Week 5 - Nucleic Acid Structure; Transcription F24 PDF

Nucleic Acid Structure LS 7A  Nucleic Acid Structure Learning Goal: Appreciate the structure and function of nucleic acids. After the pre-class assignments you should be able to: Discuss the central dogma of molecular biology. Describe the structure and orga...

Nucleic Acid Structure LS 7A  Nucleic Acid Structure Learning Goal: Appreciate the structure and function of nucleic acids. After the pre-class assignments you should be able to: Discuss the central dogma of molecular biology. Describe the structure and organization of DNA. Compare and contrast the structures of DNA and RNA. Provide the complementary sequences of a given sequence of DNA. Describe how gel electrophoresis separates nucleic acid fragments based on size. Describe how Southern blots allow specific genes or DNA sequences to be visualized on a gel. By the time you take the second Assessment of Learning you should also be able to: Explain what makes DNA a good molecule for information storage. Predict whether two nucleic acid molecules will hybridize based on their sequences. Interpret results from experiments using gel electrophoresis or Southern/Northern blots as a method. The Cell: The basic unit of life All cells need: Mechanism to separate and regulate the internal environment (membranes) to maintain homeostasis Mechanisms to acquire, transform, and use energy to power cellular processes Some form of information storage and transfer The Central Dogma of Molecular Biology transcription translation DNA RNA PROTEIN Arrows represent the flow of genetic information The Central Dogma of Molecular Biology transcription translation DNA RNA PROTEIN Copy Arrows represent the flow of genetic information  Where does all of this happen? Transcription Transcription Translation Translation Imagine you heat up a piece of double stranded DNA. Which bond(s) would be the first to break? (Remember, adding heat is adding energy) A. Hydrogen bonds would break first B. Covalent bonds would break first C. Hydrogen and covalent bonds would break around the same time D. You can’t break bonds by adding heat energy! Imagine you heat up a piece of double stranded DNA. Which bond(s) would be the first to break? (Remember, adding heat is adding energy) A. Hydrogen bonds would break first B. Covalent bonds would break first C. Hydrogen and covalent bonds would break around the same time D. You can’t break bonds by adding heat energy!  Denaturation/Renaturation of DNA Native DNA Denatured DNA Renatured DNA HEAT or OH- DNA denaturation Renaturation (DNA melting) (Annealing)  You have two molecules of DNA. The sequence of nucleotides in each molecule is shown below. Will these two molecules “melt” at the same temperature? A. Molecule 1 will melt at a Molecule 1: higher temperature ATTAAATTTATTATTA than Molecule 2 B. Molecule 1 will melt at a |||||||||||||||| lower temperature than TAATTTAAATAATAAT Molecule 2 C. Molecule 1 will melt at Molecule 2: roughly the same GGGCCGCCGGGGCCGC temperature as Molecule 2 |||||||||||||||| D. There is no way to tell CCCGGCGGCCCCGGCG based on the nucleotide sequence  You have two molecules of DNA. The sequence of nucleotides in each molecule is shown below. Will these two molecules “melt” at the same temperature? A. Molecule 1 will melt at a Molecule 1: higher temperature ATTAAATTTATTATTA than Molecule 2 B. Molecule 1 will melt at a |||||||||||||||| lower temperature than TAATTTAAATAATAAT Molecule 2 C. Molecule 1 will melt at Molecule 2: roughly the same GGGCCGCCGGGGCCGC temperature as Molecule 2 |||||||||||||||| D. There is no way to tell CCCGGCGGCCCCGGCG based on the nucleotide sequence The melting temperature (Tm) of a DNA is related to its G+C content, which varies between organisms A. thaliana  Nucleic acids can only hybridize (anneal/attach) to each other if they are both complementary and anti-parallel. Which of these pairs of nucleic acids can hybridize to each other? (You can flip any individual sequence as long as you maintain its 5’ and 3’ directionality.) A. 5’ ATCG 3’ C. 3’ TAGC 5’ 3’ ATCG 5’ 3’ GCTA 5’ B. 5’ ATCG 3’ D. 5’ ATCG 3’ 5’ TAGC 3’ 3’ TACC 5’  Nucleic acids can only hybridize (anneal/attach) to each other if they are both complementary and anti-parallel. Which of these pairs of nucleic acids can hybridize to each other? (You can flip any individual sequence as long as you maintain its 5’ and 3’ directionality.) A. 5’ ATCG 3’ C. 3’ TAGC 5’ 3’ ATCG 5’ 3’ GCTA 5’ B. 5’ ATCG 3’ D. 5’ ATCG 3’ 5’ TAGC 3’ 3’ TACC 5’ Pod time!  