BIOD21 Labs Fall 2024 Weeks 1-2 PDF

Gazzarrini, BIOD21 – Fall 2024 © BIOD21 LABS – Fall 2024 LAB HANDOUTS WEEKS 1-2: DNA isolation, DNA sequence analysis, and PCR ________________________________________________________________________ WEEK 1 (Sep 4 – 5, 2024) Exercise...

Gazzarrini, BIOD21 – Fall 2024 © BIOD21 LABS – Fall 2024 LAB HANDOUTS WEEKS 1-2: DNA isolation, DNA sequence analysis, and PCR ________________________________________________________________________ WEEK 1 (Sep 4 – 5, 2024) Exercise 1: Arabidopsis thaliana seed sterilization and plating on plant growth media BIONFORMATICS LAB 1: Analysis of genomic DNA and cDNA Sequences WEEK 2 (Sep 11 – 12, 2024) Exercise 2: Genomic DNA isolation from Arabidopsis wild-type (WT) plants Exercise 3: CBF4 amplification by PCR Exercise 4: Genomic DNA analysis (agarose gel) Exercise 5: PCR analysis (agarose gel) Data discussion Þ QUIZ1 (gDNA and PCR). In class, Sep 12. Þ Bioinformatics Assignment 1 due Sep 13, 11:59 pm _______________________________________________________________________ Introduction and outline of BIOD21 Labs In BIOD21 you will study the function of the C-repeat-binding factor (CBF4)/DEHYDRATION-RESPONSIVE ELEMENT-BINDING FACTOR 1D (DREB1D) gene in Arabidopsis. For simplicity, we will refer to it as CBF4. CBF4 belongs to the AP2/EREBP family of transcription factors, and is closely related to CBF1, CBF2 and CBF3. CBF1, CBF2, and CBF3 bind to the promoter region of genes that are regulated by cold stress. While the function of CBF1/2/3 is well characterized, much less is known about the role of CBF4. In the first part of BIOD21 (weeks 1-5), we will study the transcriptional regulation of CBF4 by cold and osmotic stress, as well as by the stress hormone abscisic acid (ABA), using RT-qPCR. In the second part of the course (weeks 6-11), we will study the function of CBF4 by generating cbf4 knockout mutants by genome editing (CRISPR/Cas9), and then study its subcellular localization by generating CBF4-YFP fusion proteins. Weeks 1-2 labs This week you will sterilize and plate Arabidopsis seeds to prepare plant samples needed in the next weeks to determine the transcriptional regulation of the CBF4. In week 1 you will also use bioinformatics tools to analyze gDNA and cDNA sequences (Bioinformatics Lab 1), find primers annealing sites, and run in silico PCR. In week 2 you will isolate genomic DNA (gDNA) from Arabidopsis seedlings (plantlets) and run PCR to test the primers that will be later used with cDNA in RT-qPCR (weeks 3- 5). 1  Gazzarrini, BIOD21 – Fall 2024 © WEEK 1 Exercise 1: Arabidopsis thaliana seed sterilization and plating on plant growth media Each group will sterilize 2 tubes of Arabidopsis wild type (WT) seeds and plate them on two agar plates containing synthetic plant growth media (1/2 MS). Both plates will be chilled at 4°C for 1 day (to break dormancy and synchronize germination) and then placed at 21°C under a long day cycle (18h light, 8h dark) until next week. Seedlings from one plate will be used for DNA isolation and PCR (week 2),while seedlings from the other plate will be exposed to stress/ABA for RNA isolation and RT-qPCR (weeks 3- 5). Before coming to class, watch the video on seed plating posted on Quercus. 1. Each student will label one microfuge tube containing Arabidopsis seeds (WT1 or WT2, group#) and add 1 mL of sterilization solution. Place them in the shaker for 5 min (or invert tubes every min.). 