Bio Chp 15 PDF

Homework - Chapter 15 Due Nov 17 at 11:59pm Points 380 Questions 38 Time Limit None Allowed Attempts 2 Attempt History Attempt Time Score KEPT Attempt 2 14 minutes 380 out o...

Homework - Chapter 15 Due Nov 17 at 11:59pm Points 380 Questions 38 Time Limit None Allowed Attempts 2 Attempt History Attempt Time Score KEPT Attempt 2 14 minutes 380 out of 380 LATEST Attempt 2 14 minutes 380 out of 380 Attempt 1 less than 1 minute 80 out of 380 Score for this attempt: 380 out of 380 Submitted Nov 14 at 6:30pm This attempt took 14 minutes.  Question 1 10 / 10 pts Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the β-globin gene? silent Correct! missense nonsense frameshift sense  Question 2 10 / 10 pts What would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? a silent point mutation with no deleterious effects a missense point mutation resulting in the change of one amino acid  a nonsense point mutation resulting in the generation of a premature stop codon Correct! a frameshift mutation, producing a different amino acid sequence altogether All of the choices are possible.  Question 3 10 / 10 pts Larger genes are usually more likely to incur a mutation than smaller genes. Correct! True False  Question 4 10 / 10 pts A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? Correct! nonsense mutation missense mutation silent mutation sense mutation frameshift mutation  Question 5 10 / 10 pts Mutations can produce a polypeptide with increased function. Correct! True False  Question 6 10 / 10 pts Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp base addition—silent substitution—missense base addition—missense substitution—nonsense Correct! base addition—frameshift Clarify Question What is the key concept addressed by the question? The question is asking about how point mutations can alter the amino acid sequence of a polypeptide. What type of thinking is required? You are being asked to analyze normal and mutated DNA and protein sequences and to identify which type of point mutation occurred. What key words does the question contain? Mutation, permanent, random change in genetic material Polypeptide, protein product formed from translation of DNA Gather Content What do you already know about how mutations can alter the amino acid sequence of a polypeptide? What other information is related to the question? What are the potential effects of point mutations in a structural gene? What are the differences between a base pair substitution and a base pair insertion or deletion? What are the differences between a silent mutation, a missense mutation, a nonsense mutation, and a frame shift mutation? Choose Answer Given what you now know, what information is most likely to produce the correct answer? When you compare the two DNA sequences and protein sequences given in the question, how do they differ? Note that there is an inserted A near the middle of the mutated gene sequence. Is the inserted A in the DNA a base addition or a substitution? What is the difference between these two possibilities? Note that the last four amino acids in the protein in the mutated sequence are different than those of the normal protein; this change in amino acid corresponds to the point in the gene where the A was inserted. This string of altered amino acids downstream from that insertion is indicative of a frame shift mutation. Reflect on Process Did your problem-solving process lead you to the correct answer? If not, where did the process break down or lead you astray? How can you revise your approach to produce a more desirable result? Answering the question depended on your not only on your ability to distinguish between different types of point mutations, but on your ability to analyze the possible effects of that point mutation on a protein product. If you got the correct answer, great! If not, remember it’s important to use a systematic approach to answer questions and to reinforce those good habits over time. If you got an incorrect answer, where did the process break down? Did you understand that the mutation in the DNA was a base pair insertion and not a substitution? A substitution would have replaced one nucleotide with another and not changed the number of nucleotides in the sequence. Did you understand that an addition of a single nucleotide would change all codons downstream of that addition? Did you understand that changing codons (altering the reading frame) would change every amino acid downstream of the mutation? Did you remember that changing the reading frame is called a frame shift mutation? And did you understand that silent, missense, and nonsense mutations do not involved changes in reading frame? Did you remember that a missense mutation leads to a change in a single amino acid?  