BIO 405 Bioinformatics Practice Questions PDF

Summary

This document contains a set of questions that are related to bioinformatics. The questions include retrieving nucleotide and protein sequences from NCBI, calculating lengths and types of sequences, conducting alignment and analyzing phylogenetics.

Full Transcript

BIO 405. Bioinformatics. Practice Questions 1. Using NCBI Retrieve the FASTA sequences (Nucleotide and protein sequences) with the following accession numbers. a) NC_000019.10 b) NM_001009481.1 c) D86611.1 d) AY515272.1 e) L05910.1 2. Search this gene in NCBI and answer the...

BIO 405. Bioinformatics. Practice Questions 1. Using NCBI Retrieve the FASTA sequences (Nucleotide and protein sequences) with the following accession numbers. a) NC_000019.10 b) NM_001009481.1 c) D86611.1 d) AY515272.1 e) L05910.1 2. Search this gene in NCBI and answer the following questions: Accession number NM_000454.5 a) Retrieve and paste the nucleotide sequence. b) What is the length of the sequence? c) What is the name of this gene? d) What organism does it originate from? e) What type of nucleotide sequence is it? 3. Search the amino acid sequence associated with the above gene. a) Paste the amino acid sequence b) What is the length of the sequence c) What family/ superfamily does it belong to? d) Write a 200 word summary on the significance of this protein (PubMed database) 4. Search for 5 homologous sequences (BLAST) of the above nucleotide and amino acid sequence. a) For each category, paste 5 homologous sequences in FASTA format b) Include details of the BLAST method used, database searched and any limits applied 5. Conduct a multiple sequence alignment (Nucleotide and protein sequence): Generate a multiple sequence alignment with your protein and nucleotide sequence and a group of other members of this family from different species. A typical number of sequences to use in a multiple sequence alignment for this assignment is 5. Include the multiple sequence alignment in your report. Use Courier font with a size appropriate to fit page width. 6. Create a phylogenetic tress: Use “simple phylogeny” online or any respected phylogeny program (such as MEGA, PAUP, or Phylip). Paste an image of your Cladogram or tree output in your report. 7. Use the nucleotide sequence to answer the following qstns: ATTCTGCCCTCGAGCCCACCGGGAACGAAAGAGAAGCTCTATCTCCCCTCCAGGAGCCCAGCTATGAACT CCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTT CCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCT BIO 405. Bioinformatics. Practice Questions TCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTA ACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGC TGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTT TTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTG TGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCAC CCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATG ACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGT AGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGC ACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTA ATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTAC CACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTT GTTTCAGAGCCAGATCATTTCTTGGAAAGTGTAGGCTTACCTCAAATAAATGGCTAACTTATACATATTT TTAAAGAAATATTTATATTGTATTTATATAATGTATAAATGGTTTTTATACCAATAAATGGCATTTTAAA AAATTCA a. What organism does it originate from? b. What is the accession number, name, and type of the sequence c. What is the size of the above sequence? d. Retrieve and paste the protein sequence associated with this gene. (show accession number) 8. Study the gen structure of the above nucleotide: a. Show the following regions: 5` and 3` UTR (Grey), Start and stop codons (Green), Exon-Exon junctions (Red), Signal peptides (yellow), CDS (light blue). b. Retrieve the promoter sequence and show the possible location of the TATAAT Box ( Brown) c. Search for the top 2 Expressed sequence Tags (ESTs) of the above sequence. 9. Design 2 possible primers (and all its associated characteristics) for the above sequence. (Display your results). (Use primer blast or Primer premier).

Use Quizgecko on...
Browser
Browser