2. Turn Bunsen burner on and remove the sterilization solution with the pipette. Add 1 mL ddH20 and let the seeds settle. NB: Remove the sterilization solution slowly, as bleach can damage the pipette. Do not let the seeds sit in sterilization solution for more than 7 min or else the embryo may die. 3. Withdraw the water and repeat this step for 4 times under sterile conditions (Seeds will be washed a total of 5 times) 4. Add 200 µL ddH2O in the tube NB: You may have to add or remove some water depending on how much seed volume there is in the tube. 5. Label 2 MS plates. Plate 50 seeds in 4 rows: remove the tip from the pipette and lightly tap on the agar. Release only one seed. Follow TA instructions and watch the video posted on Quercus. 6. Secure the lid on the plate using two small pieces of micropore tape. Reagents/solutions ½ MS plates (supplied) 1.1 g/L Murashige and Skoog media (MS) (Sigma) 8 g/L Plant Agar (0.8%) (Sigma) àAutoclave Sterilization solution (supplied) 0.1% Triton X 1.5% Sodium Hypochlorite (Bleach) à Keep in the dark at 4ºC 2  Gazzarrini, BIOD21 – Fall 2024 © BIOINFORMATICS LAB 1 DNA Sequence Analysis and in silico PCR Started in class, finished on your own. In this Bioinformatics Lab, you will navigate various websites to retrieve information about gene structure and analyze genomic DNA (gDNA) and cDNA sequences. To conduct molecular biology studies, you need to have a good understanding of the structure of the gene you want to study. For example, to design gene specific primers for PCR and RT- qPCR it is useful to know if your gene has introns, how long are the UTRs, etc. (See Bioinf Lab 2 and lecture). You will organize your data into Figures and answer the questions highlighted in red. All this analysis will be included in the Bioinformatics Report (download from Quercus before coming to the lab). Important note. All Figures should have a Figure legend. The Figure legend should briefly describe the figure and include which websites/webtools were used to retrieve the information. PART I: Analysis of Gene Sequence To characterize DNA/protein sequences, you will use the following websites and web tools: NCBI, The National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov), hosts several databases (genomes, genes, protein, literature, chemicals, health) TAIR, The Arabidopsis Information Resource (http://www.arabidopsis.org) maintains a database of genetic and molecular biology data for the model higher plant Arabidopsis thaliana. Clustal Omega (https://www.ebi.ac.uk/jdispatcher/msa/clustalo), a program that generate alignments between three or more DNA or protein sequences. Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi), a program that finds regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance. Primer Blast at NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast). Primer-Bast uses Primer 3 to design primers, or test your own primers in silico, and then uses Blast to screen primers against the selected database (Ye et al., 2012; http://www.biomedcentral.com/1471-2105/13/134). Read the information about Primer-Blast. NB: You may need to use the FASTA format when pasting DNA sequences: > AT5G51990 cDNA ATGATGTGGAAT… 3  Gazzarrini, BIOD21 – Fall 2024 © Exercise 1) Characterization of CBF4 (AT5G51990) gene structure (done with the TA). A) CBF4 (AT5G51990) gene structure Go to NCBI - Genes database (https://www.ncbi.nlm.nih.gov/gene/). Type AT5G51990 in the Gene box and hit search, then select CBF4. Under “Gene summary”, retrieve ‘gene symbol’ and ‘gene description’(name), ‘locus tag’ (AGI #), ‘organism’ and ‘description’ (molecular and biological function, if known). Under “Genomic context”, retrieve the chromosome number and sequence coordinates. Under “Genomic regions, transcripts, and products” you will find the gene structure showing UTRs (light green boxes), exons (dark green boxes), introns (green lines). Take a snapshot of the drawing. Import the snapshots in PowerPoint and indicate 5’- and 3’-UTRs, exons and introns. This will be panel A of Figure 1. In the top, right side of the