40 Questions
What is the start codon for translation?
AUG
What does the ribosome use to attract the anticodon?
tRNA
During translation, what are amino acids joined by?
Peptide bonds
Which process continues until a stop codon is reached?
Translation
What happens to tRNA after it delivers an amino acid to the ribosome?
It detaches and floats away.
What mainly influences the traits of living organisms according to molecular biology?
The genetic code
What is the primary function of proteins mentioned in the text?
Catalyze and regulate chemical reactions
Which scientist is credited with mapping the structure of ribosomes?
Ada Yonath
What did Gregor Mendel discover about genes?
Genes contain nothing but instructions for assembling proteins
How is the genetic code maintained in all living organisms?
It is nearly universal
Which process occurs when DNA is transcribed into mRNA?
Transcription
What does mRNA do in the process of translation?
Carries the coded message
Which type of RNA delivers amino acids during protein synthesis?
tRNA
What role do ribosomes play in translation?
They hold ribosomal proteins in place and carry out chemical reactions
What happens to the polypeptide chain when the ribosome reaches a stop codon?
It is released from the ribosome
Which type of RNA is responsible for forming covalent bonds between amino acids in the ribosome?
rRNA
What do the four bases of RNA form?
A genetic language
What is the first step in decoding genetic messages?
Transcription from DNA to mRNA
What determines the function of a protein?
The order of amino acids in a polypeptide chain
What is a codon?
A group of three consecutive bases in mRNA
How many amino acids are commonly found in polypeptides?
Twenty
What is the role of mRNA in protein synthesis?
To code for amino acids
How many bases does each codon consist of?
Three
What are proteins made by joining together?
Amino acids
What are ribosomes responsible for during the process of translation?
Decoding the mRNA message into a protein
Which three components are involved directly in the translation process?
mRNA, tRNA, ribosome
What does an anticodon on tRNA do?
Binds to a codon on mRNA
The nucleotide sequence AUUUAACUGUUCUGUCUAGAG can be translated into how many sets of amino acids?
Three
What is the role of tRNA during translation?
To carry amino acids to the ribosome
What is the sequence AUG known for in the process of translation?
It is the codon for methionine
Which step initiates the translation process?
When the ribosome attaches to an mRNA molecule
Which process forms the final shape or functional form of a protein?
Protein folding
Which two codons code for glutamic acid?
GAA and GAG
How many possible three-base codons are there in the genetic code?
64
What does the codon GAC code for?
Aspartic acid
Which amino acid is specified by the codon UGG?
Tryptophan
What is the function of the methionine codon AUG in protein synthesis?
It serves as the initiation or start codon.
What does the verb 'specify' mean?
To identify precisely
How many different codons specify leucine?
Six
How many stop codons are there in the genetic code?
Three
Study Notes
Ribosomes and Protein Synthesis
The Genetic Code
- The genetic code is a language with four letters: A, C, G, and U.
- The code is read three bases at a time, and each "word" is three bases long and corresponds to a single amino acid.
- A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.
Protein Synthesis
- Proteins are made by joining amino acids together into chains called polypeptides.
- The specific order of amino acids in a polypeptide determines the shape, chemical properties, and function of a protein.
- Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.
Translation
- Translation is the process of decoding an mRNA message into a protein.
- The sequence of bases in an mRNA molecule provides the instructions for building a protein.
- A cell part called a ribosome acts like a tiny factory, carrying out the assembly tasks.
- Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.
Steps in Translation
- Translation begins when a ribosome attaches to an mRNA molecule in the cytoplasm.
- As each codon passes through the ribosome, several molecules of tRNA bring the proper amino acids into the ribosome.
- Each tRNA molecule carries just one kind of amino acid and has three unpaired bases that are together called an anticodon.
- The ribosome has a second binding site for a tRNA molecule for the next codon.
- The ribosome then attaches these amino acids to the growing chain.
tRNA and rRNA in Translation
- mRNA carries the coded message that directs the process.
- tRNA delivers the amino acids.
- rRNA holds ribosomal proteins in place and carries out the chemical reactions that join amino acids together.
- The three types of RNA work together at a ribosome to synthesize a polypeptide.
The Genetic Code Diagram
- The genetic code diagram shows how each codon specifies a particular amino acid.
- There are 64 possible three-base codons in the genetic code.
- Most amino acids can be specified by more than one codon.
- The codon AUG also serves as the initiation, or "start," codon for protein synthesis.
- The three "stop" codons specify when no amino acids should be added, and synthesis should cease.
Start and Stop Codons
- The methionine codon AUG serves as the initiation, or "start," codon for protein synthesis.
- The three "stop" codons end translation.
- At that point, the polypeptide is complete.
Overview of Transcription and Translation
- DNA encodes the information for an organism's traits.
- mRNA transcribes the genes and then tRNA builds the proteins.
- These proteins produce the organism's traits.
Learn about the genetic code, mRNA, and the role of ribosomes in assembling proteins. Discover how molecular biology relates to genetics.
Make Your Own Quizzes and Flashcards
Convert your notes into interactive study material.
Get started for free