Question 7 10 / 10 pts The rate of transcription for a gene is found to be affected by a mutation. Where would you expect the mutation to appear on the DNA? In an intron associated with the gene Correct! In the promoter for the gene In a splice site for the gene  In the rRNA of the ribosomes translating the gene In the exon of the gene  Question 8 10 / 10 pts Which of the following is true concerning a somatic cell mutation? A small fraction of the gametes carry the mutation. Half of the gametes carry the mutation. All of the gametes carry the mutation. Correct! Only a subset of cells within the organism is affected by the mutation. All cells within the organism are affected by the mutation.  Question 9 10 / 10 pts Somatic cell mutations are heritable. True Correct! False  Question 10 10 / 10 pts Which of the following results in a spontaneous mutation? Correct! free radicals produced by cellular metabolism exposure to ultraviolet light exposure to benzo (a)-pyrene, a chemical substance found in cigarette smoke exposure to ultraviolet light and benzo (a)-pyrene exposure to X-rays  Question 11 10 / 10 pts All of the following are chemical mutagens EXCEPT nitrogen mustard. Correct!  X-rays. ethyl methanesulfonate. hydroxylamine. nitrous acid.  Question 12 10 / 10 pts Ionizing radiation can produce which of the following? cytosine Correct! free radicals stop codons thymine dimers hypoxanthine  Question 13 10 / 10 pts Which of the following types of physical mutagens produces thymine dimer mutations? Correct! ultraviolet light X-rays microwave gamma rays ionizing radiation  Question 14 10 / 10 pts A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure. Which of the following DNA repair systems is responsible for the correction? base excision repair Correct! direct repair indirect repair nucleotide excision repair  methyl-directed mismatch repair  Question 15 10 / 10 pts Which of the following base pairs would be targeted and repaired by a mismatch repair system? A-T C-G Correct! A-G A-G and C-G A-T and C-G  Question 16 10 / 10 pts Cells are normally limited to one DNA repair system that corrects DNA mistakes. True Correct! False  Question 17 10 / 10 pts Which of the following CANNOT be repaired by nucleotide excision repair (NER)? ultraviolet-induced damage chemically modified bases missing bases Correct! mismatched bases pyrimidine dimers  Question 18 10 / 10 pts Which of the following diseases is associated with faulty DNA repair mechanisms? Alzheimer's disease diabetes Correct!  xeroderma pigmentosum diabetes and xeroderma pigmentosum Alzheimer's disease and diabetes  Question 19 10 / 10 pts Which of the following statements about cancer is FALSE? It is characterized by uncontrolled cell division. Over 1 million Americans are diagnosed with cancer each year. Correct! Most cancers involve genetic changes that are passed from parent to offspring. At least 80% of all human cancers are related to exposure to carcinogens. It is caused by an accumulation of mutations.  Question 20 10 / 10 pts Cancers originate from a single cell. Correct! True False  Question 21 10 / 10 pts Which of the following is an overgrowth of cells that serves no useful purpose? Correct! tumor oncogene proto-oncogene growth callus  Question 22 10 / 10 pts When cancer cells have the ability to migrate to other parts of the body, they are said to be  benign. Correct! metastatic. oncogenic. genetic.  Question 23 10 / 10 pts A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene? tumor-suppressor gene Correct! oncogene spliced gene alternatively spliced gene malignant gene  Question 24 10 / 10 pts Most oncogenes encode proteins that function in cell growth signaling pathways. Correct! True False  Question 25 10 / 10 pts If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone a missense mutation. Correct! gene amplification. a chromosomal translocation. retroviral insertion. a nonsense mutation.  Question 26 10 / 10 pts Which of the following events must occur to cause a chromosomal translocation, such as that seen in individuals with chronic myelogenous leukemia (CML)? One chromosome must break in two distinct locations. Correct! Two different chromosomes must break. A transposon must be present in one of the chromosomes. The broken ends must pair correctly. A mutation in the DNA must occur. Clarify Question What is the key concept addressed by the question? The question is asking about the mechanism of chromosomal translocation. What type of thinking is required? You are being asked to analyze a series of statements and to identify which correctly identifies events that must happen for a chromosomal translocation to occur. What key words does the question contain? Chromosomal translocation, when one segment of a chromosome becomes attached to another Chronic myelogenous leukemia (CML), a type of cancer involving white blood cells