Color--Chapter Seven-DNA to Protein PDF

Chapter 07 From DNA to Protein: How Cells Read the Genome Energetic cost of translation -- aminoacyl-tRNA activation --> 1 ATP -- initiation --> 1 GTP -- elongation step 1 --> 1 GTP for each aa added -- elongation step 3 --> 1 GTP for each aa added -- termination --> 1 GTP Relationship between g...

Chapter 07 From DNA to Protein: How Cells Read the Genome Energetic cost of translation -- aminoacyl-tRNA activation --> 1 ATP -- initiation --> 1 GTP -- elongation step 1 --> 1 GTP for each aa added -- elongation step 3 --> 1 GTP for each aa added -- termination --> 1 GTP Relationship between genes and proteins Amplification •genes are regions of DNA that are transcribed into RNA •mRNA allows the cell to separate information storage from information utilization •transcription - copying in same “language” •translation - goes from nucleic acid language to protein language Gene expression Genes contain information to make RNA, some of which encode proteins Figure 5-7 Genes can be expressed with different efficiencies Figure 7-2 Many RNAs have a complex 3–D shape •Shape imp. for function •folding driven by complementary base pairs •single strand with double-stranded regions tRNA rRNA snRNA Overview --the flow of information in a cell •mRNA separates info storage from info utilization •signal amplification of mRNAs •rRNA and tRNAs are nonspecific for polypeptide being made Genetic info directs the synthesis of proteins Figure 7-1 Transcription -- The basic process (DNA --> RNA) •transcription -- DNA template strand provides information for the synthesis of an RNA strand •mRNA, tRNA, rRNA •One DNA strand copied, thus a single strand of RNA Notice that the base identity on the non-template strand (coding strand) is equivalent to the RNA sequence (copied strand) Figure 7-6 Both DNA strands are not used to make RNA (5' -> 3') A TGGA A TTC TC GC TC (3' <- 5') TA C C TTA A GA GC GA G (5' -> 3') A U GGA A U U C U C GC U C (Coding, sense strand) (Template, antisense strand) (mRNA made from Template strand) Both DNA strands are not used to make RNA (5' -> 3') A TGGA A TTC TC GC TC (3' <- 5') TA C C TTA A GA GC GA G (5' -> 3') A U GGA A U U C U C GC U C (Coding, sense strand) (Template, antisense strand) (mRNA made from Template strand) Both DNA strands are not used to make RNA (5' -> 3') A TGGA A TTC TC GC TC (3' <- 5') TA C C TTA A GA GC GA G (5' -> 3') A U GGA A U U C U C GC U C (Coding, sense strand) (Template, antisense strand) (mRNA made from Template strand) Both DNA strands are not used to make RNA (5' -> 3') A TGGA A TTC TC GC TC (3' <- 5') TA C C TTA A GA GC GA G (5' -> 3') A U GGA A U U C U C GC U C (Coding, sense strand) (Template, antisense strand) (mRNA made from Template strand) Both DNA strands are not used to make RNA (5' -> 3') A TGGA A TTC TC GC TC (3' <- 5') TA C C TTA A GA GC GA G (5' -> 3') A U GGA A U U C U C GC U C (Coding, sense strand) (Template, antisense strand) (mRNA made from Template strand) Promoters •RNA polymerase does not start at random sites on the DNA •By convention, all orientation is relative to the non-template strand •Both strands considered part of gene Upstream 5’ end of gene Downstream 3’ end of gene --> Both strands can encode genes (but not in same location on DNA) •very unusual (eukaryotes) if both strands in one area encode for a gene Figure 7-11 5' ATGGAATTCTCGCTCTTAAGC 3’ TACCTTAAGAGCGAGAATTCG •Copying one direction on the top strand and the other direction on the bottom strand does not give the same sequence •the top strand is not “copy from mom” and the bottom strand is not “copy from dad”; both strands are on the same chromosome and thus