NEET Botany Solved Paper

Botany

• Plant Kingdom:
  • In moss, the first stage of gametophyte is the protonema stage.
  • Protonema develops directly from spores produced in the capsule.
• Morphology of Flowering Plants:
  • Family Fabaceae differs from Solanaceae and Liliaceae in terms of stamens.
  • Diadelphous and dithecous anthers are characteristic of Fabaceae.
  • Axile placentation is observed in China rose, Petunia, and Lemon.
• Anatomy of Flowering Plants:
  • Endarch and exarch are terms used to describe the position of secondary xylem in the plant body.
  • Exarch condition is a common feature of the root system.
  • Late wood has fewer xylary elements with narrow vessels due to less active cambium in winters.

Cell Cycle and Cell Division

• Replication of DNA in eukaryotes takes place in the S phase.
• Meiosis involves the following stages:
  • Prophase I: appearance of recombination nodules occurs at the pachytene substage.
  • Metaphase II: division of centromere occurs.
• ATP is used at two steps in glycolysis: converting glucose into glucose-6-phosphate and converting fructose-6-phosphate into fructose-1-6-diphosphate.

Transport in Plants

• Movement and accumulation of ions across a membrane against their concentration gradient can be explained by active transport.
• Transpiration cools leaf surfaces by 10-15 degrees due to evaporative cooling.

Biomolecules

• Cellulose does not form a blue color with iodine because it is a helical molecule and does not hold iodine molecules.
• RNA polymerase III is involved in the transcription of tRNA, 5S rRNA, and snRNA in eukaryotes.
• Expressed Sequence Tags (ESTs) refer to certain important expressed genes.

Principles of Inheritance and Variation

• The phenomenon of pleiotropism refers to a single gene affecting multiple phenotypic expressions.
• Frequency of recombination between gene pairs on the same chromosome is used to map their position on the chromosome.

Molecular Basis of Inheritance

• Unequivocal proof that DNA is the genetic material was first proposed by Alfred Hershey and Martha Chase.
• In gene gun method, microparticles of tungsten or gold are used to introduce alien DNA into host cells.

Biotechnology: Principles and Processes

• The role of RNA polymerase III in transcription is to transcribe tRNA, 5S rRNA, and snRNA in eukaryotes.
• Main steps in the formation of recombinant DNA are:
  1. Cutting of DNA at specific locations by restriction enzyme.
  2. Isolation of the desired DNA fragment.
  3. Insertion of recombinant DNA into the host cell.
  4. Amplification of the gene of interest using PCR.

Environmental Issues

• The thickness of ozone in a column of air in the atmosphere is measured in Dobson units.### Organisms and Populations
• Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely, and the competitively inferior one will be eliminated eventually.
• Carnivores are more adversely affected by competition than herbivores.

Photosynthesis in Higher Plants

• Chemiosmosis requires a proton pump, electron gradient, and ATP synthase.

Respiration in Plants

• Oxidative decarboxylation is related to Citrate synthase.
• Glycolysis is related to Pyruvate.
• Oxidative phosphorylation is related to Electron transport system.
• Tricarboxylic acid cycle is related to EMP pathway.

Principles of Inheritance and Variation

• Klinefelter's Syndrome: individual has overall masculine development, but feminine development is also expressed; affected individual is short-statured, and physical, psychomotor and mental development is retarded; individuals are sterile.

Environmental Issues

• Bioaccumulation: amount of some toxic substances of industrial waste increases in organisms at successive trophic levels.
• Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
• Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics.

Zoology

• Radial symmetry is not found in adults of phylum Echinodermata.
• Taenia has Nephridia, Paramoecium has Contractile vacuole, Periplaneta has Flame cells, and Pheretima has Urecose gland.

Structural Organisation in Animals

• Ligaments are dense irregular tissue, and Cartilage is dense regular tissue.

Cell: The Unit of Life

• Mitochondria, Chloroplasts, and Peroxisomes are not considered part of the endomembrane system.
• Cytoskeleton performs functions of transportation, nuclear division, protein synthesis, and motility.

Biomolecules

• Low temperature preserves the enzyme in a temporarily inactive state, whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
• Competitive inhibitor is a molecule that closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme.

Digestion and Absorption

• Peptic cells secrete Mucus, Goblet Cells secrete Bile Juice, Oxyntic Cell secretes Proenzyme Pepsinogen, and Hepatic cells secrete HCl and intrinsic factor for absorption of vitamin B12.

Breathing and Exchange of Gases

• Vital capacity of lung is IRV + ERV + TV.

Body Fluids and Circulation

• P-wave represents the beginning of systole, Q-wave represents repolarisation of ventricles, QRS complex represents depolarisation of atria, and T-wave represents depolarisation of ventricles.