Gather Content What do you already know about chromosomal translocations? What other information is related to the question? What is a chromosomal translocation? What steps must occur for such result to occur for a piece of one chromosome to be removed and to be permanently attached to another chromosome? Choose Answer Given what you now know, what information is most likely to produce the correct answer? In the case of CML, two different chromosomes exchange pieces. Think about what basic steps must happen (at a general level, do not worry about any specific enzymes or proteins involved in the process) for a chromosome to lose a piece of DNA, and then to attach a segment of DNA from  another chromosome. When two chromosomes break and the cell incorrectly joins them together, a translocation occurs. Reflect on Process Did your problem-solving process lead you to the correct answer? If not, where did the process break down or lead you astray? How can you revise your approach to produce a more desirable result? Answering the question depended on your ability to analyze a series of statements and to identify which correctly identified an event that must happen for a chromosomal translocation to occur. If you got the correct answer, great! If not, remember it’s important to use a systematic approach to answer questions and to reinforce those good habits over time. If you got an incorrect answer, where did the process break down? Were you able to think about the idea of chromosome translocation—two chromosomes exchanging pieces of DNA—and the steps that would have to occur? Did it make sense that both chromosomes would have to break, each in one location? And that each chromosome, at its broken end, would have to fuse, incorrectly, to the piece of the other (wrong) chromosome? Did you understand that translocation is something that can happen in the cell, and does not have to be the result of a specific mutation? Did you understand that no transposons are used in the process of translocation? If you understand all of this information, there is only one choice that describes something that must happen for a chromosomal translocation.  Question 27 10 / 10 pts A physician discovered a cancerous tumor in the cartilage of a patient. What type of tumor is this? myeloma retroviral Correct! sarcoma leukemia cyst  Question 28 10 / 10 pts Which of the following tumor-suppressor genes encode proteins that are involved in the maintenance of genome integrity? Correct!  BRCA-1. Rb. NF1. p16.  Question 29 10 / 10 pts Should a genetic abnormality arise,_________ prevent a cell from progressing uncontrollably through the cell cycle. cis-acting elements Correct! checkpoint proteins trans-acting elements growth factors Ras proteins  Question 30 10 / 10 pts Which of the following is a protein activated during apoptosis? growth factor oncogene chimeric gene Correct! caspase transposase  Question 31 10 / 10 pts At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? S M Correct!  Question 32 10 / 10 pts p53 is a tumor suppressor gene that acts as a sensor of DNA damage. Correct! True False  Question 33 10 / 10 pts Certain types of cancer are caused by viruses. Correct! True False  Question 34 10 / 10 pts Which of the following is most likely to occur when a tumor-suppressor gene is mutated? The tumor-suppressor gene may be overactive. The resulting tumor-suppressor protein would further suppress cell proliferation. The resulting tumor-suppressor protein would activate an oncogene. Correct! The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. None of the choices are possible.  Question 35 10 / 10 pts Which of the following is the cancer of epithelial cells? sarcoma lymphoma leukemia Correct! carcinoma  myeloma  Question 36 10 / 10 pts Which of the following viruses can cause cancer? Rous sarcoma virus Hepatitis B Abelson leukemia virus Simian sarcoma virus Correct! All of the choices are correct.  Question 37 10 / 10 pts An actively dividing cell is missing an entire chromosome. How might this lead to cancer? The proto-oncogene ras will lose its ability to hydrolyze GTP to form GDP. It will continue to promote cell division and lead to cancer. The proto-oncogene ras may be present in multiple copies, leading to over expression and cancer. Correct! Various tumor suppressor genes may have been deleted from the genome, so cell proliferation occurs regardless of the damaged genome. Various proto-oncogenes may have been deleted from the genome, so cells will not divide when they should. The deleted chromosome will signal certain genes, like p53, to promote apoptosis. Clarify Question What is the key concept addressed by the question? The question asks about tumor suppressors and oncogenes. What type of thinking is required? You are being asked to use your knowledge of