Podcast
Questions and Answers
What do the letters DNA stand for?
What do the letters DNA stand for?
Deoxyribonucleic acid
What are the names of the two scientists credited for discovering the structure of DNA?
What are the names of the two scientists credited for discovering the structure of DNA?
James Watson and Francis Crick
What are the monomers in DNA called?
What are the monomers in DNA called?
Nucleotides
What are the 'backbone' of the DNA molecule?
What are the 'backbone' of the DNA molecule?
What are the names of the 4 different monomer bases in DNA?
What are the names of the 4 different monomer bases in DNA?
Purines have __ ring(s) in their structure, and pyrimidines have __ ring(s) in their structure.
Purines have __ ring(s) in their structure, and pyrimidines have __ ring(s) in their structure.
What are the two purine bases?
What are the two purine bases?
What are the two pyrimidine bases?
What are the two pyrimidine bases?
Chargaff's rule states that the DNA of any species contains equal amounts of ________ and _________ and also equal amounts of _________ and _________.
Chargaff's rule states that the DNA of any species contains equal amounts of ________ and _________ and also equal amounts of _________ and _________.
Based on this information, scientists could predict that the base _______ pairs with _____ and the base _______ pairs with _________.
Based on this information, scientists could predict that the base _______ pairs with _____ and the base _______ pairs with _________.
This one strand of DNA is complementary to the other ______ strand.
This one strand of DNA is complementary to the other ______ strand.
The bases are paired by _______ bonds along the axis of the molecule.
The bases are paired by _______ bonds along the axis of the molecule.
Wilkins and Franklin studied the structure of DNA using _____________, a technique to examine molecules, and helped Watson and Crick determine that the shape of the molecule was a _______ _______.
Wilkins and Franklin studied the structure of DNA using _____________, a technique to examine molecules, and helped Watson and Crick determine that the shape of the molecule was a _______ _______.
Write a complementary sequence to AATTCGCCGGTATTAGACGTT.
Write a complementary sequence to AATTCGCCGGTATTAGACGTT.
Finish the sequence; Left side: ATGC _, _, Right side: _, _, _, _, _, _,.
Finish the sequence; Left side: ATGC _, _, Right side: _, _, _, _, _, _,.
Flashcards are hidden until you start studying
Study Notes
DNA Overview
- DNA stands for Deoxyribonucleic acid, a vital macromolecule for all living organisms.
- Watson and Crick are renowned for discovering the double helix structure of DNA.
DNA Structure Components
- DNA is composed of monomers called nucleotides.
- The backbone of the DNA molecule consists of deoxyribose sugar and phosphate groups linked by phosphodiester bonds.
Nitrogenous Bases
- Four different nitrogenous bases in DNA: Thymine (T), Adenine (A), Guanine (G), Cytosine (C).
- Bases can be categorized into two types: purines (Adenine and Guanine) and pyrimidines (Thymine and Cytosine).
- Purines have a double-ring structure; pyrimidines have a single-ring structure.
Chargaff's Rule
- Chargaff's rule indicates that in any species, the amount of Guanine equals that of Cytosine, and the amount of Adenine equals that of Thymine.
Base Pairing
- Base pairing: Adenine pairs with Thymine, and Guanine pairs with Cytosine, forming complementary base pairs.
- Each DNA strand is complementary to the opposite strand.
Molecular Interactions
- The nitrogenous bases are connected by hydrogen bonds along the axis of the DNA molecule.
Contributions of Wilkins and Franklin
- Wilkins and Franklin utilized X-Ray Crystallography to analyze DNA structure, aiding in the confirmation of the double helix shape.
Sequence Complementarity
- Example of a complementary DNA sequence:
- Given strand: AATTCGCCGGTATTAGACGTT
- Complementary strand: TTAAGCGGCCATAATCTGCAA
DNA Sequence Completion
- Completing a partial DNA sequence:
- Left side: ATGC AC
- Right side: TACGTG
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.