Podcast
Questions and Answers
What is the start codon for translation?
What is the start codon for translation?
- GCU
- UAA
- UGA
- AUG (correct)
What does the ribosome use to attract the anticodon?
What does the ribosome use to attract the anticodon?
- rRNA
- tRNA (correct)
- DNA
- mRNA
During translation, what are amino acids joined by?
During translation, what are amino acids joined by?
- Polypeptide bonds
- DNA
- Hydrogen bonds
- Peptide bonds (correct)
Which process continues until a stop codon is reached?
Which process continues until a stop codon is reached?
What happens to tRNA after it delivers an amino acid to the ribosome?
What happens to tRNA after it delivers an amino acid to the ribosome?
What mainly influences the traits of living organisms according to molecular biology?
What mainly influences the traits of living organisms according to molecular biology?
What is the primary function of proteins mentioned in the text?
What is the primary function of proteins mentioned in the text?
Which scientist is credited with mapping the structure of ribosomes?
Which scientist is credited with mapping the structure of ribosomes?
What did Gregor Mendel discover about genes?
What did Gregor Mendel discover about genes?
How is the genetic code maintained in all living organisms?
How is the genetic code maintained in all living organisms?
Which process occurs when DNA is transcribed into mRNA?
Which process occurs when DNA is transcribed into mRNA?
What does mRNA do in the process of translation?
What does mRNA do in the process of translation?
Which type of RNA delivers amino acids during protein synthesis?
Which type of RNA delivers amino acids during protein synthesis?
What role do ribosomes play in translation?
What role do ribosomes play in translation?
What happens to the polypeptide chain when the ribosome reaches a stop codon?
What happens to the polypeptide chain when the ribosome reaches a stop codon?
Which type of RNA is responsible for forming covalent bonds between amino acids in the ribosome?
Which type of RNA is responsible for forming covalent bonds between amino acids in the ribosome?
What do the four bases of RNA form?
What do the four bases of RNA form?
What is the first step in decoding genetic messages?
What is the first step in decoding genetic messages?
What determines the function of a protein?
What determines the function of a protein?
What is a codon?
What is a codon?
How many amino acids are commonly found in polypeptides?
How many amino acids are commonly found in polypeptides?
What is the role of mRNA in protein synthesis?
What is the role of mRNA in protein synthesis?
How many bases does each codon consist of?
How many bases does each codon consist of?
What are proteins made by joining together?
What are proteins made by joining together?
What are ribosomes responsible for during the process of translation?
What are ribosomes responsible for during the process of translation?
Which three components are involved directly in the translation process?
Which three components are involved directly in the translation process?
What does an anticodon on tRNA do?
What does an anticodon on tRNA do?
The nucleotide sequence AUUUAACUGUUCUGUCUAGAG can be translated into how many sets of amino acids?
The nucleotide sequence AUUUAACUGUUCUGUCUAGAG can be translated into how many sets of amino acids?
What is the role of tRNA during translation?
What is the role of tRNA during translation?
What is the sequence AUG known for in the process of translation?
What is the sequence AUG known for in the process of translation?
Which step initiates the translation process?
Which step initiates the translation process?
Which process forms the final shape or functional form of a protein?
Which process forms the final shape or functional form of a protein?
Which two codons code for glutamic acid?
Which two codons code for glutamic acid?
How many possible three-base codons are there in the genetic code?
How many possible three-base codons are there in the genetic code?
What does the codon GAC code for?
What does the codon GAC code for?
Which amino acid is specified by the codon UGG?
Which amino acid is specified by the codon UGG?
What is the function of the methionine codon AUG in protein synthesis?
What is the function of the methionine codon AUG in protein synthesis?
What does the verb 'specify' mean?
What does the verb 'specify' mean?
How many different codons specify leucine?
How many different codons specify leucine?
How many stop codons are there in the genetic code?
How many stop codons are there in the genetic code?
Flashcards are hidden until you start studying
Study Notes
Ribosomes and Protein Synthesis
The Genetic Code
- The genetic code is a language with four letters: A, C, G, and U.
- The code is read three bases at a time, and each "word" is three bases long and corresponds to a single amino acid.
- A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.
Protein Synthesis
- Proteins are made by joining amino acids together into chains called polypeptides.
- The specific order of amino acids in a polypeptide determines the shape, chemical properties, and function of a protein.
- Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.
Translation
- Translation is the process of decoding an mRNA message into a protein.
- The sequence of bases in an mRNA molecule provides the instructions for building a protein.
- A cell part called a ribosome acts like a tiny factory, carrying out the assembly tasks.
- Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.
Steps in Translation
- Translation begins when a ribosome attaches to an mRNA molecule in the cytoplasm.
- As each codon passes through the ribosome, several molecules of tRNA bring the proper amino acids into the ribosome.
- Each tRNA molecule carries just one kind of amino acid and has three unpaired bases that are together called an anticodon.
- The ribosome has a second binding site for a tRNA molecule for the next codon.
- The ribosome then attaches these amino acids to the growing chain.
tRNA and rRNA in Translation
- mRNA carries the coded message that directs the process.
- tRNA delivers the amino acids.
- rRNA holds ribosomal proteins in place and carries out the chemical reactions that join amino acids together.
- The three types of RNA work together at a ribosome to synthesize a polypeptide.
The Genetic Code Diagram
- The genetic code diagram shows how each codon specifies a particular amino acid.
- There are 64 possible three-base codons in the genetic code.
- Most amino acids can be specified by more than one codon.
- The codon AUG also serves as the initiation, or "start," codon for protein synthesis.
- The three "stop" codons specify when no amino acids should be added, and synthesis should cease.
Start and Stop Codons
- The methionine codon AUG serves as the initiation, or "start," codon for protein synthesis.
- The three "stop" codons end translation.
- At that point, the polypeptide is complete.
Overview of Transcription and Translation
- DNA encodes the information for an organism's traits.
- mRNA transcribes the genes and then tRNA builds the proteins.
- These proteins produce the organism's traits.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