Excretory Products and their Elimination

• Nephrons are of two types: Cortical and Juxta medullary, based on their relative position in cortex and medulla.

Human Reproduction

• Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
• The cavity of the cervix is called the cervical canal, which along with the vagina forms the birth canal.

Locomotion and Movement

• Cartilaginous Joint is found between adjacent vertebrae in vertebral column, Ball and Socket Joint is found between humerus and pectoral girdle, and Fibrous Joint is found between carpal and metacarpal of thumb.

Principles of Inheritance and Variation

• Broad palm with a single palm crease is visible in a person suffering from Down's syndrome.
• RNA mutates at a faster rate, and viruses having RNA genome and shorter life span mutate and evolve faster.

Reproductive Health

• Gonorrhoea is a common sexually transmitted disease that is completely curable when detected early and treated properly.### Gene and Protein Expression
• Gene 'i' is linked to Permease, while Gene 'z' is linked to Repressor protein.
• In prokaryotes, positively charged DNA is held with negatively charged proteins in a region called the nucleoid.
• In eukaryotes, negatively charged DNA is wrapped around positively charged histone octamer to form nucleosome.

Biotechnology

• pBR322 is a cloning vector.
• ELISA (Enzyme Linked Immuno-Sorbent Assay) is a technique used for the early diagnosis of diseases.
• Recombinant DNA Technology is a technique used for the early diagnosis of diseases.
• PCR (Polymerase Chain Reaction) technique is a technique used for the early diagnosis of diseases.

Evolution

• Numbat, Spotted cuscus, and Flying phalanger are examples of Australian Marsupials that exhibit adaptive radiation.
• Lemur, Anteater, and Wolf are not examples of Australian Marsupials that exhibit adaptive radiation.

Organisms and Populations

• A Leopard and a Lion in a forest/grassland exhibit Competition.
• A Cuckoo laying egg in a Crow's nest exhibits Brood parasitism.
• Fungi and root of a higher plant in Mycorrhizae exhibit Mutualism.
• A cattle egret and a Cattle exhibit Commensalism.

Human Health and Disease

• Ringworm is caused by Trichophyton.
• Filariasis is caused by Wuchereria bancrofti.
• Malaria is caused by Plasmodium vivax.
• Pneumonia is not specifically caused by any of the above organisms.

Environmental Issues

• Algal Bloom does not decrease fish mortality.
• Eutrophication refers to an increase in domestic sewage and waste water in lakes.
• Biomagnification refers to an increase in concentration of the toxicant at successive trophic levels.
• Presence of a large amount of nutrients in water restricts 'Algal Bloom'.

Zoology

• HIV undergoes replication and produces progeny viruses in TH cells.
• Unique mammalian characteristics include pinna, monocondylic skull, and mammary glands.
• In cockroach, excretion is brought about by Malpighian tubules.
• Phallic gland, Urecose gland, and Nephrocytes are not responsible for excretion in cockroach.

Cell Cycle and Cell Division

• During Go phase of cell cycle, the cell is metabolically inactive.
• The centrosome undergoes duplication during S phase of interphase.
• Tetrad formation is seen during Leptotene.
• During Anaphase, the centromere splits and chromatids separate.
• Terminalization takes place during Pachytene.

Structural Organisation in Animals

• In cockroach, the presence of anal styles is a characteristic feature of sexual dimorphism.

Body Fluids and Circulation

• Basophils are involved in inflammatory response.
• Basophils secrete histamine, serotonin, and heparin.
• Basophils have a kidney-shaped nucleus.

Molecular Basis of Inheritance

• The sequence on the corresponding coding strand, if the sequence on mRNA formed is as follows: 5'AUCGAUCGAUCGAUCGAUCG
• The correct sequence is: 3'ATCGATCGATCGATCGATCG

Locomotion and Movement

• Muscle bundles are held together by collagenous connective tissue layer called fascicle.
• Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
• Striated appearance of skeletal muscle fibre is due to the distribution pattern of actin and myosin proteins.
• M line is considered as the functional unit of contraction called sarcomere.

Food Production

• Inbreeding decreases the productivity of inbred population, after continuous inbreeding.
• Inbreeding decreases homozygosity.
• Inbreeding exposes harmful recessive genes that are eliminated by selection.
• Elimination of less desirable genes and accumulation of superior genes take place due to inbreeding.

Strategies for Enhancement in Food Production

• Logistic growth is a condition of unlimited resource availability.
• Exponential growth is a condition of limited resource availability.
• Expanding age pyramid is a condition where the percent of individuals of pre-reproductive age is largest, followed by reproductive and post-reproductive age groups.
• Stable age pyramid is a condition where the percent of individuals of pre-reproduction and reproductive age groups are the same.