Chapter 22: An Introduction to Evolution PDF - Biology Lecture

Chapter 22 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use...

Chapter 22 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have used any of the animation functions (such as Play or Pause), you must first click on the slide’s background before you can advance to the next slide. See separate PowerPoint slides for all figures and tables pre-inserted into PowerPoint without notes and animations. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1  Chapter 22 An Introduction to Evolution Key Concepts: The Theory of Evolution Evidence of Evolutionary Change The Molecular Processes That Underlie Evolution 2  The Theory of Evolution develop & Evolution – Heritable change in one or more characteristics of a population or species from one generation to the next Microevolution – changes in a single gene in a population over time Macroevolution – formation of new species or groups of species 3  Species - > several population  Group of related organisms that share a distinctive form  Among species that reproduce sexually, members of the same species are capable of interbreeding to produce viable and fertile offspring small group of the same species Population -  Members of the same species that are likely to encounter each other and thus have the opportunity to interbreed 4 History of the Theory of Evolution Empirical thought  Relies on observation to form an idea or hypothesis, rather than trying to understand life from a non-physical or spiritual point of view In the 1600s, a shift toward empirical thought encouraged scholars to look for the basic rationale behind a given process or phenomenon 5  Mid- to late-1600s, John Ray was the first to carry out a thorough study of the natural world  Developed an early classification system  Modern species concept create binomial naming Extended by Carolus Linnaeus Neither proposed that evolutionary change promotes the formation of new species 6  Late 1700s, small number of European scientists suggest life forms are not fixed George Buffon says life forms change over time Jean-Baptiste Lamarck realized that some animals remain the same while others change  Believed living things evolved upward toward human “perfection”  Inheritance of acquired characteristics  ex: Giraffe necks 7  Uniformitarianism hypothesis from geology  Slow geological processes lead to substantial change  Earth was much older than 6,000 years Thomas Malthus, an economist, says that only a fraction of any population will survive and reproduce 8 Charles Darwin British naturalist born in 1809 Theory shaped by several different fields of study  Geology  Economics  Voyage of the Beagle 9 Voyage of the Beagle,1831-1836 Darwin’s ideas were most influenced by his own observations He noticed distinctive traits of island species that allowed them to better exploit their environment ex: Galapagos Island finches  Saw similarities in species yet noted differences that provided them with specialized feeding strategies 10  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. England Azores Canary Is. Cape Verde Is. Galápagos Is. (a) Charles Darwin Ascension Is. Cocos Is. New Callao Bahia St. Helena Is. Zealand Tahiti Mauritius Valparaiso Rio de Sydney Janeiro King George Hobart Montevideo Sound Tierra del Fuego Falkland Is. (b) The voyage of the Beagle a: © PoodlesRock/Corbis 11 12 Continued from the previous page 13  Formulated theory of evolution by mid-1840s Spent several additional years studying barnacles 1856, began writing his book 1858, Alfred Wallace sends Darwin an unpublished manuscript proposing many of the same ideas Darwin’s and Wallace’s papers published together 1859, Darwin’s On the Origin of Species is published detailing his ideas with observational support 14  What are barnacles? 15  Formulated theory of evolution by mid-1840s Spent several additional years studying barnacles 1856, began writing his book 1858, Alfred Wallace sends Darwin an unpublished manuscript proposing many of the same ideas Darwin’s and Wallace’s papers published together 1859, Darwin’s On the Origin of Species is published detailing his ideas with observational support 16 Descent with modification Evolution based on  Variation within a given species Traits heritable – passed from parent to offspring Genetic basis was not yet known  Natural selection More offspring produced than can survive Competition for limited resources Individuals with better traits flourish and reproduce 17 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 A small population of birds flies from the South American mainland, where they fed on seeds of a variety of sizes, and become residents of a distant island. 18 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 2 The birds produce many offspring that vary in beak size. The variation is due to random mutations within genes that affect beak size. 19  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 3 Due to limited resources, not all offspring reproduce. Surviving The seeds on this island are birds that relatively large. Those reproduce offspring that happen to have larger beaks are better at crushing these seeds, so they are more likely to survive and reproduce. 