Podcast Beta
Questions and Answers
What is the characteristic color assigned to the start and stop codons in the gene structure diagram?
Which region of the nucleotide sequence is typically associated with the regulation of transcription and is represented in brown?
What characteristic is most important when designing primers for a nucleotide sequence in PCR?
Which of the following regions is NOT typically included when discussing protein coding sequences (CDS)?
Signup and view all the answers
Which option refers to the short sequences that are often used to identify genes when searching for Expressed Sequence Tags (ESTs)?
Signup and view all the answers
Which accession number is associated with a nucleotide sequence that can be retrieved from NCBI?
Signup and view all the answers
What information can you obtain regarding NM_000454.5 by searching on NCBI?
Signup and view all the answers
What type of sequence is NM_000454.5 primarily classified as?
Signup and view all the answers
When performing a BLAST search, which of the following is not necessary to document?
Signup and view all the answers
What information do you obtain from conducting a multiple sequence alignment?
Signup and view all the answers
Which program can be used to create a phylogenetic tree?
Signup and view all the answers
What is the expected output after conducting a BLAST analysis?
Signup and view all the answers
What is one key step when searching protein sequences associated with a gene?
Signup and view all the answers
Study Notes
NCBI Retrieve Sequences
- Retrieve FASTA sequences (nucleotide and protein) using NCBI for the following accession numbers:
- NC_000019.10
- NM_001009481.1
- D86611.1
- AY515272.1
- L05910.1
Gene Analysis
- Retrieve nucleotide sequence for accession number NM_000454.5
- Determine the sequence length.
- Identify the gene name associated with the sequence.
- Determine the organism of origin for the gene.
- Classify the type of nucleotide sequence (e.g., mRNA, cDNA, genomic DNA).
Protein Analysis
- Retrieve amino acid sequence for the gene using accession number NM_000454.5.
- Determine the sequence length.
- Identify the family or superfamily to which the protein belongs.
- Write a 200-word summary on the significance of this protein based on information found in the PubMed database.
Homologous Sequence Search
- Perform a BLAST search for 5 homologous sequences for both the nucleotide and amino acid sequences.
- Include details of the BLAST method used, the database searched, and any limits applied.
- Display the 5 homologous sequences for each category in FASTA format.
Multiple Sequence Alignment
- Generate a multiple sequence alignment using the protein and nucleotide sequences and 5 additional members of the same family from different species.
- Present the multiple sequence alignment in your report using Courier font with appropriate sizing for readability.
Phylogenetic Tree Construction
- Create a phylogenetic tree using an online tool or software such as MEGA, PAUP, or Phylip.
- Include an image of the resulting cladogram or tree in your report.
Nucleotide Sequence Analysis
- Identify the organism of origin for the nucleotide sequence:
- ATTCTGCCCTCGAGCCCACCGGGAACGAAAGAGAAGCTCTATCTCCCCTCCAGGAGCCCAGCTATGAACT
- CCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTT
- CCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCT
- TCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTA
- ACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGC
- TGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTT
- TTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTG
- TGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCAC
- CCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATG
- ACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGT
- AGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGC
- ACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTA
- ATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTAC
- CACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTT
- GTTTCAGAGCCAGATCATTTCTTGGAAAGTGTAGGCTTACCTCAAATAAATGGCTAACTTATACATATTT
- TTAAAGAAATATTTATATTGTATTTATATAATGTATAAATGGTTTTTATACCAATAAATGGCATTTTAAA
- AAATTCA
- Determine the accession number, name, and type of the sequence.
- Calculate the size of the given sequence.
- Retrieve and display the protein sequence associated with this gene, including its accession number.
Gene Structure Analysis
- Display the following regions of the nucleotide sequence:
- 5' and 3' UTR (grey)
- Start and stop codons (green)
- Exon-exon junctions (red)
- Signal peptides (yellow)
- CDS (light blue)
- Retrieve the promoter sequence and indicate the possible location of the TATAAT box (brown).
- Identify the top 2 Expressed Sequence Tags (ESTs) associated with the provided sequence.
Primer Design
- Design two possible primers for the sequence using primer blast or Primer premier.
- Display the results, including all primer characteristics.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
Related Documents
Description
This quiz covers multiple aspects of gene and protein analysis using NCBI databases. Participants will learn to retrieve sequences, analyze gene details, and perform homologous sequence searches while enhancing their understanding of bioinformatics tools. Get ready to dive into the world of genetic research!