DNA Sequence Mutation and Amino Acid Translation Quiz

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

Which enzyme is responsible for relaxing supercoiled DNA upstream of the replication fork?

  • Helicase (correct)
  • DNA ligase
  • Topoisomerase
  • RNA polymerase

During DNA replication, which enzyme synthesizes a single, continuous strand of DNA?

  • Primase
  • DNA ligase
  • DNA polymerase (correct)
  • Topoisomerase

What is the role of RNA primers in DNA synthesis?

  • Help initiate DNA synthesis (correct)
  • Provide a template for DNA polymerase
  • Proofread the DNA sequence
  • Stabilize the newly synthesized DNA strand

At what stage of gene expression can regulation occur except?

<p>During replication (C)</p> Signup and view all the answers

If a TATA box blocks transcription factors in eukaryotic gene regulation, what would be the consequence?

<p>Decreased gene expression (C)</p> Signup and view all the answers

What conclusion would Avery, MacLeod, and McCarty have made if protease-treated heat-killed bacteria did not transform bacteria in their experiment?

<p>Protein is the genetic material (D)</p> Signup and view all the answers

Which of the following is true about the role of a bacterial operon?

<p>Operons can regulate gene expression efficiently. (B)</p> Signup and view all the answers

What is the function of SSB proteins in DNA replication?

<p>Stabilize the two DNA strands to prevent them from snapping back together. (C)</p> Signup and view all the answers

In gene expression, what is the role of poly-A tail?

<p>Inhibit mRNA degradation. (D)</p> Signup and view all the answers

What happens when genes that create female-specific tissue are turned off?

<p>The expression of male-specific tissue genes decreases. (B)</p> Signup and view all the answers

Which activity of DNA polymerase III is essential for maintaining DNA integrity during replication?

<p>3' to 5' exonuclease activity (B)</p> Signup and view all the answers

How does complementary base pairing contribute to DNA stability?

<p>It stabilizes the sugar-phosphate backbone of DNA. (C)</p> Signup and view all the answers

What is the likely effect of a mutation in the DNA sequence GAGAGAUACAGAGAGAGAGAGAGAGAG to GAGAGAUACAGAAGAGAGATCGAGAGA on the amino acid sequence?

<p>met-ser-ser-leu (B)</p> Signup and view all the answers

In a negative repressible operon, what type of protein is the regulator synthesized as?

<p>an inactive repressor (C)</p> Signup and view all the answers

When a protein binds a DNA sequence upstream of a promoter and increases transcription, what type of protein is most likely binding?

<p>Enhancer (A)</p> Signup and view all the answers

Where does RNA polymerase bind in an operon?

<p>Promoter (A)</p> Signup and view all the answers

What is the function of an activator in gene expression regulation?

<p>Binds to DNA to enhance transcription (C)</p> Signup and view all the answers

Where do activators bind in the context of gene expression regulation?

<p>Enhancer (D)</p> Signup and view all the answers

Flashcards are hidden until you start studying

Study Notes

Gene Regulation and Expression

  • Gene regulation can be achieved by turning off genes that create male- or female-specific tissue.

DNA and RNA

  • A particular triplet of bases in the non-template strand of DNA is AGT, corresponding to the mRNA transcribed codon AGU.
  • DNA strands possess complementary base pairing and run antiparallel in direction.
  • SSB proteins stabilize the two DNA strands, preventing them from snapping back together.

mRNA and Translation

  • The 5' cap and poly-A tail help stabilize mRNA by inhibiting its degradation.
  • RNA primers help initiate DNA synthesis.

DNA Replication and Repair

  • DNA polymerase synthesizes a single, continuous strand of DNA.
  • Helicase helps relax supercoiled DNA upstream of the replication fork.

tRNA and Wobble

  • Through wobble, a single tRNA can pair with multiple codons in mRNA.

Transformation and Genetic Material

  • Avery, MacLeod, and McCarty's experiment would suggest that DNA is the genetic material, as samples treated with RNase and DNase, but not protease, transformed bacteria.

Gene Regulation

  • Gene expression can be regulated during transcription, replication, translation, post-transcription, and post-translation.
  • The TATA box in eukaryotic gene regulation indicates where transcription should begin.

Mutations and Amino Acid Sequences

  • A mutated DNA sequence can generate a different amino acid sequence.

Operon Regulation

  • In a negative repressible operon, the regulator protein is synthesized as an inactive repressor.
  • An enhancer protein binds DNA several hundred base pairs upstream of a promoter, increasing the rate of transcription of the gene.

Operon Components

  • A promoter is the site where RNA polymerase binds to the operon.
  • An operator is the site where repressors bind.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

More Like This

Exploring Gene Mutations
10 questions
Chapter 5: Understanding DNA Mutation
19 questions
SNP and Mutation in DNA Sequence
17 questions
Mutations and Their Types Quiz
21 questions

Mutations and Their Types Quiz

ImprovingFallingAction8885 avatar
ImprovingFallingAction8885
Use Quizgecko on...
Browser
Browser