20 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 4 The birds of the next generation tend to have larger beaks. 21 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5 After many, many generations, the adaptation that allows success in feeding on larger seeds has created a new species with larger beaks, as well as other modified traits, such as changes in color, that are suited to the new environment. 22 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 A small population of birds flies from the South American mainland, where they fed on seeds of a variety of sizes, and become residents of a distant island. 2 The birds produce many offspring that vary in beak size. The variation is due to random mutations within genes that affect beak size. 3 Due to limited resources, not all offspring reproduce. Surviving The seeds on this island are birds that relatively large. Those reproduce offspring that happen to have larger beaks are better at crushing these seeds, so they are more likely to survive and reproduce. 4 The birds of the next generation tend to have larger beaks. 5 After many, many generations, the adaptation that allows success in feeding on larger seeds has created a new species with larger beaks, as well as other modified traits, such as changes in color, that are suited to the new environment. 23 The Grants Observed Natural Selection in Galápagos Finches 24  The Grants Observed Natural Selection in Galápagos Finches Grants focused much of their work on Daphne Major – moderately isolated, undisturbed habitat and resident finches Compared beak sizes of parents and offspring over many years Birds with larger beaks survived better during drought years In the year after drought, average beak depth increases 25  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (a) Daphne Major (b) Medium ground finch a: © Worldwide Picture Library/Alamy; b: © Gerald & Buff Corsi/Visuals Unlimited 26 Daphne Major is a volcanic island, one of the Galápagos Islands (Ecuador) 27  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. HYPOTHESIS Dry conditions produce larger seeds and may result in larger beaks in succeeding generations of Geospiza fortis due to natural selection. KEY MATERIALS A population of G. fortis on the Galápagos Island called Daphne Major. Experimental level Conceptual level 1 In 1976, measure beak depth in parents This is a way to measure and offspring of the species G. fortis. Capture birds a trait that may be subject and measure to natural selection. beak depth. 2 Repeat the procedure on offspring that This is a way to measure were born in 1978 and had reached Capture birds a trait that may be subject mature size. A drought had occurred in and measure to natural selection. 1977 that caused plants on the island beak depth. to produce mostly large dry seeds and relatively few small seeds. 28  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 3 THE DATA Number of birds measured 1976 parents (predrought) 1976 offspring (predrought) 1978 offspring (postdrought) 50 Average 30 Average 40 Average 40 25 30 20 30 15 20 20 10 10 10 5 0 0 0 7.3 7.8 8.3 8.8 9.3 9.8 10.310.8 7.3 7.8 8.3 8.8 9.3 9.8 10.310.811.3 7.3 7.8 8.3 8.8 9.3 9.8 10.3 10.811.3 Beak depth (mm) 4 CONCLUSION Because a drought produced larger seeds, birds with larger beaks were more likely to survive and reproduce. The Process of natural selection produced postdrought offspring that had larger beaks compared to predrought offspring. 5 SOURCE Grant, B. Rosemary, and Grant, Peter R. 2003. What Darwin’s Finches Can Teach Us about the Evolutionary Origin and Regulation of Biodiversity. Bioscience 53:965–975. 29 Evidence of Evolutionary Change Fossil record Biogeography Convergent evolution Selective breeding Homologies  Anatomical  Developmental  Molecular 30 31 Continued from the previous page 32 Fishapod (Tiktaalik roseae) Illuminates steps leading to evolution of tetrapods Transitional form – provides link between earlier and later forms Had broad skull, flexible neck, eyes on top of head, primitive wrist and five fingers Could peek above water and look for prey 33  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Early amphibian Amphibian 360 tetrapod Expanded ribs LATE DEVONIAN PERIOD Millions of years ago (mya) Neck Flat head, eyes on top Tiktaalik roseae 370 Scales Fins Fish 377 380 (middle): © T. Daeschler/VIREO 34 Horses Interesting case of how evolution involves adaptation to changing environments Fossil record has revealed adaptive changes in size, foot anatomy, and tooth morphology Changes can be attributed to natural selection producing adaptations to changing global climates  Large dense forests replaced with grassland  Run faster, eat tougher food 35 