window, under “Tools”, select “sequence text view” to view the text analysis of the sequence (UTRs in purple, exons in orange, introns in green). Take a snapshot of the sequence (this will be panel B). Combine panels A and B into one figure (Figure 1) and write the legend briefly explaining each panel and how you obtained the results (programs/websites). B) Alignment of DNA Sequences For some experiments, including RT-qPCR, one may need to design specific primers that bind only your target gene (UTR regions are less conserved; there is more sequence divergence within a gene family), or primers that flank or span introns (see lecture). In these cases, it is useful to align sequences and select suitable regions. Go to TAIR and retrieve the CBF4 genomic, cDNA, CDS sequences (http://www.arabidopsis.org): type AT5G51990 or CBF4 in the “Gene” box and hit search. Now select AT5G51990. Once you are in the AT5G51990 locus page, scroll down and go to “Sequences”. Retrieve (copy) the CBF4 genomic, cDNA and CDS sequences. Paste the sequences in a word file, from which you can later retrieve the sequences. - [You can also get the gDNA, mRNA and CDS sequences from NCBI - Genes database: scroll down, go to NCBI Reference sequences (RefSeq), go to “genomic” (Click on FASTA) or “mRNA and protein”, then click on “NM_”, select ‘gene’ or ‘CDS’. I find the TAIR Arabidopsis website easier to use. However, from the NCBI database, sequences from all sequenced and annotated genomes can be retrieved.] Go to Clustal Omega (https://www.ebi.ac.uk/jdispatcher/msa/clustalo ). Under “Enter or paste a set of “, select ‘DNA’ (not protein). In “sequences in any supported format:” paste the CBF4 genomic, cDNA and CDS sequences as follows: 4  Gazzarrini, BIOD21 – Fall 2024 © > CBF4 genomic Nucleotide sequence > CBF4 cDNA Nucleotide sequence > CBF4 CDS Nucleotide sequence Hit ‘submit’. The program will align the three DNA sequences. Download the file, this will be Figure 2. Include a brief Figure legend. Þ Question 1: Which conclusion can you make about the CBF4 gene structure (eg. presence of introns/exons/5’UTR/3’UTR)? Exercise 2) Characterization of PP2A-A3 (AT1G13320) gene structure Repeat Exercise 1A and B with PP2A-A3 and make Figure 3 and 4. This is a large gene; you can show the beginning of the sequence structure (Fig 3B) and of the alignment (Fig 4), starting from the 5’UTR. Þ Question 2: Which conclusion can you make about the PP2A-A3 gene structure (eg. presence of introns/exons/5’UTR/3’UTR)? Þ Question 3: What is the difference between the structure of genomic DNA, cDNA and CDS (in terms of presence or absence of introns/exons/5’UTR/3’UTR?) PART II: PCR primer design and in silico PCR. You will test primers that amplify a gene fragment by in silico PCR using the following websites and web tools: Primer Blast at NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast). Primer- Bast uses Primer 3 to design primers, or test your own primers in silico, and then uses Blast to screen primers against the selected database (Ye et al., 2012; http://www.biomedcentral.com/1471-2105/13/134). Read the information about Primer-Blast. Exercise 3) Finding annealing sites of primers on gDNA and PCR amplicon size. In the D21 labs, we will use the following primers to amplify a fragment of the CBF4 (AT5G51990) and PP2A-A3 (AT1G13320) genes from genomic DNA (week 2) and from cDNA (week 3). In this exercise, you will first find primers annealing sites on CBF4 gDNA, and amplicon sizes generated in PCR using these primers and gDNA as the template. CBF4 For: 5’- TCCGACGGTTGAAATGGCTG-3’ CBF4 Rev: 5’- AGGAATACGAAGCCGCCAAG-3’ 5  Gazzarrini, BIOD21 – Fall 2024 © To find the annealing sites of CBF4 For and Rev primers on CBF4 gDNA and the amplicon size, go to Primer-Blast at NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast). We will use Primer-Bast to screen our primers against the Arabidopsis genome database to i) see if they are specific for your gene or bind other genes in the genome (since they are short sequences of nucleotides), ii) find Tm, and predict amplicon size. Copy and paste the CBF4 genomic sequence in “PCR template” box, and the CBF4 primers in “Primer parameters”. Then select Arabidopsis thaliana as organism, and RefSeq representative genomes as the database. Now hit ‘Get primers’. Þ Take a screenshot of the “graphical view” and “detailed primer report”. Retrieve the size of the amplicon (“product length”) generated with CBF4 primers and calculate the Ta (you will need this info for week 2 PCR). This will be Figure 5A). To find the detailed sequence annealing site, you can also align the primers to the gDNA and cDNA using Clustal Omega. However, the sequence of the reverse primer, which was designed as ‘reverse & complement” to the sequence in the database, needs to be changed back. Use this website to do so (https://www.bioinformatics.org/sms/rev_comp.html). We will name it “CBF4 Right primer”. Now align these three sequences (paste them in FASTA format) and take a screenshot. This will be Figure 5B. o > CBF4 genomic (sequence) o > CBF4 cDNA (sequence) o CBF4 CDS (sequence) o > CBF4 For primer (sequence) o > CBF4 Right primer (not rev comp) Þ Include screenshots of the “Clustal omega alignment” (just the region showing the primers aligning to the gDNA) in Figures 5. Þ Question 4. Which conclusion can you make about these primers? Are they specific for CBF4, or could they amplify other genes? Where do they anneal on the CBF4 gDNA and cDNA (exon, 5/3’ UTR, etc)? What would be the size of the amplicon (“product length”) if you used CBF4 cDNA as the PCR template and RefSeq mRNA as the database? PP2A-A3 is used as the reference gene in RT-qPCR (see weeks 3-5 labs and lectures for details). Repeat the same analysis for PP2A-A3 using these primers and include your analysis in Figures 6. PP2A-A3 For: 5’- TGTTGAGGAAACTTGCGTGA -3’ PP2A-A3 Rev: 5’- GAAAGTCGCTTAGCCAGAGG -3’ 6  Gazzarrini, BIOD21 – Fall 2024 © Þ Question 5. Could you find a product using these primers and gDNA? What did you find when aligning gDNA, cDNA and the primers? What would be the size of the amplicon (“product length”) if you used PP2A-A3 cDNA as the PCR template and RefSeq mRNA as the database (include a snapshot in Figure 6)? Discuss your results. Exercise 4) Characterization of ACTIN7 (AT5G0910) ACTIN7 is used as one of the reference genes in RT-qPCR (see weeks 3-5 labs and lectures for details). Repeat the same analysis done above using these primers. Do this exercise on your own. ACT7 For: 5’- TCACAGAGGCACCTCTTAACC -3’ ACT7 Rev: 5’- CCCTCGTAGATTGGCACAG -3’ 7  Gazzarrini, BIOD21 – Fall 2024 © WEEK 2 Exercise 2 Genomic DNA isolation from Arabidopsis wild-type (WT) plants Exercise 3 CBF4 amplification by PCR Exercise 4 Genomic DNA analysis (agarose gel) Exercise 5 PCR analysis (agarose gel) Data discussion; Q&A for preparing slides for oral presentations ________________________________________________________________________ Before coming to the lab, read the lab protocol/handout and complete the Laboratory Notebook Prelab). For the first lab, the TA will show you how to do this, but it would be a good exercise to try on your own. For the following labs, you will do this on your own. Exercise 2: Genomic DNA isolation from Arabidopsis wild-type (WT) plants CRUDE ISOLATION OF GENOMIC DNA In this exercise you will use a protocol that allows rapid isolation of genomic DNA (gDNA) from plants and can be used to genotype several plants in a short period of time. Plant cells are disrupted with SDS