mutation, oncogenes, and tumor suppressors to analyze which type of mutation could lead to cancer. Gather Content What do you already know about tumor suppressors? What other information is related to the question? Tumor suppressors are proteins that monitor the cell at cell cycle checkpoints. As a collective group, they ensure that conditions are favorable for cell division, and will inhibit cell cycle progression if they are not. If a tumor suppressor gene is mutated, the cell cycle could proceed even if DNA is damaged or other conditions are not quite right. We want normal, functional tumor suppressors in our cells. Rb, BRCA, and p53 are tumor suppressors. There are three common mechanisms by which tumor suppressor genes are silenced—mutation, chromosome loss, and epigenetic changes. A proto-oncogene is a normal gene that encodes proteins involved in cell signaling pathways that regulate the cell cycle. If a proto-oncogene is mutated, it can become an oncogene. An oncogene is a gene that is overexpressed or expressed in the wrong cell type and can lead to cancer. The gene ras and fos is an proto-oncogenes. How does ras work? Several types of genetic changes may convert a proto-oncogene into an oncogene—point mutations, gene amplifications, chromosomal translocations, and retroviral insertion. Choose Answer Given what you now know, what information is most likely to produce the correct answer? Both proto-oncogenes and tumor suppressor genes can be mutated due to chromosomal abnormalities. Cell cycle controls will be lost if a tumor suppressor is missing. The best answer describes that tumor suppressor genes may have been deleted from the genome, so cell proliferation may occur regardless of damage to the genome. Reflect on Process Did your problem-solving process lead you to the correct answer? If not, where did the process break down or lead you astray? How can you revise your approach to produce a more desirable result? Answering the question depended on your ability to use your knowledge of mutation, oncogenes, and tumor suppressors to analyze which type of mutation could lead to cancer. If you got the correct answer, great! If not, remember it’s important to use a systematic approach to answer questions and to reinforce those good habits over time. Did you understand that if a gene was missing due to a chromosome deletion, the gene is effectively silenced? Did you understand that silencing tumor suppressors can lead to cancer because cell division will occur even when conditions of the cell aren’t favorable (like missing a chromosome!)? Did you understand that silencing a proto-oncogene would lead to a situation where cell division does not occur—the opposite of cancer?  Question 38 10 / 10 pts Duchenne muscular dystrophy (DMD) is a severe muscular dystrophy that results in muscle weakness and loss and occurs primarily in boys. DMD result from mutations in the dystrophin gene. Dystrophin connects the cytoskeleton of a muscle fiber to the extracellular matrix. In about 10-15% of DMD patients, a short, nonfunctional version of the dystrophin protein is produced. What type of mutation would you expect to find in the dystrophin gene in these patients? Silent mutation Missense mutation Correct! Nonsense mutation Frameshift mutation Clarify Question What is the key concept addressed by the question? This question is asking you to distinguish among different types of mutations. What type of thinking is required? You are being asked to take what you already know about mutations and use, or apply, it to a specific disease example. Gather Content What do you already know about mutations? What other information is related to the question? What types of mutations do you know about? What characterizes the types of mutations commonly seen in diseases? What is the difference between the following types of mutations: silent, missense, nonsense, and frameshift? Choose Answer Given what you now know, what information is most likely to produce the correct answer? The key to answering this question is to identify which type of mutation generates a shortened polypeptide. Which type of mutation is most likely to do this? Because a nonsense mutation inserts a premature codon, this type of mutation results in a shortened polypeptide. Reflect on Process Did your problem-solving process lead you to the correct answer? If not, where did the process break down or lead you astray? How can you revise your approach to produce a more desirable result? Answering this question correctly depended on your ability to use your knowledge of mutations in a new situation. If you got an incorrect answer, did you remember what occurred in each of the different types of mutations? Did you recall that inserting a premature stop codon results in a shorter polypeptide? Quiz Score: 380 out of 380