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Equus 5 Molar 10 Front leg 15 and foot Pliohippus 20 Millions of years ago (mya) 25 TIME 30 Merychippus 35 40 Mesohippus 45 50 Hyracotherium 55 36 Biogeography Study of the geographical distribution of extinct and modern species Isolated continents and island groups have evolved their own distinct plant and animal communities  Endemic – naturally found only in a particular location ex: Island fox (Urocyon littoralis) evolved from mainland gray fox (Urocyon cinereoargenteus) 37 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (a) Island fox (Urocyon littoralis) California Santa Barbara Santa Barbara Channel Islands channel San Anacapa Miguel Santa Cruz Santa Rosa (b) Gray fox (Urocyon cinereoargenteus) 38 a: © Wm. Grenfell/Visuals Unlimited; b: © Prisma Bildagentur AG/Alamy  Evolution of major animal groups correlated with known changes in the distribution of land masses on the Earth First mammals arose 225 mya when Australia was still connected Placental mammals arose 80 mya after Australia separated Australia has no large, terrestrial placental mammals 39 Convergent evolution Two different species from different lineages show similar characteristics because they occupy similar environments Examples:  Giant anteater and echidna both have long snouts and tongues to feed on ants  Aerial rootlets for clinging in English ivy and wintercreeper  Antifreeze proteins in different, very cold water fish 40  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (a) The long snouts and tongues of the giant anteater (left) and the echidna (right) allow them to feed on ants. (b) The aerial rootlets of English ivy (left) and wintercreeper (right) enable them to climb up supports. (c) The sea raven (left) and the longhorn sculpin (right) have antifreeze proteins that enable them to survive in frigid waters. a (left): © Tom Brakefield/ Corbis; a (right): © Tom McHugh/Photo Researchers, Inc.; b (left): © David Sieren/Visuals Unlimited; b (right): © 2003 Steve Baskauf/bioimages.vanderbilt.edu; c (left): © Jonathan Bird/Getty Images; 41 c (right): © David Wrobel/SeaPics.com Selective breeding Programs and procedures designed to modify traits in domesticated species Also called artificial selection Darwin influenced by pigeon breeders Nature chooses parents in natural selection while breeders choose in artificial selection Made possible by genetic variation Breeders choose desirable phenotypes ex: dog breeds, Brassica plants, and corn 42  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. (a) Bulldog (b) Greyhound (c) Dachshund (a): © Mark Raycroft/ Minden Pictures; (b): © Martin Rugner/agefotostock; (c): © Juniors Bildarchiv/agefotostock. 43  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Wild mustard plant (Brassica oleracea) Brussels Strain Kohlrabi Kale Broccoli Cabbage Cauliflower sprouts Modified Flower buds Lateral Terminal Flower Stem Leaves trait and stem leaf buds leaf bud buds 44  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 19 18 High oil content 17 Low oil content 16 15 14 13 Percentage oil content 12 11 10 9 8 7 6 5 4 3 2 1 0 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 Generations 45 Homology Fundamental similarity due to descent from a common ancestor Homology may be  Anatomical  Developmental  Molecular 46 Anatomical homology Same set of bones in the limbs of modern vertebrates has undergone evolutionary change for many different purposes Homologous structures are derived from a common ancestor Vestigial structures are anatomical structures that have no apparent function but resemble structures of presumed ancestors  Ear wiggling muscles 47  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Humerus Radius Ulna Carpal Metacarpal Phalanges 1 Human 2 3 4 5 1 2 3 Turtle 4 5 1 2 Bat 3 4 5 1 Whale 4 3 5 2 48 Developmental homology Species that differ as adults often bear striking similarities during embryonic stages Presence of gill ridges in human embryos indicates that humans evolved from an aquatic animal with gill slits Human embryos have long bony tails 49 Gill ridges and long bony tails in human embryos 50 51 Manatees 52 Molecular homology Similarities in cells at the molecular level show that living species evolved from a common ancestor All living species use DNA to store information Certain biochemical pathways are found in all or nearly all species 53 Comparative genomics reveals homology at the DNA level 54 What are exons?  