BIOL1XX8 2024 Lecture 23: It's in the genes PDF

It’s in the genes Lecture 23 BIOL1XX8/MEDS001 Human Biology Dr. Hong Dao Nguyen School of Life and Environmental Sciences Learning objectives Describe homologous chromosomes, genes and alleles Explain how an allele and phenotype would be considered dominant or recessive Describe ho...

It’s in the genes Lecture 23 BIOL1XX8/MEDS001 Human Biology Dr. Hong Dao Nguyen School of Life and Environmental Sciences Learning objectives Describe homologous chromosomes, genes and alleles Explain how an allele and phenotype would be considered dominant or recessive Describe homozygous dominant, homozygous recessive and heterozygous genotypes Describe co-dominance using ABO blood group as an example Predict the probability of an offspring’s genotype and phenotype for traits or disorders with autosomal modes of inheritance Determine genotypes and phenotypes for two traits using dihybrid crosses Predict the probability of inheritance for autosomal dominant and autosomal recessive traits or disorders in a pedigree Key terms = blue Terms for your own interest = pink Almost every human trait has a genetic component Humans are largely composed of proteins – Contractile e.g. actin, myosin – Enzymes e.g. amylase – Hormonal e.g. insulin, glucagon – Structural e.g. collagen – Transport e.g. Na+/K+-ATPase, haemoglobin – Storage e.g. ferritin The DNA sequence of a gene determines the amino acid sequence for the protein it encodes Most human traits and diseases are complex, affected by multiple genes (polygenic) and the additional influence of environmental factors Traits and genetic disorders that are influenced by one gene are rare Today’s lecture  Genetics is full of specific terminology and concepts Chromosomes Diploid Allele Homozygous Homologous Heterozygous genotype chromosomes genotype Gene Genotype Phenotype Carrier Autosomes Sex chromosomes Autosomal modes Dominant Co-dominance of inheritance phenotype/allele Y-linked Autosomal dominant Recessive phenotype/allele Sex-linked modes X-linked dominant of inheritance X-linked recessive Autosomal recessive  Chromosomes DNA-protein complex = chromatin Tightly packed chromatin = chromosomes DNA is coiled around centromere proteins (histones) This is one chromosome This is also one containing one DNA chromosome made up molecule of two DNA molecules 1-2% of our DNA are protein-coding genes Image: https://www.garvan.org.au/research/kinghorn-centre-for-clinical-genomics/learn-about-genomics/dna-base/collection1/dna-chromosomes-and-cells Genes Genes are sections along DNA that encode for proteins – Gene sequence determines the amino acid sequence for the protein it encodes Amino acid sequence Images modified from Adobe Stock Autosomes and sex chromosomes Homologous chromosomes Most of our cells are diploid - 2 sets of chromosomes Chromosomes 1-22 are autosomes - don’t determine our sex - homologous Key Orange = inherited maternal chromosome Blue = inherited paternal chromosome 23rd pair are the sex chromosomes or X/X Image modified from Wikimedia  Chromosome 9 Homologous chromosomes Genes and alleles The same gene is found at the same location (locus) on homologous chromosomes The DNA sequence for the same gene on homologous chromosomes may have some variations Allele: different variants/versions/forms of a gene due to their slight differences in DNA sequence – Several alleles are possible for one gene – e.g. there are 3 alleles for the ABO gene Human somatic cells, being diploid, carry two alleles of a gene ABO gene Image modified from Wikimedia  ABO blood group 3 alleles IA IB i - Encodes an enzyme that catalyses the - Encodes an inactive enzyme synthesis of sugar antigens - Recessive to dominant IA and IB - dominant to i allele alleles - IA and IB are codominant Heterozygous genotype Homozygous recessive genotype Genotype IAIA or IAi IBIB or IBi IA IB ii Homozygous dominant genotype Phenotype A antigens on RBC B antigens on RBC A & B antigens on RBC No A &or B antigens on RBC A blood type B blood type AB blood type O blood type Genotype vs Phenotype Genotype: combination of alleles for a particular gene – Homozygous (alleles are the same) - Homozygous dominant, homozygous recessive – Heterozygous (alleles are different) Phenotype: the observable or measurable characteristic arising from the genotype and its interaction with environmental factors Dominant vs Recessive Alleles and Phenotypes Dominant alleles mask the effect of recessive alleles Dominant phenotypes (e.g. A blood type) – Not about preferential expression are expressed with: – Not necessary more common in a population - Homozygous dominant genotypes e.g. IAIA – Not necessarily the normal allele - Heterozygous genotypes e.g. IAi Recessive alleles have their effect masked by dominant Recessive phenotypes (e.g. O blood type) alleles are expressed with: – Encoded proteins may still retain some normal function but - Homozygous recessive genotypes e.g. ii at a reduced capacity or completely dysfunctional – Can be more common in some populations – Recessive alleles don’t necessarily cause genetic diseases Co-dominance occurs when two different alleles and therefore phenotypes are expressed equally Single gene human traits and disorders Mode of inheritance Examples