and NaCl, and cell debris is pelleted by high-speed centrifugation. Genomic DNA, which remains in solution, is precipitated by isopropanol and then washed by ethanol. Genomic DNA isolated with this method can be used in PCR reactions, but not in more sensitive applications, such as Southern blot. Note: WT seeds were sterilized, chilled for 1 day at 4°C to break dormancy and synchronize germination, and grown on synthetic plant growth media (1/2MS) for 6 days under long days at 21°C (12h lights, 8h dark). Before doing the exercises, we will practice dilutions and pipetting!!!!! 1. Each group will place 2 microcentrifuge tubes on the rack and label them: WT1- group#, WT2-group#. 2. Homogenize frozen or fresh plant material (5 to10 six-days-old seedlings) in 1.5 mL microcentrifuge tube with a micro pestle until there are no more chunks of plant tissue. 3. Leave the pestle in the microcentrifuge tube and add 500 µl Extraction Buffer and briefly homogenize. While adding the extraction buffer, try washing off residual plant material remaining on the pestle. When done, place the micropestle on a paper towel. You will rinse all pestles with water at the end. 4. Vortex the homogenate for 5 sec. 5. Place tube on ice until ready to load the centrifuge. 6. Centrifuge 1 min at maximum speed (13-14000 rpm) @RT to pellet debris. Note: DNA is in the supernatant 7. Label 2 clean tubes (WT1, WT2) and add 300 µl of 100% Isopropanol (2-Propanol) 8. Carefully remove 300 µl of the supernatant (contains DNA) from centrifuged tubes (from step 6) and add it to the tubes with 300 µl of Isopropanol (step 7). Close the 8  Gazzarrini, BIOD21 – Fall 2024 © lid. Mix by inverting the tubes 5 times and incubate at RT for 2 min to precipitate DNA. Note: final concentration of isopropanol is 50%. When transferring supernatant, try not to pipet plant debris that is on the bottom of the tubes by keeping the tip away from the bottom. Isopropanol is used instead of ethanol as DNA is less soluble in isopropanol and it will fall out of solution faster even at lower concentrations (àhigher DNA yield). The extraction buffer contains salt, which neutralizes charges on the DNA making it less soluble. 9. Centrifuge at 14 000 rpm for 5 min @RT to pellet DNA. Note: total RNA and salt will also precipitate. 10. Pipette out or pour off the supernatant. Note: DNA is now in the pellet; be extremely careful when pouring off the ethanol solution because the pellet may be loose. 11. Add 750 µl of 70% ethanol (ice cold) to the tube. This step is to wash off any residual salt (in the extraction buffer) and isopropanol (less volatile than ethanol). Salt can inhibit subsequent reactions. 12. Centrifuge at 14 000 rpm for 5 min @RT to pellet DNA. 13. Carefully discard the supernatant. Note: DNA in the pellet may be loose. Note: total RNA is also in the pellet 14. Desiccate pellet for 10 minutes Note: ensure there is no residual ethanol, which may inhibit subsequent reactions and make your DNA sample float out of the well when loading it in an agarose gel. 15. Resuspend the pellet in 20 µl TE buffer. Vortex for a few minutes until no pellet is visible and then place the tubes on ice. Keep DNA solution cold as much as possible to prevent degradation of DNA by endonuclease (DNase), as this is a crude extraction of genomic DNA. TE buffer protects DNA from degradation. TRIS buffer has mildly alkaline pH, which favours DNA solubilization, while EDTA chelates divalent cations such as Mg2+, which are required for the activity of enzymes such as DNAse, thus preventing DNA degradation. DNA can also be dissolved in water, if subsequent reactions require low salt. However, DNA will be less stable in water during storage. For long-term storage, DNA should be stored at -20°C or -80°C. 