q1
9 Questions
5 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is DNA made up of?

  • Amino acids and phosphate
  • Amino acids
  • Nucleotides (correct)
  • Deoxyribose
  • How is Ribose linked to phosphate in RNA?

  • Amide bond
  • Phosphodiester bond (correct)
  • Glycosidic bond
  • Hydrogen bond
  • How many base pairs are there in a full turn of a DNA molecule?

  • 18 (correct)
  • 30
  • 15
  • 20
  • What is the backbone of DNA made of?

    <p>Deoxyribose and phosphate (D)</p> Signup and view all the answers

    Which nitrogen bases are found in DNA?

    <p>Adenine, guanine, cytosine, thymine (C)</p> Signup and view all the answers

    Which of the following oligonucleotides could form a hairpin structure?

    <p>GGCTAATACGGGGGCGTATTAGCC (A)</p> Signup and view all the answers

    If a piece of 100 bp DNA has 32 cytosine, how many thymine is present in that DNA?

    <p>60 (C)</p> Signup and view all the answers

    Which of the following DNAs has mirror repeats?

    <p>5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (A), 5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (B), 5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ (C)</p> Signup and view all the answers

    Which of the following DNAs has a palindromic sequence?

    <p>5’-GCCTTGTAGCGGATTAGCTTGG-3’ 3’-CGGAACATCGCCTAATCGAACC-5’ (A)</p> Signup and view all the answers

    Study Notes

    DNA Structure

    • DNA is composed of nitrogen bases, sugar molecules, and phosphate groups.

    RNA Structure

    • In RNA, ribose is linked to phosphate through a phosphodiester bond.

    DNA Helix

    • One full turn of a DNA molecule consists of 10 base pairs.

    DNA Backbone

    • The backbone of DNA is composed of sugar molecules and phosphate groups.

    Nitrogen Bases in DNA

    • DNA contains the nitrogen bases adenine (A), guanine (G), cytosine (C), and thymine (T).

    Hairpin Structure

    • An oligonucleotide with inverted repeats can form a hairpin structure.

    DNA Composition

    • If a 100 bp DNA has 32 cytosine, it will have 32 guanine (since C-G pairing) and 36 thymine (since A-T pairing).

    Mirror Repeats and Palindromic Sequences

    • DNA with inverted repeats has mirror repeats.
    • DNA with a sequence that reads the same forward and backward has a palindromic sequence.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    Practice Quiz-1 PDF

    Description

    Test your knowledge on nucleotides and DNA with this practice quiz. Identify the components of a nucleotide, understand the structure of DNA, and learn about the link between ribose and phosphate in RNA. Perfect for biology enthusiasts and students studying genetics.

    More Like This

    Use Quizgecko on...
    Browser
    Browser