q1
9 Questions
5 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is DNA made up of?

  • Amino acids and phosphate
  • Amino acids
  • Nucleotides (correct)
  • Deoxyribose
  • How is Ribose linked to phosphate in RNA?

  • Amide bond
  • Phosphodiester bond (correct)
  • Glycosidic bond
  • Hydrogen bond
  • How many base pairs are there in a full turn of a DNA molecule?

  • 18 (correct)
  • 30
  • 15
  • 20
  • What is the backbone of DNA made of?

    <p>Deoxyribose and phosphate</p> Signup and view all the answers

    Which nitrogen bases are found in DNA?

    <p>Adenine, guanine, cytosine, thymine</p> Signup and view all the answers

    Which of the following oligonucleotides could form a hairpin structure?

    <p>GGCTAATACGGGGGCGTATTAGCC</p> Signup and view all the answers

    If a piece of 100 bp DNA has 32 cytosine, how many thymine is present in that DNA?

    <p>60</p> Signup and view all the answers

    Which of the following DNAs has mirror repeats?

    <p>5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’</p> Signup and view all the answers

    Which of the following DNAs has a palindromic sequence?

    <p>5’-GCCTTGTAGCGGATTAGCTTGG-3’ 3’-CGGAACATCGCCTAATCGAACC-5’</p> Signup and view all the answers

    Study Notes

    DNA Structure

    • DNA is composed of nitrogen bases, sugar molecules, and phosphate groups.

    RNA Structure

    • In RNA, ribose is linked to phosphate through a phosphodiester bond.

    DNA Helix

    • One full turn of a DNA molecule consists of 10 base pairs.

    DNA Backbone

    • The backbone of DNA is composed of sugar molecules and phosphate groups.

    Nitrogen Bases in DNA

    • DNA contains the nitrogen bases adenine (A), guanine (G), cytosine (C), and thymine (T).

    Hairpin Structure

    • An oligonucleotide with inverted repeats can form a hairpin structure.

    DNA Composition

    • If a 100 bp DNA has 32 cytosine, it will have 32 guanine (since C-G pairing) and 36 thymine (since A-T pairing).

    Mirror Repeats and Palindromic Sequences

    • DNA with inverted repeats has mirror repeats.
    • DNA with a sequence that reads the same forward and backward has a palindromic sequence.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    Practice Quiz-1 PDF

    Description

    Test your knowledge on nucleotides and DNA with this practice quiz. Identify the components of a nucleotide, understand the structure of DNA, and learn about the link between ribose and phosphate in RNA. Perfect for biology enthusiasts and students studying genetics.

    Use Quizgecko on...
    Browser
    Browser