Plant Genetics and CBF4 Gene Analysis
48 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What information can be retrieved from the NCBI Genes database regarding the CBF4 gene?

  • Organism lifespan and habitat
  • Phenotypic traits associated with the gene
  • Chromosome number and sequence coordinates (correct)
  • Protein structure and folding details

In constructing a figure with the CBF4 gene's structure, which elements are represented by light green boxes?

  • Exons
  • 3'-UTRs (correct)
  • Introns
  • 5'-UTRs (correct)

What is the main purpose of aligning DNA sequences when designing primers for RT-qPCR?

  • To enhance the speed of the sequencing process
  • To allow amplification of multiple genes simultaneously
  • To ensure primers bind to conserved regions only (correct)
  • To minimize the experimental cost

What is the initial step in sterilizing Arabidopsis seeds?

<p>Add 1 mL of sterilization solution and place in the shaker (C)</p> Signup and view all the answers

What is the purpose of chilling the plated seeds at 4°C for one day?

<p>To break dormancy and synchronize germination (A)</p> Signup and view all the answers

Which of the following formats can be retrieved from the NCBI Reference sequences for the CBF4 gene?

<p>Genomic DNA sequence (D)</p> Signup and view all the answers

Which type of sequence is likely to have more sequence divergence within a gene family?

<p>5'-UTRs (B)</p> Signup and view all the answers

How many times should the seeds be washed with ddH2O after sterilization?

<p>Five times (A)</p> Signup and view all the answers

What is the tool used for aligning sequences mentioned in the content?

<p>Clustal Omega (D)</p> Signup and view all the answers

What might happen if the seeds are left in the sterilization solution for more than 7 minutes?

<p>The embryo may die (A)</p> Signup and view all the answers

When viewing the gene structure of CBF4, what color represents introns in the text analysis view?

<p>Green (B)</p> Signup and view all the answers

What is the composition of the sterilization solution used for treating Arabidopsis seeds?

<p>0.1% Triton X and 1.5% Sodium Hypochlorite (D)</p> Signup and view all the answers

During the plating process, how many seeds should be plated in total on the MS plates?

<p>50 seeds (A)</p> Signup and view all the answers

What is the primary website suggested for retrieving the CBF4 genomic sequences?

<p>TAIR (D)</p> Signup and view all the answers

What is the optimal temperature for the seeds to be incubated after the chilling period?

<p>21°C (D)</p> Signup and view all the answers

How should the agar plate be secured after seeding?

<p>With two small pieces of micropore tape (D)</p> Signup and view all the answers

What is the purpose of using specific primers like CBF4 and PP2A-A3 in PCR?

<p>To amplify only the target genes in genomic DNA. (B)</p> Signup and view all the answers

What is the initial step in the PCR cycle as outlined in the procedure?

<p>Initial denaturation at 94°C for 3 minutes. (C)</p> Signup and view all the answers

What is the purpose of adding water to the PCR setup?

<p>To dilute the reagents to the required final volume. (A)</p> Signup and view all the answers

How long should the PCR samples remain in the PCR machine at the end of the process?

<p>Overnight at 4°C. (C)</p> Signup and view all the answers

Which components are essential for the PCR reaction besides the primers?

<p>Template DNA and dNTPs. (B)</p> Signup and view all the answers

What is the meaning of 'Ta' in the context of PCR?

<p>The temperature at which the primers anneal to the template. (D)</p> Signup and view all the answers

What is the purpose of using Primer-Blast at NCBI?

<p>To check the specificity of primers against the Arabidopsis genome database. (B)</p> Signup and view all the answers

What information can be obtained regarding the amplicon size?

<p>It can be retrieved after entering the genomic sequence in Primer-Blast. (A)</p> Signup and view all the answers

In the provided PCR setup, how much volume of the 2x PCR master mix is added to each tube?

<p>12.5 µL. (C)</p> Signup and view all the answers

What is the role of the reverse primer in the context of this procedure?

<p>It must be designed as a reverse complement to bind effectively to the target. (A)</p> Signup and view all the answers

What happens during the extension phase of the PCR cycle?

<p>Primers extend to form the new DNA strand. (B)</p> Signup and view all the answers

How can the sequence of the reverse primer be modified after obtaining it from the database?

<p>Using a reverse and complement tool online. (B)</p> Signup and view all the answers

What does the 'product length' refer to in the PCR process?