9  Gazzarrini, BIOD21 – Fall 2024 © Reagents/solutions DNA Extraction Buffer (supplied); from Edwards et al., 1991 250 mM Tris-HCl, pH 7.5 250 mM NaCl 25 mM EDTA *Autoclave, then add 0.5 % SDS. Store at RT. DNA is pH sensitive. During cell lysis, TRIS/pH7.5 is used to maintain a stable pH, while EDTA chelates/binds to divalent cations and inactivates DNases, which would be released during cell lysis and require divalent cations for activity. NaCl binds to and neutralizes DNA, making it less soluble; it also binds to proteins and helps to remove proteins that are bound to the DNA. It also helps to keep the proteins dissolved in the aqueous layer so they don't precipitate in the alcohol along with the DNA. SDS is a detergent, used to break open the cells. TE Buffer (supplied) 10 mM Tris-HCl, pH 8 1 mM EDTA Exercise 4: DNA amplification by PCR Here you will test the CBF4 and PP2A-A3 Forward (For) and Reverse (Rev) primers with the isolated gDNA using PCR. CBF4 specific primers: For: 5’- TCCGACGGTTGAAATGGCTG -3’ Rev: 5’- AGGAATACGAAGCCGCCAAG -3’ Amplicon size = ? see Bioinf. lab 1 Ta = ? see Bioinf. lab 1. PP2A-A3 specific primers: PP2A-A3 For: 5’- TGTTGAGGAAACTTGCGTGA -3’ PP2A-A3 Rev: 5’- GAAAGTCGCTTAGCCAGAGG -3’ Amplicon size = ? see Bioinf. lab 1. Ta (average of both Tm -5°C), to be used in PCR = ? see Bioinf lab 1 ACT7 For: 5’- TCACAGAGGCACCTCTTAACC -3’ ACT7 Rev: 5’- CCCTCGTAGATTGGCACAG -3’ Amplicon size = ? see Bioinf. lab 1. Ta (average of both Tm -5°C), to be used in PCR = ? see Bioinf lab 1 Þ Considering the Ta of your primer sets (CBF4 + PP2A-A3 or CBF4 + ACT7), can we use the same PCR cycle and same Ta for all samples? 10  Gazzarrini, BIOD21 – Fall 2024 © PCR set up: 1. Each group or student will set up 3 PCR reactions (3 tubes) on ice using the table below. Label each tube (WT1, WT2, WT3). 2. Using fresh tips for each reagent, add the following reagents in the tubes in the order shown below. STOCK WT1 WT2 WT3 2x PCR master mix 12.5 µL 12.5 µL 12.5 µL Water 7.5 µL 7.5 µL 7.5 µL CBF4 For + Rev primers 2 µL PP2AA3 For + Rev primers 2 µL ACT7 For + Rev primers 2 µL Template (genomic DNA) 3 µL 3 µL 3 µL Total volume 25 µL 25 µL 25 µL 3. Pulse the tubes for 10 sec in the microfuge and place tubes back on ice. 4. Leave the tubes on ice until everybody is ready to load the PCR thermocycler (or PCR machine). 5. PCR cycle used is as follows: Initial denaturation: 3’ @ 94 C PCR Cycle (35 times) -Denaturation: 30’’ @ 94 C -Annealing: 10’’ @ 55 -Extension: 1’ @ 72 C Final extension: 5’ @ 72 C 6. PCR samples will stay in the PCR machine overnight @ 4 C. Exercise 3: Genomic DNA analysis by agarose gel electrophoresis Before coming to the lab, watch the Addgene video about gel electrophoresis: https://www.addgene.org/protocols/gel-electrophoresis/ You will run genomic DNA on a gel to ensure that DNA isolation was successful, that DNA is not degraded and to have a rough estimate of the amount of DNA isolated from the different samples. 1. Label 3 tubes 2. Add 2 µL of loading dye first, then 10 µL DNA and load all (12 µL total volume) on 1% agarose gel casted with RedSafe DNA-binding dye. Load 8 µL of ladder in the first and last lane. 11  Gazzarrini, BIOD21 – Fall 2024 © Why don’t we add the loading dye directly into the tube containing the 20 µL DNA (step 15) and then load the DNA on the gel? 3. Run at 110 V for 30-45min 4. Analyze the gDNA (pictures of the gels will be uploaded on Quercus). Did you successfully isolate gDNA? Which bands correspond to the gDNA? Do you see other bands? If so, what could they represent? Why can’t you quantify gDNA extracted with this method using the spectrophotometer? If you want to use the spectrophotometer, which additional step would you need to perform? Reagents/solutions/equipment AGAROGE