Gene and Protein Analysis with NCBI
13 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the characteristic color assigned to the start and stop codons in the gene structure diagram?

  • Grey
  • Green (correct)
  • Red
  • Yellow
  • Which region of the nucleotide sequence is typically associated with the regulation of transcription and is represented in brown?

  • 3' UTR
  • Signal peptides
  • Promoter sequence (correct)
  • 5' UTR
  • What characteristic is most important when designing primers for a nucleotide sequence in PCR?

  • Melting temperature and specificity (correct)
  • Primer length only
  • Lack of secondary structures
  • GC content only
  • Which of the following regions is NOT typically included when discussing protein coding sequences (CDS)?

    <p>5' UTR</p> Signup and view all the answers

    Which option refers to the short sequences that are often used to identify genes when searching for Expressed Sequence Tags (ESTs)?

    <p>Short cDNA fragments</p> Signup and view all the answers

    Which accession number is associated with a nucleotide sequence that can be retrieved from NCBI?

    <p>NM_001009481.1</p> Signup and view all the answers

    What information can you obtain regarding NM_000454.5 by searching on NCBI?

    <p>All of the above</p> Signup and view all the answers

    What type of sequence is NM_000454.5 primarily classified as?

    <p>mRNA sequence</p> Signup and view all the answers

    When performing a BLAST search, which of the following is not necessary to document?

    <p>Time of the search</p> Signup and view all the answers

    What information do you obtain from conducting a multiple sequence alignment?

    <p>Phylogenetic relationships</p> Signup and view all the answers

    Which program can be used to create a phylogenetic tree?

    <p>MEGA</p> Signup and view all the answers

    What is the expected output after conducting a BLAST analysis?

    <p>Homologous sequences in FASTA format</p> Signup and view all the answers

    What is one key step when searching protein sequences associated with a gene?

    <p>Obtain the amino acid sequence length and family</p> Signup and view all the answers

    Study Notes

    NCBI Retrieve Sequences

    • Retrieve FASTA sequences (nucleotide and protein) using NCBI for the following accession numbers:
      • NC_000019.10
      • NM_001009481.1
      • D86611.1
      • AY515272.1
      • L05910.1

    Gene Analysis

    • Retrieve nucleotide sequence for accession number NM_000454.5
    • Determine the sequence length.
    • Identify the gene name associated with the sequence.
    • Determine the organism of origin for the gene.
    • Classify the type of nucleotide sequence (e.g., mRNA, cDNA, genomic DNA).

    Protein Analysis

    • Retrieve amino acid sequence for the gene using accession number NM_000454.5.
    • Determine the sequence length.
    • Identify the family or superfamily to which the protein belongs.
    • Write a 200-word summary on the significance of this protein based on information found in the PubMed database.
    • Perform a BLAST search for 5 homologous sequences for both the nucleotide and amino acid sequences.
    • Include details of the BLAST method used, the database searched, and any limits applied.
    • Display the 5 homologous sequences for each category in FASTA format.

    Multiple Sequence Alignment

    • Generate a multiple sequence alignment using the protein and nucleotide sequences and 5 additional members of the same family from different species.
    • Present the multiple sequence alignment in your report using Courier font with appropriate sizing for readability.

    Phylogenetic Tree Construction

    • Create a phylogenetic tree using an online tool or software such as MEGA, PAUP, or Phylip.
    • Include an image of the resulting cladogram or tree in your report.

    Nucleotide Sequence Analysis

    • Identify the organism of origin for the nucleotide sequence:
      • ATTCTGCCCTCGAGCCCACCGGGAACGAAAGAGAAGCTCTATCTCCCCTCCAGGAGCCCAGCTATGAACT
      • CCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTT
      • CCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCT
      • TCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTA
      • ACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGC
      • TGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTT
      • TTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTG
      • TGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCAC
      • CCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATG
      • ACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGT
      • AGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGC
      • ACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTA
      • ATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTAC
      • CACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTT
      • GTTTCAGAGCCAGATCATTTCTTGGAAAGTGTAGGCTTACCTCAAATAAATGGCTAACTTATACATATTT
      • TTAAAGAAATATTTATATTGTATTTATATAATGTATAAATGGTTTTTATACCAATAAATGGCATTTTAAA
      • AAATTCA
    • Determine the accession number, name, and type of the sequence.
    • Calculate the size of the given sequence.
    • Retrieve and display the protein sequence associated with this gene, including its accession number.

    Gene Structure Analysis

    • Display the following regions of the nucleotide sequence:
      • 5' and 3' UTR (grey)
      • Start and stop codons (green)
      • Exon-exon junctions (red)
      • Signal peptides (yellow)
      • CDS (light blue)
    • Retrieve the promoter sequence and indicate the possible location of the TATAAT box (brown).
    • Identify the top 2 Expressed Sequence Tags (ESTs) associated with the provided sequence.

    Primer Design

    • Design two possible primers for the sequence using primer blast or Primer premier.
    • Display the results, including all primer characteristics.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    Description

    This quiz covers multiple aspects of gene and protein analysis using NCBI databases. Participants will learn to retrieve sequences, analyze gene details, and perform homologous sequence searches while enhancing their understanding of bioinformatics tools. Get ready to dive into the world of genetic research!

    More Like This

    NCBI Quiz
    3 questions

    NCBI Quiz

    HeroicExuberance avatar
    HeroicExuberance
    NCBI Collection of Databases Overview Quiz
    5 questions

    NCBI Collection of Databases Overview Quiz

    UncomplicatedIntelligence8731 avatar
    UncomplicatedIntelligence8731
    Finding Protein Sequence and Gene Coding Region
    12 questions
    Use Quizgecko on...
    Browser
    Browser