Three DNA Samples Lab Assistant’s Lab Assistant’s first attempt second attempt #1 #2 #3 Gel #1 Gel #2 8 kb 5 kb 750 bp 5 kb 250 bp 4 kb 3 kb 10 kb 10 kb 5 kb 5 kb You have three samples (#1-3) with different sizes of DNA 2 kb 2 kb fragments. Your lab assistant runs the samples on a gel, but they load 1 kb 1 kb all of the samples into one well. Draw what you would expect to see on Gel #1. 0.5 kb 0.5 kb Your lab assistant tries again, this time loading each sample into its own well. Draw what you would expect to see on Gel #2. The first lane on the left of each gel represents a size standard Gel electrophoresis DNA moves to the positive end of the gel Separates according to the size of the fragment What does this actually look like? Agarose gel under UV light- DNA bands A polaroid picture of stained with ethidium bromide the gel shown on left M M= standard DNA fragments of known length Lanes 1-4: Unknown DNA being analyzed Now that we know a bit about the structure of DNA… Let’s think about how genetic information is organized and transcribed Transcription LS 7A  Transcription Learning Goal: Understand how the information stored in DNA is transcribed into an RNA message in both prokaryotes and eukaryotes. After the pre-class assignments you should be able to: Define the role of promoters and terminators in the process of transcription. Label the promoter, transcription start site, exons, introns, and polyA signal sequence on a model of a eukaryotic gene. Compare and contrast transcription in prokaryotes and eukaryotes. State the function of eukaryotic mRNA modifications. Describe the process of splicing and the role of the spliceosome in eukaryotic gene expression. By the time you take the second Assessment of Learning you should also be able to: Determine the product of transcription given the DNA sequence of a gene. Evaluate how transcription factors bind to promoter sequence and their effect on transcription. Predict how changes to the DNA sequence of a gene and/or the function of proteins involved in transcription and mRNA processing will alter the final products of transcription. Interpret results from gel electrophoresis experiments and how mutation may affect the products of transcription and their relative location on a gel.  Let’s check in: Get out your reading guide and remind your podmates: what are the functions of the promoter/terminator?  Transcriptional units are called genes In eukaryotes the Poly(A) site acts as a terminator. What is the function of a terminator? -90 -80 -30 +1 What is the function of the promoter? Diagram of a eukaryotic gene Mark A for True or B for False: The promoter is transcribed by RNA polymerase. Mark A for True or B for False: The promoter is transcribed by RNA polymerase. The arrow shows the region of the gene that is actually transcribed  Another model of a eukaryotic gene This is a simplified model of a eukaryotic gene. Two representations are shown: a schematic representation of the gene (lines and boxes) and the actual nucleotide sequence of the gene. We will see this again later! transcription start site polyA signal intron sequence promoter exon 1 exon 2 5’ …TACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT…TCAGGTACTTACTGAATACACGCCAATAAATGACTA… 3’ 3’ …ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA…AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT… 5’ This region of this gene is transcribed in the direction of the arrow Use this representation to answer the following question. DNA template strand 5’ 3’ DNA non-template strand 3’ 5’ Given the locally unwound double strand above, in which direction does the RNA polymerase read the DNA molecule while transcribing DNA? A. 3’ to 5’ along the template DNA strand B. 5’ to 3’ along the template DNA strand C. 3’ to 5’ along the non-template DNA strand D. 5’ to 3’ along the non-template DNA strand Use this representation to answer the following question. DNA template strand 5’ 3’ DNA non-template strand 3’ 5’ Given the locally unwound double strand above, in which direction does the RNA polymerase read the DNA molecule while transcribing DNA? A. 3’ to 5’ along the template DNA strand B. 5’ to 3’ along the template DNA strand C. 3’ to 5’ along the non-template DNA strand D. 5’ to 3’ along the