18 Questions
Which enzyme is responsible for relaxing supercoiled DNA upstream of the replication fork?
Helicase
During DNA replication, which enzyme synthesizes a single, continuous strand of DNA?
DNA polymerase
What is the role of RNA primers in DNA synthesis?
Help initiate DNA synthesis
At what stage of gene expression can regulation occur except?
During replication
If a TATA box blocks transcription factors in eukaryotic gene regulation, what would be the consequence?
Decreased gene expression
What conclusion would Avery, MacLeod, and McCarty have made if protease-treated heat-killed bacteria did not transform bacteria in their experiment?
Protein is the genetic material
Which of the following is true about the role of a bacterial operon?
Operons can regulate gene expression efficiently.
What is the function of SSB proteins in DNA replication?
Stabilize the two DNA strands to prevent them from snapping back together.
In gene expression, what is the role of poly-A tail?
Inhibit mRNA degradation.
What happens when genes that create female-specific tissue are turned off?
The expression of male-specific tissue genes decreases.
Which activity of DNA polymerase III is essential for maintaining DNA integrity during replication?
3' to 5' exonuclease activity
How does complementary base pairing contribute to DNA stability?
It stabilizes the sugar-phosphate backbone of DNA.
What is the likely effect of a mutation in the DNA sequence GAGAGAUACAGAGAGAGAGAGAGAGAG to GAGAGAUACAGAAGAGAGATCGAGAGA on the amino acid sequence?
met-ser-ser-leu
In a negative repressible operon, what type of protein is the regulator synthesized as?
an inactive repressor
When a protein binds a DNA sequence upstream of a promoter and increases transcription, what type of protein is most likely binding?
Enhancer
Where does RNA polymerase bind in an operon?
Promoter
What is the function of an activator in gene expression regulation?
Binds to DNA to enhance transcription
Where do activators bind in the context of gene expression regulation?
Enhancer
Study Notes
Gene Regulation and Expression
- Gene regulation can be achieved by turning off genes that create male- or female-specific tissue.
DNA and RNA
- A particular triplet of bases in the non-template strand of DNA is AGT, corresponding to the mRNA transcribed codon AGU.
- DNA strands possess complementary base pairing and run antiparallel in direction.
- SSB proteins stabilize the two DNA strands, preventing them from snapping back together.
mRNA and Translation
- The 5' cap and poly-A tail help stabilize mRNA by inhibiting its degradation.
- RNA primers help initiate DNA synthesis.
DNA Replication and Repair
- DNA polymerase synthesizes a single, continuous strand of DNA.
- Helicase helps relax supercoiled DNA upstream of the replication fork.
tRNA and Wobble
- Through wobble, a single tRNA can pair with multiple codons in mRNA.
Transformation and Genetic Material
- Avery, MacLeod, and McCarty's experiment would suggest that DNA is the genetic material, as samples treated with RNase and DNase, but not protease, transformed bacteria.
Gene Regulation
- Gene expression can be regulated during transcription, replication, translation, post-transcription, and post-translation.
- The TATA box in eukaryotic gene regulation indicates where transcription should begin.
Mutations and Amino Acid Sequences
- A mutated DNA sequence can generate a different amino acid sequence.
Operon Regulation
- In a negative repressible operon, the regulator protein is synthesized as an inactive repressor.
- An enhancer protein binds DNA several hundred base pairs upstream of a promoter, increasing the rate of transcription of the gene.
Operon Components
- A promoter is the site where RNA polymerase binds to the operon.
- An operator is the site where repressors bind.
Test your knowledge on DNA mutations and amino acid translation with this quiz question. Analyze the given mutated DNA sequence and determine the resulting amino acid sequence. Choose the correct option based on the mutation provided.
Make Your Own Quizzes and Flashcards
Convert your notes into interactive study material.
Get started for free
