Protein Synthesis and Ribosomes
40 Questions
1 Views

Protein Synthesis and Ribosomes

Created by
@AwesomeBernoulli

Podcast Beta

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the start codon for translation?

  • GCU
  • UAA
  • UGA
  • AUG (correct)

    • What does the ribosome use to attract the anticodon?

  • rRNA
  • tRNA (correct)
  • DNA
  • mRNA

    • During translation, what are amino acids joined by?

  • Polypeptide bonds
  • DNA
  • Hydrogen bonds
  • Peptide bonds (correct)

    • Which process continues until a stop codon is reached?

    <p>Translation</p> Signup and view all the answers

    What happens to tRNA after it delivers an amino acid to the ribosome?

    <p>It detaches and floats away.</p> Signup and view all the answers

    What mainly influences the traits of living organisms according to molecular biology?

    <p>The genetic code</p> Signup and view all the answers

    What is the primary function of proteins mentioned in the text?

    <p>Catalyze and regulate chemical reactions</p> Signup and view all the answers

    Which scientist is credited with mapping the structure of ribosomes?

    <p>Ada Yonath</p> Signup and view all the answers

    What did Gregor Mendel discover about genes?

    <p>Genes contain nothing but instructions for assembling proteins</p> Signup and view all the answers

    How is the genetic code maintained in all living organisms?

    <p>It is nearly universal</p> Signup and view all the answers

    Which process occurs when DNA is transcribed into mRNA?

    <p>Transcription</p> Signup and view all the answers

    What does mRNA do in the process of translation?

    <p>Carries the coded message</p> Signup and view all the answers

    Which type of RNA delivers amino acids during protein synthesis?

    <p>tRNA</p> Signup and view all the answers

    What role do ribosomes play in translation?

    <p>They hold ribosomal proteins in place and carry out chemical reactions</p> Signup and view all the answers

    What happens to the polypeptide chain when the ribosome reaches a stop codon?

    <p>It is released from the ribosome</p> Signup and view all the answers

    Which type of RNA is responsible for forming covalent bonds between amino acids in the ribosome?

    <p>rRNA</p> Signup and view all the answers

    What do the four bases of RNA form?

    <p>A genetic language</p> Signup and view all the answers

    What is the first step in decoding genetic messages?

    <p>Transcription from DNA to mRNA</p> Signup and view all the answers

    What determines the function of a protein?

    <p>The order of amino acids in a polypeptide chain</p> Signup and view all the answers

    What is a codon?

    <p>A group of three consecutive bases in mRNA</p> Signup and view all the answers

    How many amino acids are commonly found in polypeptides?

    <p>Twenty</p> Signup and view all the answers

    What is the role of mRNA in protein synthesis?

    <p>To code for amino acids</p> Signup and view all the answers

    How many bases does each codon consist of?

    <p>Three</p> Signup and view all the answers

    What are proteins made by joining together?

    <p>Amino acids</p> Signup and view all the answers

    What are ribosomes responsible for during the process of translation?

    <p>Decoding the mRNA message into a protein</p> Signup and view all the answers

    Which three components are involved directly in the translation process?

    <p>mRNA, tRNA, ribosome</p> Signup and view all the answers

    What does an anticodon on tRNA do?

    <p>Binds to a codon on mRNA</p> Signup and view all the answers

    The nucleotide sequence AUUUAACUGUUCUGUCUAGAG can be translated into how many sets of amino acids?

    <p>Three</p> Signup and view all the answers

    What is the role of tRNA during translation?

    <p>To carry amino acids to the ribosome</p> Signup and view all the answers

    What is the sequence AUG known for in the process of translation?

    <p>It is the codon for methionine</p> Signup and view all the answers

    Which step initiates the translation process?

    <p>When the ribosome attaches to an mRNA molecule</p> Signup and view all the answers

    Which process forms the final shape or functional form of a protein?

    <p>Protein folding</p> Signup and view all the answers

    Which two codons code for glutamic acid?