non-template DNA strand  For any given gene, only one strand is transcribed into RNA Non-template  Genes can be coded on either strand of DNA. Consider the transcribed regions of two genes (Gene A and Gene B). Recall from the previous slides that the arrows represent the regions of the genes that are transcribed and the direction in which RNA polymerase moves along the DNA. Gene B RNA Gene A RNA 5’ 3’ 3’ 5’ For Gene A, which strand will be the template strand? A. The top strand as shown in the diagram B. The bottom strand as shown in the diagram C. No idea  Genes can be coded on either strand of DNA. Consider the transcribed regions of two genes (Gene A and Gene B). Recall from the previous slides that the arrows represent the regions of the genes that are transcribed and the direction in which RNA polymerase moves along the DNA. Gene B RNA Gene A RNA 5’ 3’ 3’ 5’ For Gene A, which strand will be the template strand? A. The top strand as shown in the diagram B. The bottom strand as shown in the diagram C. No idea  Genes can be coded on either strand of DNA. Consider the transcribed regions of two genes (Gene A and Gene B). Recall from the previous slides that the arrows represent the regions of the genes that are transcribed and the direction in which RNA polymerase moves along the DNA. Gene B RNA Gene A RNA 5’ ATCCTAGACCATGACAAACCAGATCAGTTACATTCGGTACTCTAAGCATCGGAATCCAGTA 3’ 3’ TAGGATCTGGTACTGTTTGGTCTAGTCAATGTAAGCCATGAGATTCGTAGCCTTAGGTCAT 5’ What is the sequence of the RNA produced from Gene B?  Genes can be coded on either strand of DNA. Consider the transcribed regions of two genes (Gene A and Gene B). Recall from the previous slides that the arrows represent the regions of the genes that are transcribed and the direction in which RNA polymerase moves along the DNA. Gene B RNA Gene A RNA 5’ ATCCTAGACCATGACAAACCAGATCAGTTACATTCGGTACTCTAAGCATCGGAATCCAGTA 3’ 3’ TAGGATCTGGTACTGTTTGGTCTAGTCAATGTAAGCCATGAGATTCGTAGCCTTAGGTCAT 5’ What is the sequence of the RNA produced from Gene B? A. 5’ CCAUGACAAACCAGA 3’ B. 5’ AGACCAAACAGUACC 3’ C. 5’ UCUGGUUUGUCAUGG 3’ D. 5’ GGUACUGUUUGGUCU 3’  Genes can be coded on either strand of DNA. Consider the transcribed regions of two genes (Gene A and Gene B). Recall from the previous slides that the arrows represent the regions of the genes that are transcribed and the direction in which RNA polymerase moves along the DNA. Gene B RNA Gene A RNA 5’ ATCCTAGACCATGACAAACCAGATCAGTTACATTCGGTACTCTAAGCATCGGAATCCAGTA 3’ 3’ TAGGATCTGGTACTGTTTGGTCTAGTCAATGTAAGCCATGAGATTCGTAGCCTTAGGTCAT 5’ What is the sequence of the RNA produced from Gene B? A. 5’ CCAUGACAAACCAGA 3’ B. 5’ AGACCAAACAGUACC 3’ C. 5’ UCUGGUUUGUCAUGG 3’ D. 5’ GGUACUGUUUGGUCU 3’ How does the cell actually synthesize an mRNA from DNA? The mechanism and the players involved in transcription General transcription factors and activators recognize DNA sequences  Transcription begins when RNA polymerase (and its associated transcription factors) binds the promoter region of the gene. Think for a moment: How do you think these proteins “know” where to bind? ?  Proteins can “read” nucleotide sequences in the major and minor groove Interacting with the outside of the double helix is less energetically costly than unwinding the DNA (remember, breaking those hydrogen bonds requires energy!)  Proteins can “read” nucleotide sequences in the major and minor groove Interacting with the outside of the double helix is less energetically costly than unwinding the DNA (remember, breaking those hydrogen bonds requires energy!) General transcription factors and activators recognize DNA sequences The enzyme catalyzing transcription is called RNA polymerase Non-template strand These are models of RNA polymerase The enzyme catalyzing transcription is called RNA polymerase What’s an rNTP? Non-template strand These are models of RNA polymerase  Elongation: RNA synthesis For each nucleotide added in, base pairing occurs and then the phosphodiester bond forms. Speed: ~50 nt/sec  How does transcription terminate? This is different in prokaryotes and eukaryotes. Termination in prokaryotes Rho-dependent termination Rho binds the mRNA and moves toward RNA Polymerase where it separates the growing mRNA strand from the DNA template. This leads to termination of transcription. Termination in eukaryotes Termination is linked to the addition of the polyA tail at the end of the mRNA You have isolated a single piece of bacterial chromosome that is 10kb in length. It contains the sequence for a gene that produces a 1.5 kb RNA product. This gene is transcribed and the DNA and mRNA are isolated after transcription has occurred. Below is a gel DNA gel on the left and an mRNA gel on the right. DNA mRNA 10 kb Draw the results you would expect to see 8 kb after transcription has occurred. 