from the same parent 3' 5' •Note that for each gene, only one of the two DNA strands encodes the info to make an RNA molecule. •These template nucleotides can be on either strand. •However, each “gene” is considered to include both the template and its complement. Overview of RNAP synthesis of RNA •DNA-dependent RNA polymerase is the copying enzyme •one of the DNA strands is the template •promoter -- DNA binding site •transcription factors -proteins that help RNAP recognize promoter •moves 3’-->5’ on template RNAn + NPPP --> RNAn+1 + PPi Some differences between DNA replication and transcription •A --> T in replication, but A --> U in transcription •Unlike replication, new RNA strand does not remain H-bonded, but is displaced and the DNA helix reforms •Because RNA is copied from only a limited region of the DNA, RNA molecules are much shorter •Transcription does not require a primer Several RNAP molecules on single DNA strands DNA RNAP •Nearly immediate release of RNA from template allows many RNA copies to be made from a gene in a short time Transcription in eukaryotic cells 1. Ribosomal RNAs (rRNA) 2. Transfer RNAs (tRNA) 3. Messenger RNAs (mRNA) Transcription in eukaryotic cells •3 distinct RNAP (prokaryotes have 1) •RNAP-I -- larger (28S, 18S, 5.8S) ribosomal subunits •RNAP-II -- mRNAs and small nuclear RNAs •RNAP-III -- tRNAs and small (5S) ribosomal subunit •mRNA,tRNA,rRNA -- all made as larger pre-RNAs that are processed by “cut and paste” reactions; •snRNAs (small nuclear; 100-300 nt) -- with proteins help process mRNAs •snoRNAs (small nucleolar) -- process rRNAs •miRNAs (micro) -- regulate gene expression See Table 7-2 •Transcription unit (sequence of nt that codes for a single RNA) •all preRNAs are made as larger forms that are processed into smaller pieces Transcription in eukaryotic cells 1. Ribosomal RNAs (rRNA) 2. Transfer RNAs (tRNA) 3. Messenger RNAs (mRNA) 1. Ribosomal RNAs (rRNA) Structure imp. for: •recognizing other molecules •structural support •catalyze aa covalent linkage Ribosomal RNAs (rRNA) •cells have millions of ribosomes •80% of RNA in cells is rRNA •rDNA are repeated 100’s of times •ribosomes consist of several rRNAs and dozens of proteins •half-life in days or weeks; gradually accumulate ~82 different proteins + 4 different rRNA molecules See Fig. 7-37 Processing of mammalian rRNA RNAP-III 3’ •snoRNAs (small, nucleolar RNAs) help process pre-rRNA RNAP-I 5’ •attach to rRNA while being transcribed rRNA in a large subunit of a prokaryotic ribosome rRNA protein -- a ribosome is ~ 2/3 rRNA and 1/3 protein See Fig. 7- 38 Nucleolus -- a ribosomeproducing factory •in interphase cells rDNA are clustered together in nucleolus Fig. 5-7 •most of nucleolus is ribosomal subunits •in HeLa cells ~7,000 ribosomes are produced in the nucleolus/min GFP-ribosomal protein Transcription in eukaryotic cells 1. Ribosomal RNAs (rRNA) 2. Transfer RNAs (tRNA) 3. Messenger RNAs (mRNA) 2. Transfer RNA (tRNA) •plants and animals have ~50 different tRNAs •tDNA is repeated (~ 500 genes in humans) •repeats are clustered in genome •~ 80 nt long •transcribed using RNAP-III •half-life in days or weeks; gradually accumulate Transcription in eukaryotic cells 1. Ribosomal RNAs (rRNA) 2. Transfer RNAs (tRNA) 3. Messenger RNAs (mRNA) 3. Messenger RNA (mRNA) •contains a continuous sequence of nt encoding a particular polypeptide •significant noncoding segment (5’ and 3’ ends; regulatory functions) •half-life varies; minutes to days Human b-globin mRNA See Fig. 7-18; 7-42 TATA box -- consensus sequence used by many “highly-expressed” genes 5’ -25nt Sit e o f pre in it iat io n co m pl e x (G T Fs + RN AP) TATA box -- 5’-TATAAA-3’ Start TATA binding protein Fig. 7-13 Assembly of preinitiation complex (GTF + polymerase) •there are many GTFs in preinitiation complex; two imp. are: -- TFIID (contains TBP) -- TFIIH (contains a helicase and kinase) •Tail aka C-terminal domain (CTD) Figure 7-12 Initiation of transcription •the C-terminal domain (CTD) of a RNAP-II subunit is phosphorylated by TFIIH •phosphorylation releases polymerase from promoter site •TFIID remains bound to TATA to initiate additional transcription Figure 7-17 ~50-100 nt/s •termination coupled to cleavage and polyadenylation Overview of processing of pre-mRNA •hnRNA (heterogeneous nuclear RNA) is a pre-mRNA that is processed to mRNA 1. -- 5’ cap 2. -- 3’ polyadenylation (may occur during or after splicing) 3.-- removal of introns 5’ methylguanosine cap •removal of a phosphate and addition of a methylated guanosine •protects 5’ from exonucleases •aids in transport from nucleus •helps initiate translation 3’ poly(A) tail •endonuclease forms new 3’ end by recognizing AAUAAA sequence •a polymerase adds 200-250 adenosines without template •protects from premature degradation •helps initiate translation See Figure 7-18 Eukaryotic and bacterial genes are organized differently -- introns •Allows for alternative splicing (~95% human genes) •Allows for genetic recombination between exons; drives gene evolution Figure 7-19 Most human genes are broken into exons and introns 3 exons 26 exons •Exons are usually shorter than introns Figure 7-20 RNA splicing of split genes-- removal of introns from a pre-mRNA Adenovirus genome example Nucleotide sequences at the splice sites of pre–mRNAs Pre-mRNA Unlike exons, most of the nt sequence is unimportant •consensus sequences at intron ends •G/GU………………AG/G Figure 7-21 The roles of snRNPs and spliceosomes in mRNA splicing •spliceosome -- complex containing variety of proteins and small nuclear riboproteins (snRNPs) “snurps” •5’ and 3’ consensus splice sites; base pairing with snRNPs •lariat intron excised See Fi g. 7 -2 2 , 2 3 RNA splicing •identify of various snRNPs and actual steps not imp. for this class Essential Cell Biology 3 Possible mechanism for coordination of pre-mRNA processing Polyadenylation sequence See Figure 7-17 How can a cell tell that an mRNA is mature? •A mature and intact mRNA will have 5’ cap, poly(A) tail and has been spliced •Binding proteins recognize these modifications and move mRNA into cytoplasm Figure 7-27 Alternative splicing •a single gene can encode two or more related polypeptides •~95% of multiexonic human genes are alt. spliced Figure 7-25 Correspondence between exons and protein domains Translation: RNA --> protein Properties of the genetic code •translation from nt language to aa language •codons -- the nucleotide triplets that represent an aa •codons are nonoverlapping 64 possible mRNA codons •most aa have 2 or more codons •3 “stop” codons •built in safeguards -- each aa’s codons are related -- similar aa have similar codons (acidic, polar uncharged, hydrophobic, basic) Genetic code relates codon sequences in mRNA to amino acids in proteins Codon wheel (another way of looking at / organizing it) https://www.dna20.com/codontablewheel.php Decoding the codons --role of tRNAs Properties of the genetic code •codons -- the nucleotide triplets that represent an aa Codon table is the mRNA sequence tRNA structure •73-93 nucleotides •posttranscriptionally-modified unusal bases (e.g., pseudouridine, methylguanosine •aa added to 3’ adenosine •middle loop of 7 nts contains anticodon Figure 7-33 The structure of transfer RNA (tRNA) Genetic code is redundant •Several codons can specify a single aa •More than one tRNA per