Practice Quiz-1 PDF
Document Details
Uploaded by BrightestOnyx318
null
Tags
Summary
This is a practice quiz on the topic of DNA and RNA, covering nucleotide components, DNA structure, and other related concepts. The quiz contains multiple-choice questions. Suitable for secondary school students taking biology.
Full Transcript
Practice Quiz 1. Three components of a nucleotide are a) Adenine, Guanine, Ribose b) Base, Ribose, phosphate c) Ribose, deoxyribose, phosphate d) Cytosin, Uracil, Phosphate e) Ionosin, Uracil, Thymidine 2. DNA is a polymer of a) Amino acids b) Amino acids and phosphate c) Deoxyribose d) Nucleotides...
Practice Quiz 1. Three components of a nucleotide are a) Adenine, Guanine, Ribose b) Base, Ribose, phosphate c) Ribose, deoxyribose, phosphate d) Cytosin, Uracil, Phosphate e) Ionosin, Uracil, Thymidine 2. DNA is a polymer of a) Amino acids b) Amino acids and phosphate c) Deoxyribose d) Nucleotides e) Adenosine triphosphate 3. Ribose is linked to phosphate in RNA by a) Glycosidic bond b) Hydrogen bond c) Phosphodiester bond d) Amide bond e) None of the above 4. Numbers of base pairs in a full turn of a DNA molecule are a) 15 b) 18 c) 30 d) 20 e) 10 5. The backbone of DNA is made of a) Ribose and base b) Ribose and phosphate c) Base and phosphate d) Deoxyribose and phosphate e) Ribose 6. Four nitrogen bases in DNA are a) Adenosine, guanosine, thymidine, uracil b) Adenosine, cytidine, thymidine, guanosine c) Adenine, guanine cytosine, thymine d) Adenine, uridine, thymidine, cytidine e) Adenosine, Ionosine, uracil, thymidine 7. Which one of the following oligonucleotides could form the hairpin structure? a) AATTGCAGTATACTGCAATT b) GGCTAATACGGGGGCGTATTAGCC c) AATTGCAGTAAATTGCAGTA d) AATTGCAGTAATTGCAGTAATTGCAGT e) CCATAGCGCGCGGTAT 8. If a piece of 100 bp DNA have 32 cytosine, how many thymine is present in that DNA? a) 35 b) 40 c) 18 d) 60 e) 25 9. Which of the following DNAs has mirror repeats? a) 5’-CCTGGTAACCGTTGCCAATGGTCC-3’ 3’-GGACCATTGGCAACGGTTACCAGG-5’ b) 5’-ATGCGGGGCTCTGGTACCTTGG-3’ 3’-TACGCCCCGAGACCATGGAACC-5’ 10. Which of the following DNAs has palindromic sequence? a) 5’-AAATGCCGAATTCTTGGCTA-3’. 3’-TTTACGGCTTAAGAACCGAT-5’ b) 5’-GCCTTGTAGCGGATTAGCTTGG-3’ 3’-CGGAACATCGCCTAATCGAACC-5’ 11. Which form of DNA is more common under normal physiological condition? a) A and B b) B c) C and D d) Z e) A and Z 12. You have a template DNA with GC/AT ratio 70/30. After 30 cycles of amplification what would be the GC/AT ratio of the PCR product a) 7/3 X 30 b) 7/3 X 60 c) 70/30 d) 35/15