1.5 kb You have isolated a single piece of bacterial chromosome that is 10kb in length. It contains the sequence for a gene that produces a 1.5 kb RNA product. This gene is transcribed and the DNA and mRNA are isolated after transcription has occurred. Below is a gel DNA gel on the left and an mRNA gel on the right. DNA mRNA A. This gel pair accurately represents 10 kb your expected results 8 kb B. This gel pair does not represent the experimental results C. I am not sure what I 1.5 kb would expect You have isolated a single piece of bacterial chromosome that is 10kb in length. It contains the sequence for a gene that produces a 1.5 kb RNA product. This gene is transcribed and the DNA and mRNA are isolated after transcription has occurred. Below is a gel DNA gel on the left and an mRNA gel on the right. DNA mRNA A. This gel pair accurately represents 10 kb your expected results 8 kb B. This gel pair does not represent the experimental results C. I am not sure what I 1.5 kb would expect You have isolated a single piece of bacterial chromosome that is 10kb in length. It contains the sequence for a gene that produces a 1.5 kb RNA product. This gene is transcribed and the DNA and mRNA are isolated after transcription has occurred. Below is a gel DNA gel on the left and an mRNA gel on the right. DNA mRNA A. This gel pair accurately represents 10 kb your expected results 8 kb B. This gel pair does not represent the experimental results C. I am not sure what I 1.5 kb would expect Let’s consider the whole process of transcription in eukaryotes  A scientist is studying mRNA processing. They isolate two samples of RNA from a population of cells. The plot below shows the size distribution of RNA molecules in each sample. hnRNA = All RNAs found in the cell nucleus Frequency of RNA Size (%) Messenger RNA (mRNA) mRNA = mRNAs attached to ribosomes Heterogeneous nuclear RNA (hnRNA) RNA Size (Kilobases)  A scientist is studying mRNA processing. They isolate two samples of RNA from a population of cells. The plot below shows the size distribution of RNA molecules in each sample. hnRNA = All RNAs found in the cell nucleus Frequency of RNA Size (%) Messenger RNA (mRNA) mRNA = mRNAs attached to ribosomes Think for a moment: Heterogeneous nuclear RNA 1. What kind(s) of RNA are (hnRNA) present in each sample? 2. What is different about the RNA molecules in the two samples? RNA Size (Kilobases)  A scientist is studying mRNA processing. They isolate two samples of RNA from a population of cells. The plot below shows the size distribution of RNA molecules in each sample. hnRNA = All RNAs found in the cell nucleus Frequency of RNA Size (%) Messenger RNA (mRNA) mRNA = mRNAs attached to ribosomes What can you conclude from this experiment? Heterogeneous nuclear RNA (hnRNA) A. On average, hnRNA is shorter than mRNA B. On average, hnRNA is longer than mRNA C. On average, hnRNA and mRNA are a similar length RNA Size (Kilobases)  A scientist is studying mRNA processing. They isolate two samples of RNA from a population of cells. The plot below shows the size distribution of RNA molecules in each sample. hnRNA = All RNAs found in the cell nucleus Frequency of RNA Size (%) Messenger RNA (mRNA) mRNA = mRNAs attached to ribosomes What can you conclude from this experiment? Heterogeneous nuclear RNA (hnRNA) A. On average, hnRNA is shorter than mRNA B. On average, hnRNA is longer than mRNA C. On average, hnRNA and mRNA are a similar length RNA Size (Kilobases) mRNA is shorter than the DNA coding for it Intragenic regions (Introns) are removed Expressed regions (Exons) are the sequences that remain in the mRNA The process of intron removal is called SPLICING Translated region 3 critical sites for splicing (Do not memorize!) Spliceosome Spliceosome intron lariat A mutation has occurred in a gene and a splice site is not recognized for an intron. WT MUT Draw the results you would expect to see on an mRNA gel. A mutation has occurred in a gene and a splice site is not recognized for an intron. WT MUT