher disease (GBA muts)  Tay-Sachs disease Accumulation of glycolipids (GM2 gangliosides) in brain due to lack of hydrolytic enzyme in lysosomes Progressive deterioration of nerve cells Death by age 4 (infantile form) Characteristic “Cherry Red Spot” in retina of eye More than 120 different mutations identified in HEXA (β-Hexosaminidase A) Single nucleotide insertions/deletions Splice site mutations Missense mutations https://theconversation.com/first-gene-therapy-for-tay- sachs-disease-successfully-given-to-two-children-176870  IV.A.3.b. Secreted proteins Proteins reaching Golgi BUT with no retention signal for Golgi, lysosomes or for insertion in the plasma membrane SECRETED outside of cell encapsulated in transport vesicle buds off from Trans-Golgi Network TWO OPTIONS: Constitutive secretion: fuses with plasma membrane and secreted continuously Regulated secretion: stored in cytoplasm until appropriate time for release  Constitutive secretion Secretory vesicles continuously bud off and fuse with the plasma membrane and release contents extracellularly. Transport mechanism that allows release of large molecules from cells (i.e., fibroblasts, osteoblasts, chondrocytes, neurons)  Regulated secretion Stored in cytoplasm and secretion occurs only at certain times Discontinuous process Occurs in response to specific signals (i.e., hormonal stimulation) – Insulin, neurotransmitters IV.B. Protein synthesis on FREE ribosomes is different  Proteins synthesized on FREE ribosomes Proteins remaining in cytosol or functioning in nucleus, mitochondria or peroxisomes synthesized on free ribosomes do NOT contain an N-terminal leader/signal sequence Default pathway = remain in cytosol i.e., carbohydrate metabolism enzymes or cytoskeletal proteins that function outside of organelles  Proteins synthesized on FREE ribosomes Other structural features can be incorporated to direct these proteins to specific organelles: nucleus: contain a nuclear localization signal (NLS) (i.e., DNA or RNA polymerases) mitochondria: contain N-terminal mitochondrial import sequence (i.e., citric acid cycle proteins, oxidative phosphorylation) peroxisomes: contain a C (carboxyl)-terminal tripeptide IV.C. From concept to context: insulin synthesis  Insulin synthesis and secretion Preproinsulin (enters ER) proinsulin (folded/trafficked to Golgi) insulin + C-peptide (cleaved in Golgi and secreted) Initiation of protein translation begins with… A. Formation of a charged glutamanyl-tRNA by an aminoacyl- tRNA synthetase enzyme. B. Transfer of a polypeptide from a tRNA in the P site to an AA- bound tRNA at the A site. C. Binding of a methionyl-tRNA and small ribosomal subunit to the AUG codon of an mRNA. D. Translocation of a ribosome from 3’ to 5’ along an mRNA. A tRNA molecule that is supposed to carry a Glu is mischarged and actually carries a Gly. Which enzyme’s proofreading activity will correct this? A. E3 ubiquitin ligase B. Aminoacyl-tRNA synthetase C. Peptidyl transferase D. RNA polymerase II Which of the following statements regarding elongation during translation is true? A. New charged tRNAs enter at the ribosomal P site. B. Aminoacyl-tRNA synthetase forms a peptide bond between new amino acids in the A site and the growing polypeptide chain. C. Eukaryotic release factor (eRF) signals departure of empty tRNAs from the ribosomal E site. D. After new peptide bond formation occurs, the growing polypeptide is transferred to the tRNA in the A site. Of the following, proteins synthesized on FREE ribosomes are most likely to… A. Be packaged for inclusion in lysosomes. B. Function in the nucleus. C. Be secreted extracellularly. D. Localize to the plasma membrane. Secretion of insulin in response to high blood glucose levels is an example of… A. Constitutive secretion B. Regulated secretion Initiation of protein translation begins with… A. Formation of a charged glutamanyl-tRNA by an aminoacyl- tRNA synthetase enzyme. B. Transfer of a polypeptide from a tRNA in the P site to an AA- bound tRNA at the A site. C. Binding of a methionyl-tRNA and small ribosomal subunit to the AUG codon of an mRNA. D. Translocation of a ribosome from 3’ to 5’ along an mRNA. A tRNA molecule that is supposed to carry a Glu is mischarged and actually carries a Gly. Which enzyme’s proofreading activity will correct this? A. E3 ubiquitin ligase B. Aminoacyl-tRNA synthetase C. Peptidyl transferase D. RNA polymerase II Which of the following statements regarding elongation during translation is true? A. New charged tRNAs enter at the ribosomal P site. B. Aminoacyl-tRNA synthetase forms a peptide bond between new amino acids in the A site and the growing polypeptide chain. C. Eukaryotic release factor (eRF) signals departure of empty tRNAs from the ribosomal E site. D. After new peptide bond formation occurs, the growing polypeptide is transferred to the tRNA in the A site. Of the following, proteins synthesized on FREE ribosomes are most likely to… A. Be packaged for inclusion in lysosomes. B. Function in the nucleus. C. Be secreted extracellularly. D. Localize to the plasma membrane. Secretion of insulin in response to high blood glucose levels is an example of… A. Constitutive secretion B. Regulated secretion