Autosomal recessive Dry earwax Hemochromatosis Sickle cell disease Autosomal dominant Bitter taste perception Today’s lecture Wet earwax Hungtington’s disease Co-dominant AB blood type Sickle cell anemia Incomplete dominance Sickle cell anemia X-linked recessive g6pd deficiency Red-green colour blindness Haemophilia a Next lecture X-linked dominant Rett’s syndrome Y-linked “Webbed toes”  Earwax: an autosomal trait Earwax type is controlled by the gene ABCC11 on chromosome 16 - Encodes for a protein transporter Two alleles - Dominant allele codes for a functioning protein - Recessive allele codes for a non-functioning protein Recessive phenotype – dry earwax Dominant phenotype - wet earwax Images from Toyoda et al. (2009) https://doi.org/10.1096/fj.09-129098 & Wikimedia Commons Predicting the likelihood of an offspring’s genotype and phenotype Q1. A man and a woman both have wet earwax. Their son has dry earwax. The allele for dry earwax is recessive to the allele for wet earwax. What is the likelihood that their next child will have wet earwax? Let’s say: E is the allele for wet earwax Mother’s genotype e is the allele for dry earwax Father’s genotype A. 25% B. 50% C. 75% D. 100% Bitter taste perception The compound Phenylthiocarbamide (PTC) tastes bitter to some people – Not found in nature but the ability to taste it strongly correlates to tasting other bitter substances Largely determined by a single gene on chromosome 7, TAS2R8, which codes for a taste receptor Two common alleles – Bitter tasting allele is dominant – Non-bitter tasting allele is recessive Dominant phenotype: “taster” (can taste bitterness) Recessive phenotype: “non-taster” (cannot taste bitterness) Looking at two traits Q2. Powdered PTC accidentally blew into the air and a man who has wet earwax perceived the dust to be bitter tasting. His wife standing next to him also has wet earwax and agreed that the dust tasted bitter. It turns out that both are heterozygous for the two traits. If this couple have a child, what is the probability that their child will have dry earwax and perceive PTC to be bitter? Let’s designate E as the allele for wet earwax e is the allele for dry earwax B can be the allele for bitter taste perception b can be the allele for non-bitter taste perception Dihybrid cross: determining the phenotype and genotype for two traits Both the man and woman have heterozygous genotypes for earwax and bitter taste perception Mother’s genotype EeBb Allelic combination in a gamete Q2. What is the likelihood that EB Eb eB eb the child would have dry earwax and perceive PTC to be bitter? EB Father’s genotype Eb EeBb eB eb Sickle cell disease: an autosomal recessive disorder Mutation in HBB gene resulting in abnormal haemoglobin beta subunit Heterozygotes exhibit the sickle cell trait and are carriers of the abnormal allele – Half of haemoglobin is normal – Mixture of normal and sickle red blood cells (co-dominant phenotype) – Lower blood oxygen levels (incomplete phenotype) Images from Adobe Stock Normal red blood cell Sickle cell red blood cell Images modified from http://www.publicdomainfiles.com Why does the sickle cell allele persist in human populations? Sickle cell disease (recessive phenotype) affects millions of people worldwide – Major symptom is severe pain from obstruction of blood flow Heterozygous individuals (sickle cell trait phenotype) have greater resistance to malaria – Malaria infected red blook cells tend to sickle à removed by macrophages Image from Piel et al. (2010) Nature Communications https://doi.org/10.1038/ncomms1104 Pedigrees A family tree indicating the presence of absence of a trait for each member Conventions Unaffected male Unaffected female Affected male Affected female Pedigree question Q3. The son of Anne and Rob has sickle cell disease (recessive phenotype). What is the genotype of Anne? A. Homozygous dominant B. Heterozygous C. Homozygous recessive D. Not sure Anne Rob = affected male = affected female = unaffected male = unaffected female Huntington’s Disease: an autosomal dominant disorder Healthy individuals are homozygous recessive Affected individuals are homozygous dominant or heterozygous Normal alleles of the HTT gene encodes for a normal HTT protein Normal protein …CAGCAGCAGCAGCAGCAG… 7-35 trinucleotide repeats Mutant alleles characterised by additional CAG repeats Protein prone to misfolding …CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG… >40 trinucleotide repeats How does the abnormal HTT alllele persist in human populations? Affected individual passes ~20 years after onset of symptoms Worldwide prevalence varies – 5-7 people per 100,000 affected in Western countries Highest incidence in Lake Maracaibo region, Venezuela – 18, 000 individuals over 10 generations affected Symptoms manifest between 30-45 years of age – Patients may have had children before diagnosis Rare cases of disease manifesting in children Q4. Huntington’s Disease is an autosomal dominant disorder. If a child has a 50% chance of inheriting Huntington’s Disease, what are the genotypes of the parents? Let’s say: h is the normal allele for the HTT gene H is the abnormal allele for HTT gene Genotype of Parent 1 Genotype of Parent 2 A. HH and hh B. Both are hh C. Both are Hh D. Hh and hh