    <p>GAA and GAG</p> Signup and view all the answers

    How many possible three-base codons are there in the genetic code?

    <p>64</p> Signup and view all the answers

    What does the codon GAC code for?

    <p>Aspartic acid</p> Signup and view all the answers

    Which amino acid is specified by the codon UGG?

    <p>Tryptophan</p> Signup and view all the answers

    What is the function of the methionine codon AUG in protein synthesis?

    <p>It serves as the initiation or start codon.</p> Signup and view all the answers

    What does the verb 'specify' mean?

    <p>To identify precisely</p> Signup and view all the answers

    How many different codons specify leucine?

    <p>Six</p> Signup and view all the answers

    How many stop codons are there in the genetic code?

    <p>Three</p> Signup and view all the answers

    Study Notes

    Ribosomes and Protein Synthesis

    The Genetic Code

    • The genetic code is a language with four letters: A, C, G, and U.
    • The code is read three bases at a time, and each "word" is three bases long and corresponds to a single amino acid.
    • A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.

    Protein Synthesis

    • Proteins are made by joining amino acids together into chains called polypeptides.
    • The specific order of amino acids in a polypeptide determines the shape, chemical properties, and function of a protein.
    • Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.

    Translation

    • Translation is the process of decoding an mRNA message into a protein.
    • The sequence of bases in an mRNA molecule provides the instructions for building a protein.
    • A cell part called a ribosome acts like a tiny factory, carrying out the assembly tasks.
    • Ribosomes use the sequence of codons in mRNA to assemble amino acids into polypeptide chains.

    Steps in Translation

    • Translation begins when a ribosome attaches to an mRNA molecule in the cytoplasm.
    • As each codon passes through the ribosome, several molecules of tRNA bring the proper amino acids into the ribosome.
    • Each tRNA molecule carries just one kind of amino acid and has three unpaired bases that are together called an anticodon.
    • The ribosome has a second binding site for a tRNA molecule for the next codon.
    • The ribosome then attaches these amino acids to the growing chain.

    tRNA and rRNA in Translation

    • mRNA carries the coded message that directs the process.
    • tRNA delivers the amino acids.
    • rRNA holds ribosomal proteins in place and carries out the chemical reactions that join amino acids together.
    • The three types of RNA work together at a ribosome to synthesize a polypeptide.

    The Genetic Code Diagram

    • The genetic code diagram shows how each codon specifies a particular amino acid.
    • There are 64 possible three-base codons in the genetic code.
    • Most amino acids can be specified by more than one codon.
    • The codon AUG also serves as the initiation, or "start," codon for protein synthesis.
    • The three "stop" codons specify when no amino acids should be added, and synthesis should cease.

    Start and Stop Codons

    • The methionine codon AUG serves as the initiation, or "start," codon for protein synthesis.
    • The three "stop" codons end translation.
    • At that point, the polypeptide is complete.

    Overview of Transcription and Translation

    • DNA encodes the information for an organism's traits.
    • mRNA transcribes the genes and then tRNA builds the proteins.
    • These proteins produce the organism's traits.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Description

    Learn about the genetic code, mRNA, and the role of ribosomes in assembling proteins. Discover how molecular biology relates to genetics.

    More Like This

    Molecular Genetics Lecture 3
    47 questions

    Molecular Genetics Lecture 3

    CharitableBronze avatar
    CharitableBronze
    Translation and Protein Synthesis Quiz
    10 questions

    Translation and Protein Synthesis Quiz

    FlatterAspen avatar
    FlatterAspen
    Understanding Types of RNA
    18 questions

    Understanding Types of RNA

    BlitheMulberryTree avatar
    BlitheMulberryTree
    Protein Synthesis Basics Quiz
    12 questions

    Protein Synthesis Basics Quiz

    PowerfulTopaz avatar
    PowerfulTopaz
    Use Quizgecko on...
    Browser
    Open
    Browser
    Browser