DNA Technology

What is the primary purpose of PCR (Polymerase Chain Reaction)?

Based on base-pairing rules, if a DNA strand has the sequence ACGGT, what would be its complementary strand?

During PCR, which enzyme is responsible for adding complementary bases to the template strand?

How do scientists typically cut DNA into smaller, manageable fragments?

What is the primary function of CODIS (Combined DNA Index System)?

What molecular biology technique is most appropriate when biologists need to create numerous copies of a specific DNA fragment?

In the human body, where is DNA primarily located?

What term describes the pattern of DNA fragments unique to an individual, obtained during DNA analysis?

During gel electrophoresis, which DNA strands migrate through the gel the fastest?

What is the net electrical charge of DNA?

What technique enables DNA to be copied outside of a living cell?

Which of the following statements about DNA is FALSE?

DNA fragments can be sorted based on their size using which technique?

What does the acronym CODIS stand for in the context of forensic DNA analysis?

What enzyme targets a specific base sequence and cuts DNA into smaller fragments?

Starting with two double-stranded DNA molecules, how many double-stranded DNA molecules would result after two cycles of PCR, assuming 100% efficiency?

On an electropherogram resulting from STR analysis, how are alleles typically represented?

If only one allele (one peak) is observed on an electropherogram for a particular STR locus, what does this indicate about the genotype at that locus?

How many core STR regions are typically analyzed for CODIS in the United States?

Which two molecules form the sides (backbone) of the DNA ladder structure?

Within the DNA sequence TGCACGATCATCATCATAGCCCT, which region is repeated three times?

On human chromosomes, what characteristic does the AMEL locus (location) indicate?

At a particular STR locus, an individual has two different lengths of the STR repeat. How is the frequency of this genotype calculated for population genetics?

Who is credited with discovering DNA fingerprinting?

Since STR segments are inherited from parents, how many alleles do you possess for each STR segment?

During PCR, at what temperature is the initial melting stage used to separate DNA into single strands?

Which choice below best describes non-coding DNA?

Will the sugar phosphate backbone structure vary from different sources of DNA?

Will DNA samples taken from a person and a Twin have the same bases?

What sequence do restriction enzymes use to determine where to cut portions of DNA?