The same type of gene is often found in diverse organisms ex: p53 gene plays a role in preventing cancer  Certain genes are found in a diverse array of species  Sequences of closely related species tend to be more similar to each other than to distantly related species 56  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Percentages of amino acids in the Short amino acid sequence within the p53 protein whole p53 protein that are identical to human p53 Human (Homo sapiens) Val Pro Ser Gln Lys Thr Tyr Gln Gly Ser Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr 100 Rhesus monkey (Macaca mulatta) Val Pro Ser Gln Lys Thr Tyr His Gly Ser Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr 95 Green monkey (Cercopithecus aethiops) Val Pro Ser Gln Lys Thr Tyr His Gly Ser Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr 95 Rabbit (Oryctolagus cuniculus) Val Pro Ser Gln Lys Thr Tyr His Gly Asn Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr 86 Dog (Canis lupus familiaris) Val Pro Ser Pro Lys Thr Tyr Pro Gly Thr Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr 80 Chicken (Gallus gallus) Val Pro Ser Thr Glu Asp Tyr Gly Gly Asp Phe Asp Phe Arg Val Gly Phe Val Glu Ala Gly Thr 53 Channel catfish (Ictalurus punctatus) Val Pro Val Thr Ser Asp Tyr Pro Gly Leu Leu Asn Phe Thr Leu His Phe Gln Glu Ser Ser Gly 48 European flounder (Platichthys flesus) Val Pro Val Val Thr Asp Tyr Pro Gly Glu Tyr Gly Phe Gln Leu Arg Phe Gln Lys Ser Gly Thr 46 Congo puffer fish (Tetraodon miurus) Val Pro Val Thr Thr Asp Tyr Pro Gly Glu Tyr Gly Phe Lys Leu Arg Phe Gln Lys Ser Gly Thr 41 57  The Molecular Processes That Underlie Evolution Homologous genes – two genes derived from the same ancestral gene  Orthologs occur in separate species Reveals molecular details of evolutionary change Two sequences may be similar, but not identical due to the independent accumulation of different random mutations 58 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Ancestral metal transporter gene Common ancestor 59  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Metal Metal transporter transporter gene gene Escherichia coli Clostridium acetylbutylicum Evolutionary separation of 2 (or more) distinct species Ancestral metal transporter gene Common ancestor 60  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. TTGGTTATATCGATCCCGGTAACTTTGCGACCAAE. coli TAGCCTACATTGATCCTGGTAATTTTGCTACAAAC. acetylbutylicum Metal Metal transporter transporter gene gene Mutation Mutation Accumulation of random mutations in the 2 genes Metal Metal transporter transporter gene gene Escherichia coli Clostridium acetylbutylicum Evolutionary separation of 2 (or more) distinct species Ancestral metal transporter gene Common ancestor 61  Paralogs – homologous genes within a single species Gene duplication can lead to a gene family  Two or more paralogs within the genome of a single organism ex: Globin genes  Allows for specialized function, expression at different times or in different tissues 62  Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer. https://www.youtube.com/watch?v=V4ZxlXnbxz0 63  New Genes in Eukaryotes Have Evolved Via Exon Shuffling Exon shuffling occurs when an exon and the flanking introns are inserted into a gene – producing a protein with an additional domain Proteins can alter traits and be acted upon by natural selection May occur by more than one mechanism  Double crossover  Transposable elements  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Domain 1 Intron 1 Exon 1 Intron 2 Exon 2 Intron 3 Exon 3 Intron 4 3 Gene 1 Protein 1 2 2 Intron 1 Exon 1 Intron 2 Exon 2 Intron 3 Exon 3 Intron 4 1 Gene 2 Protein 2 3 A double crossover causes a segment of gene 1, including exon 2 and parts of the flanking introns, to be removed from 1 Domain 2 is missing. Natural gene 1 and inserted into gene 2. selection may eliminate this Exon 1 Exon 3 3 gene from the population if it is no longer functional. Gene 1 Protein 1 Gene 1 is missing exon 2. 1 A protein with domain 2 from gene 1 inserted into gene 2. Exon 1 Exon 2 Exon 2 Exon 3 If this protein provides a Gene 2 Protein 2 2 new, beneficial trait, natural selection may increase its Gene 2 has acquired exon 2 from gene 1. 2 prevalence in a population. 3 Horizontal gene transfer Exchange of genetic material among different species Surprisingly common phenomenon Can transfer  From prokaryotes to eukaryotes  From eukaryotes to prokaryotes  Between prokaryotes  Between eukaryotes Widespread among bacteria 66  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. During phagocytosis, the bacterial cell is degraded, and the products of degradation Paramecium are released into the (a eukaryote) cytosol. However, a gene from the bacterium escapes degradation and becomes inserted into a chromosome in the eukaryotic cell. Bacterial chromosome Bacterial cell Gene Phagocytic transfer Bacterial vesicle gene 67  Evolution also occurs at the genomic level involving changes in chromosome structure and number Compare three largest chromosomes in humans and apes  Similar due to close evolutionary relationship  Humans have one large chromosome 2 while apes have it divided into two separate chromosomes  Chromosome 3 very similar but orangutans have a large inversion May have established orangutans as a new species 68  Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chromosome 1 Human Chimpanzee Gorilla Orangutan Chromosome 2 Human Chimpanzee Gorilla Orangutan Chromosome 3 Human Chimpanzee Gorilla Orangutan Inversion 69