GEL ELECTROPHORESIS See Addgene video on gel electrophoresis: https://www.addgene.org/protocols/gel- electrophoresis/ Preparing agarose gels. 1% agarose gels have been prepared with TBE (TRIS/Borate/EDTA) buffer. Low % agarose (0.8-1%) allows better separation of large DNA fragments, while higher % of agarose (1.2-15%) is used to separate shorter DNA fragments. Each well has a capacity of ~20 µl. Each gel contains SafeRed stain, which binds DNA and allows visualization of DNA after UV light exposure. You can also use ethidium bromide stain. However, keep in mind that ethidium bromide is a toxic, DNA intercalating agent and a mutagen, thus wear appropriate protective gear (gloves, lab coat, safety glasses). Upon binding of the molecule (stain) to the DNA and illumination with a UV light source, the DNA banding pattern can be visualized. Loading and running agarose gel. Samples are mixed with 6X loading dye, which contains bromephenol blue and glycerol. Glycerol allows the DNA samples to fall at the bottom on the wells. Bromephenol blue is used as a tracking dye in electrophoresis. The migration of bromophenol blue is the same as of DNA i.e. it carries negative charge and moves in same direction of DNA with the speed equals to 200-400bp of DNA on a 1% agarose gel. Some loading dyes also contain xylen cyanol, which runs at approximately the same rate as a 4 kb DNA fragment on a 1% agarose gel. Agarose gels are run until the Bromephenol blue dye reaches approximately ¾ of the gel. Nucleic acid visualization on agarose gel. Gels are placed on a transilluminator box. Stained DNA bands will light up under UV illumination. Wear safety glasses; never observe fluorescence with unprotected eyes, as short-wave UV is damaging. In the lab, gels are placed in a gel documentation box, which is closed and does not require the use of safety glasses. DNA ladder. A DNA ladder is a solution of DNA molecules of different lengths used in agarose gel electrophoresis. It is used as a reference to estimate the size of unknown DNA molecules that were separated based on their mobility in an electrical field through the gel. The “1 Kb Plus DNA Ladder” (Invitrogen) will be used to determine the size of DNA fragments. A picture of the DNA ladder, after electrophoresis on a 1% gel, is shown below, and is also uploaded on Quercus. The size of each band is indicated in base pairs (bp). 12  Gazzarrini, BIOD21 – Fall 2024 © Exercise 5: PCR analysis by agarose gel electrophoresis 1. Label 3 clean tubes. Add 4 µL of the loading dye in each tube and then 20 µL of PCR product. Mix and load 20 µL on the gel. 2. Run at 110 V for 30-45min. 3. Determine the size (MW) of the PCR products. Do the observed amplicon sizes agree with the calculated ones? PCR reagents/solutions: Master mix (supplied at a 2X concentration). Final [ ]: 1.25 U Taq DNA polymerase, 0.2 mM each dNTP (dATP, dCTP, cGTP, dTTP), 10 mM Tris-HCl/pH 8.3, 50 mM KCl, 1.5 mM MgCl2. Primers: For + Rev. Stock concentration of each primer is 10 µM, while final concentration of each primer is 400 nM. Primers are therefore diluted 25X. Template: 50-100 ng of genomic DNA is typically used in PCR. To avoid inhibition of enzyme activity by contaminants, no more than 3 µL DNA will be used since a crude DNA isolation method was used. *At the end of the lab, summarize your results in Figures* Prepare Figures summarizing your results: include one slide about methodology: gDNA isolation and PCR cycle, and the gels showing gDNA and PCR. The Figures must be properly labelled (gel lanes, ladder, etc). Include Figure title and a brief legend. The Figures can be prepared in PowerPoint, Google slides, or similar and will be used in your oral presentations. The TA will check your figures and notebook every week. 13