aa? •Can single tRNA recognize more than one codon? •Answer – Both can occur Genetic code is redundant •Several codons can specify a single aa •More than one tRNA per aa? •Can single tRNA recognize more than one codon? •Answer – Both can occur Wobble codons •61 codons encode for aa; but there are fewer than 61 tRNAs. Why? •steric (structural) requirement between tRNA anticodon and mRNA codon is strict for first two positions, but flexible at third •thus a single tRNA can recognize more than one codon Adding aa to the correct tRNA (activation) •aminoacyl-tRNA synthetase -20 different ones; enzyme covalently-links aa to correct tRNA •single enzyme can recognize all tRNAs for that aa •ATP required; primary energy requirement for peptide bond formation •proofreading mechanism •aa has no role in targeting See Figure 7-34 tRNA Genetic code translated by recognition events Figure 7-35 Translation 1. Initiation 2. Elongation 3. Termination In principle an mRNA can be translated in 3 possible reading frames— however only one encodes an actual protein Fig. 7-30 AUG = Start codon; sets the reading frame AUGCUCCAGUCC— —CUAGUUACC —CUAGUUACCAUGCUCCAGUCC— Initiation of protein synthesis in eukaryotes •10 initiation factors •43S complex binds to mRNA, when finds AUG, eIF2-GTP hydrolysis releases eIFs allowing large (60S) ribosome subunit to bind •Kozak sequence -- additional nts containing AUG; help ribosome distinguish start from internal AUG; base pairs with rRNA Inhibition of protein synthesis in eukaryotes •eIF2 must be bound to GTP (not GDP) to bind to tRNA and initiate protein synthesis •The phosphorylation of a serine on eIF2 makes in unable to exchange GDP for GTP and synthesis stops •Done when cell has too many unfolded or denatured proteins Translation 1. Initiation 2. Elongation 3. Termination 3 tRNA binding sites on ribosome 1. A -- aminoacyl 2. P -- peptidyl 3. E -- exit •parts of ribosomes in contact with mRNA and tRNA lined with rRNAs Figure 7-38 rRNA in a large subunit of a prokaryotic ribosome rRNA protein -- a ribosome is ~ 2/3 rRNA and 1/3 protein See Fig. 7-38 1. selection of aminoacyl-tRNA -eEF1a (EF-Tu in prokaryotes) delivers tRNA to A site; requires GTP hydrolysis to bind tightly See Fi g. 7 -3 9 2. peptidyl transferase - RNA portion of large subunit catalyzes transfer of aa; no energy required at this step See Fi g. 7 -3 9 2. peptidyl transferase - RNA portion of large subunit catalyzes transfer of aa; no energy required at this step See Fi g. 7 -3 9 2. peptidyl transferase - RNA portion of large subunit catalyzes transfer of aa; no energy required at this step See Fi g. 7 -3 9 3. translocation - eEF2 GTP hydrolysis See Fi g. 7 -3 9 +H2O 4. Deacylated tRNA released (when eEF1a GTP hydrolyzed) See Fi g. 7 -3 9 Elongation EF-Tu = eEF1a EF-G = eEF2 •for each elongation cycle two GTPs hydrolyzed •each cycle lasts ~1/20 second Translation 1. Initiation 2. Elongation 3. Termination Termination •UAA, UAG or UGA are stop codons •no tRNAs are complementary •release factors -- mimic tRNAs; recognize these codons; bind to A site; one of these factors is a Gprotein and hydrolysis of ester bond on peptide-tRNA helps termination •ribosome falls apart, mRNA released Translation Mutations can cause early termination •termination codons can be formed by single nt changes from many codons Base-pair substitution Base-pair insertion or deletion Nonsense-mediated decay •selective destruction of mRNA with premature termination codons •Exon-junction complex -normally displaced by ribosome •premature termination EJC remains on mRNA Polyribosomes Figure 7-42 How some antibiotics work --but does not affect eukaryote processes Table 7-3