<p>The length of the amplified DNA segment from PCR. (A)</p> Signup and view all the answers

What is the result of aligning the primers with genomic and cDNA sequences?

<p>It identifies potential off-target amplification. (C)</p> Signup and view all the answers

What is the significance of determining the annealing sites of the primers?

<p>To ensure specific binding to regions like exons or UTRs. (B)</p> Signup and view all the answers

Which tool can be used to align multiple sequences in FASTA format?

<p>Clustal Omega. (C)</p> Signup and view all the answers

What is the purpose of using PP2A-A3 as a reference gene in RT-qPCR?

<p>To normalize expression levels in experiments (D)</p> Signup and view all the answers

What are the forward and reverse primer sequences for PP2A-A3?

<p>5’- TGTTGAGGAAACTTGCGTGA -3’ and 5’- GAAAGTCGCTTAGCCAGAGG -3’ (A)</p> Signup and view all the answers

What is a significant step in the crude isolation of genomic DNA from plants?

<p>Using high-speed centrifugation to pellet cell debris (B)</p> Signup and view all the answers

What could be the expected outcome when aligning gDNA, cDNA, and the primers?

<p>Similar patterns with some discrepancies (A)</p> Signup and view all the answers

What is one of the main roles of ACTIN7 in the RT-qPCR analysis?

<p>To serve as another reference gene alongside PP2A-A3 (D)</p> Signup and view all the answers

Which reagent is used to precipitate genomic DNA during its isolation?

<p>Isopropanol (B)</p> Signup and view all the answers

The PCR template used for amplifying PP2A-A3 should preferably be what type of RNA?

<p>Coding DNA (cDNA) (B)</p> Signup and view all the answers

What is the function of SDS in the genomic DNA isolation protocol?

<p>To dissolve lipid membranes and release DNA (B)</p> Signup and view all the answers

What is the purpose of a DNA ladder in agarose gel electrophoresis?

<p>To serve as a reference for estimating the size of unknown DNA fragments. (A)</p> Signup and view all the answers

What is the main reason for wearing safety glasses when observing stained DNA bands under UV light?

<p>To protect against short-wave UV radiation which is damaging to the eyes. (D)</p> Signup and view all the answers

At what voltage should the gel electrophoresis be run according to the procedure?

<p>110 V (B)</p> Signup and view all the answers

What is the final concentration of Taq DNA polymerase in the master mix?

<p>1.25 U (C)</p> Signup and view all the answers

What is the role of loading dye in PCR analysis by agarose gel electrophoresis?

<p>It allows visual tracking of the sample during electrophoresis. (A)</p> Signup and view all the answers

How much genomic DNA should typically be used in PCR to avoid inhibition of enzyme activity?

<p>3 µL (B)</p> Signup and view all the answers

What does the term ‘4 kb DNA fragment’ mean in the context of agarose gel electrophoresis?

<p>A DNA strand that is 4000 base pairs long. (C)</p> Signup and view all the answers

What should be included in the figures summarizing the results of the PCR analysis?

<p>Methodology, gDNA isolation, PCR cycle, and gel results. (A)</p> Signup and view all the answers

Flashcards

Seed Sterilization

A process that involves removing harmful microorganisms from seeds using a bleach solution.

Plant Growth Media (1/2 MS)

A specialized media used to grow plants in a controlled environment. It provides essential nutrients and helps synchronize germination.

Seed Plating

The act of placing sterilized seeds onto the surface of agar plates containing plant growth media.

Chilling at 4°C

A controlled environment where seeds are kept at 4°C for 24 hours to promote synchronized germination.

Signup and view all the flashcards

Long Day Cycle (18h Light, 8h Dark)

A specific growth condition that mimics natural day and night cycles. The seeds are exposed to 18 hours of light and 8 hours of darkness.

Signup and view all the flashcards

DNA Isolation

A method used to extract DNA from plant cells.

Signup and view all the flashcards

PCR (Polymerase Chain Reaction)

A laboratory technique used to amplify specific DNA sequences.

Signup and view all the flashcards

ABA (Abscisic Acid)

A stress hormone that can be used to study the plant's response to environmental challenges.

Signup and view all the flashcards

Primer-Blast

A tool used to design PCR primers, analyze their specificity, and predict the amplicon size.

Signup and view all the flashcards

Tm

The temperature at which 50% of a DNA strand will be denatured.

