DNA Structure Worksheet Flashcards

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What do the letters DNA stand for?

Deoxyribonucleic acid

What are the names of the two scientists credited for discovering the structure of DNA?

James Watson and Francis Crick

What are the monomers in DNA called?

Nucleotides

What are the 'backbone' of the DNA molecule?

<p>A and B (A)</p> Signup and view all the answers

What are the names of the 4 different monomer bases in DNA?

<p>Thymine, Adenine, Guanine, Cytosine</p> Signup and view all the answers

Purines have __ ring(s) in their structure, and pyrimidines have __ ring(s) in their structure.

<p>2 rings, 1 ring</p> Signup and view all the answers

What are the two purine bases?

<p>Adenine and Guanine</p> Signup and view all the answers

What are the two pyrimidine bases?

<p>Thymine and Cytosine</p> Signup and view all the answers

Chargaff's rule states that the DNA of any species contains equal amounts of ________ and _________ and also equal amounts of _________ and _________.

<p>Guanine and Cytosine, Adenine and Thymine</p> Signup and view all the answers

Based on this information, scientists could predict that the base _______ pairs with _____ and the base _______ pairs with _________.

<p>Adenine and Thymine, Guanine and Cytosine</p> Signup and view all the answers

This one strand of DNA is complementary to the other ______ strand.

<p>Opposite</p> Signup and view all the answers

The bases are paired by _______ bonds along the axis of the molecule.

<p>Hydrogen</p> Signup and view all the answers

Wilkins and Franklin studied the structure of DNA using _____________, a technique to examine molecules, and helped Watson and Crick determine that the shape of the molecule was a _______ _______.

<p>X-Ray Crystallography, Double Helix</p> Signup and view all the answers

Write a complementary sequence to AATTCGCCGGTATTAGACGTT.

<p>TTAAGCGGCCATAATCTGCAA</p> Signup and view all the answers

Finish the sequence; Left side: ATGC _, _, Right side: _, _, _, _, _, _,.

<p>AC, TACGTG</p> Signup and view all the answers

Flashcards are hidden until you start studying

Study Notes

DNA Overview

  • DNA stands for Deoxyribonucleic acid, a vital macromolecule for all living organisms.
  • Watson and Crick are renowned for discovering the double helix structure of DNA.

DNA Structure Components

  • DNA is composed of monomers called nucleotides.
  • The backbone of the DNA molecule consists of deoxyribose sugar and phosphate groups linked by phosphodiester bonds.

Nitrogenous Bases

  • Four different nitrogenous bases in DNA: Thymine (T), Adenine (A), Guanine (G), Cytosine (C).
  • Bases can be categorized into two types: purines (Adenine and Guanine) and pyrimidines (Thymine and Cytosine).
  • Purines have a double-ring structure; pyrimidines have a single-ring structure.

Chargaff's Rule

  • Chargaff's rule indicates that in any species, the amount of Guanine equals that of Cytosine, and the amount of Adenine equals that of Thymine.

Base Pairing

  • Base pairing: Adenine pairs with Thymine, and Guanine pairs with Cytosine, forming complementary base pairs.
  • Each DNA strand is complementary to the opposite strand.

Molecular Interactions

  • The nitrogenous bases are connected by hydrogen bonds along the axis of the DNA molecule.

Contributions of Wilkins and Franklin

  • Wilkins and Franklin utilized X-Ray Crystallography to analyze DNA structure, aiding in the confirmation of the double helix shape.

Sequence Complementarity

  • Example of a complementary DNA sequence:
    • Given strand: AATTCGCCGGTATTAGACGTT
    • Complementary strand: TTAAGCGGCCATAATCTGCAA

DNA Sequence Completion

  • Completing a partial DNA sequence:
    • Left side: ATGC AC
    • Right side: TACGTG

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

More Like This

Use Quizgecko on...
Browser
Browser