Mark A for True or B for False: This gel represents what would happen in the mRNA. A mutation has occurred in a gene and a splice site is not recognized for an intron. WT MUT Mark A for True or B for False: This gel represents what would happen in the mRNA. Studying how cells synthesize, splice and process RNA to regulate gene expression. The goal of our research is to decipher the workings of the spliceosome. Moreover, we seek to understand how regulation of RNA splicing and other RNA processing Prof. Tracy Johnson reactions allows the cell to respond to its environment. Dean of Life Sciences HHMI Professor Eukaryotic genes vary enormously in both their size and their complexity You will explore the genes of the human genome in your discussion section next week!  Let’s put it all together… On your own at home, determine the sequence of the primary-mRNA produced by this gene and the mature (modified) mRNA produced by this gene. transcription start site polyA signal intron sequence promoter exon 1 exon 2 5’ …TACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT…TCAGGTACTTACTGAATACACGCCAATAAATGACTA… 3’ 3’ …ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA…AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT… 5’ You are studying transcription initiation in eukaryotes. You have isolated a piece of DNA that includes the promoter and transcribed region of a gene: Promoter Transcribed Region -100 -80 -60 -40 -20 1 CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA To identify important elements in this region, you change the first nucleotide in this promoter region to a different nucleotide and measure how much the gene is transcribed. You then change the second nucleotide and measure how much the gene is transcribed. You then change the third nucleotide, and so on… Let’s think about a different experiment… Which components of a car are important for it to work?  Change one piece at a time and see what happens! Relative speed 3 2 1  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door Window  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door Window Headlight  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door Window Headlight Engine  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door Window Headlight Engine Trunk  Change one piece at a time and see what happens! Relative speed 3 2 1 Wheels Door Window Headlight Engine Trunk Brakes Pod time!  Here are the results from your experiment: RNA synthesized with wt DNA = 1 Discuss with your learning pod: 1. Which region(s) of this promoter sequence are most important for initiating transcription? Explain your reasoning 2. Which regions of this promoter, when mutated, cause transcription of this gene to decrease? 3. The sequence around -90 has a single function in transcription. Based on these data, is that function to increase or decrease transcription? 4. General transcription factors bind to promoter regions to recruit RNA polymerase and promote transcription. Which regions shown below are potential binding sites for general transcription factors? CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide  Here are the results from your experiment: RNA synthesized with wt DNA = 1 The region at -75 is transcribed less when mutated. A. True B. False C. Not Sure CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide  Here are the results from your experiment: RNA synthesized with wt DNA = 1 The region shown from -100 to -1 is coding for: A. the gene. B. the untranslated part of the mRNA. C. the promoter of the gene. CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide  Here are the results from your experiment: RNA synthesized with wt DNA = 1 The region shown from -100 to -1 is coding for: A. the gene. B. the untranslated part of the mRNA. C. the promoter of the gene. CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide  Here are the results from your experiment: RNA synthesized with wt DNA = 1 The region at -75 is transcribed less when mutated. A. True B. False C. Not Sure CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide  Here are the results from your experiment: RNA synthesized with wt DNA = 1 The region at -75 is transcribed less when mutated. A. True B. False C. Not Sure CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCACACAGGATAGAGAGGGCAGGAGCCAGGGCAGGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACA Mutated nucleotide