Signup and view all the flashcards

Amplicon

The sequence of DNA produced by PCR using forward and reverse primers.

Signup and view all the flashcards

Product Length

The length of the amplified DNA sequence produced by PCR.

Signup and view all the flashcards

Clustal Omega

A web-based tool used to perform sequence alignments.

Signup and view all the flashcards

FASTA

A format used to store sequences - a single line identifier followed by a sequence on subsequent lines.

Signup and view all the flashcards

Annealing Site

The region where a primer binds to a DNA strand during PCR.

Signup and view all the flashcards

CDS (Coding Sequence)

The area of DNA that codes for a protein.

Signup and view all the flashcards

DNA Sequence Alignment

The process of aligning multiple DNA sequences to identify similarities and differences, often used for identifying conserved regions, designing primers, or detecting mutations.

Signup and view all the flashcards

Primers

A short DNA sequence used in PCR to amplify a specific target region. Primers are designed to bind to complementary sequences on either side of the target region.

Signup and view all the flashcards

Exon

A specific region of DNA that codes for a protein or functional RNA. Exons are transcribed into mRNA and translated into protein.

Signup and view all the flashcards

Intron

Non-coding regions within a gene that are transcribed into mRNA but are removed before translation, making them not part of the protein.

Signup and view all the flashcards

5'-UTR

The untranslated region of an mRNA molecule that lies upstream of the coding sequence.

Signup and view all the flashcards

3'-UTR

The untranslated region of an mRNA molecule that lies downstream of the coding sequence.

Signup and view all the flashcards

NCBI - Genes database

A database containing information about genes and proteins, including gene descriptions, sequences, and related publications.

Signup and view all the flashcards

PP2A-A3

A reference gene commonly used in RT-qPCR (reverse transcription quantitative polymerase chain reaction), it is a stable gene that serves as a control for standardization of data analyses.

Signup and view all the flashcards

gDNA

DNA extracted directly from the cells of an organism.

Signup and view all the flashcards

cDNA

A specific type of DNA created from the RNA transcript of a gene. It can be used to analyze gene expression at the RNA level.

Signup and view all the flashcards

ACTIN7

A reference gene for RT-qPCR analysis, a stable gene involved in cell structure and functions.

Signup and view all the flashcards

RefSeq mRNA

This is the DNA sequence of a gene as it appears in the database, often used as a reference for comparing to experimental sequences.

Signup and view all the flashcards

TE Buffer

A solution containing 10 mM Tris-HCl at a pH of 8 and 1 mM EDTA. It is commonly used to store and stabilize DNA.

Signup and view all the flashcards

Tm (Melting Temperature)

The temperature at which 50% of a DNA strand will denature, meaning the two strands separate.

Signup and view all the flashcards

Amplicon Size

The length of the DNA sequence generated in a PCR reaction.

Signup and view all the flashcards

PCR Cycle

A set of conditions for running a PCR reaction, including the initial denaturation temperature, the annealing temperature, and the extension temperature. These are optimized for the specific primer set being used.

Signup and view all the flashcards

DNA Ladder

A solution of DNA molecules with known sizes used to determine the size of unknown DNA fragments in agarose gel electrophoresis. It acts as a reference point for comparison.

Signup and view all the flashcards

Bromephenol Blue

A negative charge that moves in the same direction as DNA during electrophoresis, allowing scientists to follow the progress of the DNA migration.

Signup and view all the flashcards

PCR product

The DNA fragments produced by PCR amplification.

Signup and view all the flashcards

Master Mix

A mixture containing the necessary ingredients for PCR, including DNA polymerase, dNTPs, and buffer solutions.

Signup and view all the flashcards

Study Notes

BIOD21 Labs - Fall 2024

  • Weeks 1-2: DNA isolation, DNA sequencing analysis, and PCR
  • Week 1 (Sep 4-5, 2024): Seed sterilization and plating of Arabidopsis thaliana seeds on growth media
  • Week 2 (Sep 11-12, 2024): Isolation of genomic DNA from Arabidopsis wild-type (WT) plants and CBF4 amplification by PCR.
  • Exercises (weeks 1-2): Seed sterilization, plating on growth media, genomic DNA isolation, PCR analysis (agarose gel), and data discussion.
  • Lab Components: Arabidopsis thaliana seed sterilization and plating on 1/2 MS media for growth; genomic DNA isolation from plantlets; in-silico PCR using bioinformatics tools; PCR of CBF4 gene.
  • In-Class Quizzes: (gDNA and PCR), Sep 12. Bioinformatics lab assignment due Sep 13 (11:59 PM).
  • Bioinformatics Lab 1: Analysis of genomic DNA and cDNA sequences.
  • Course Outline The first part of the course (weeks 1-5) focuses on the transcriptional regulation of CBF4 by cold and osmotic stress and by the stress hormone abscisic acid (ABA), using RT-qPCR. The latter part of the course (weeks 6-11) studies the function of CBF4 by generating cbf4 knockout mutants by CRISPR/Cas9 and analyzing its subcellular localization.

