q1

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is DNA made up of?

  • Amino acids and phosphate
  • Amino acids
  • Nucleotides (correct)
  • Deoxyribose

How is Ribose linked to phosphate in RNA?

  • Amide bond
  • Phosphodiester bond (correct)
  • Glycosidic bond
  • Hydrogen bond

How many base pairs are there in a full turn of a DNA molecule?

  • 18 (correct)
  • 30
  • 15
  • 20

What is the backbone of DNA made of?

<p>Deoxyribose and phosphate (D)</p> Signup and view all the answers

Which nitrogen bases are found in DNA?

<p>Adenine, guanine, cytosine, thymine (C)</p> Signup and view all the answers

Which of the following oligonucleotides could form a hairpin structure?

<p>GGCTAATACGGGGGCGTATTAGCC (A)</p> Signup and view all the answers

If a piece of 100 bp DNA has 32 cytosine, how many thymine is present in that DNA?

<p>60 (C)</p> Signup and view all the answers

Which of the following DNAs has mirror repeats?

<p>5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (A), 5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (B), 5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (C)</p> Signup and view all the answers

Which of the following DNAs has a palindromic sequence?

<p>5’-GCCTTGTAGCGGATTAGCTTGG-3’ 3’-CGGAACATCGCCTAATCGAACC-5’ (A)</p> Signup and view all the answers

Flashcards are hidden until you start studying

Study Notes

DNA Structure

  • DNA is composed of nitrogen bases, sugar molecules, and phosphate groups.

RNA Structure

  • In RNA, ribose is linked to phosphate through a phosphodiester bond.

DNA Helix

  • One full turn of a DNA molecule consists of 10 base pairs.

DNA Backbone

  • The backbone of DNA is composed of sugar molecules and phosphate groups.

Nitrogen Bases in DNA

  • DNA contains the nitrogen bases adenine (A), guanine (G), cytosine (C), and thymine (T).

Hairpin Structure

  • An oligonucleotide with inverted repeats can form a hairpin structure.

DNA Composition

  • If a 100 bp DNA has 32 cytosine, it will have 32 guanine (since C-G pairing) and 36 thymine (since A-T pairing).

Mirror Repeats and Palindromic Sequences

  • DNA with inverted repeats has mirror repeats.
  • DNA with a sequence that reads the same forward and backward has a palindromic sequence.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

Practice Quiz-1 PDF
Use Quizgecko on...
Browser
Browser