Introduction to BIOD21 Labs

  • CBF4 Function: Students will study the C-repeat-binding factor (CBF4) gene's function in Arabidopsis, specifically how it's regulated by cold stress, osmotic stress, and the stress hormone abscisic acid (ABA).
  • CBF Family: CBF4 belongs to the AP2/EREBP family of transcription factors, closely related to CBF1, CBF2, and CBF3. These factors are involved in cold stress responses.
  • Research Focus: The lab will determine the transcriptional regulation of CBF4.

Bioinformatics Lab 1

  • Tools: NCBI, TAIR, Clustal Omega, Blast, and Primer Blast.
  • Purpose: Retrieve genetic information, analyze genomic DNA (gDNA) and cDNA, design primers, and carry out in silico PCR.

DNA Sequence Analysis/In Silico PCR:

  • Analysis: Students use tools to characterize DNA sequences:
    • Gene structure, intron-exon, UTRs,
    • Alignment of sequences using Clustal Omega
    • Identify similarities in gene sequences.
    • Design gene-specific primers for PCR
    • Test primers in silico and analyze results to evaluate primer performance.
  • Importance : Fundamental to Molecular Biology research.
  • Deliverables: Create Figures for the Bioinformatics report.

Exercise 1: Characterization of CBF4 (AT5G51990) Gene Structure

  • Methodology: Students use the NCBI Gene database, retrieve information and identify characteristics of the gene (name, symbol, locus tag, organism, coordinates, and biological function) as well as the genomic contexts. Generate sequence figures.

Exercise 2: Characterization of PP2A-A3 (AT1G13320) Gene Structure

  • Purpose: To replicate exercise 1 on a second gene (PP2A-A3) and generate comparison figures on the gene structure.

Exercise 3: Primer Design and PCR Amplicon Size

  • Methodology: Design and analyze primers for CBF4 or PP2A-A3 using Primer-Blast.
  • Analyze: Test primer specificity; evaluate annealing sites on gDNA & cDNA; and determine the expected amplicon size.

Exercise 4: Characterization of ACTIN7 (AT5G0910)

  • Purpose: Similar analysis of ACTIN7 as in previous steps.

Week 2 Lab: Genomic DNA Isolation

  • Procedure: Plant tissue homogenization, lysis, debris removal, DNA precipitation and purification, and resuspension.
  • Materials: Extraction buffer, micro pestle, microfuge tubes, 100% isopropanol, 70% ethanol, ice-cold tubes, TE buffer.
  • Purpose: Extract genomic DNA from Arabidopsis tissue to be used in PCR.

Week 2 Lab: PCR Analysis

  • Procedure: Setting up PCR reactions, running PCR, visualising the gel using electrophoresis.
  • Purpose: To amplify specific DNA sequences.

Other Key Points from the Document

  • DNA Extraction Buffer: Contains Tris/pH7.5, NaCl (to neutralize DNA charge), EDTA (to inhibit DNAases), and SDS.
  • TE Buffer: Used for DNA resuspension to stabilise DNA.
  • Primer Design: Critical for PCR success.
  • PCR Reagents: Supplied at 2x concentration needed for specific ratios.
  • Gel Electrophoresis: Use to visualise PCR products using 1% agarose gel electrophoresis and a DNA ladder.
  • Loading Dye: Contains bromophenol blue and glycerol to aid gel loading.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

BIOD21 Labs Fall 2024 Weeks 1-2 PDF

Description

This quiz covers essential topics related to the CBF4 gene, including its structure, the importance of alignment in RT-qPCR primer design, and the sterilization process for Arabidopsis seeds. Test your understanding of gene information retrieval from the NCBI database and the implications of various procedures in plant genetics.

Use Quizgecko on...
Browser
Open
Browser
Browser