Respiration (Breathing) PDF

Respiration (Breathing) Organs of the respiratory system in mammals: Upper respiratory system: Nose, nasal cavity, sinuses, pharynx, larynx. Lower respiratory system: Trachea, bronchi, bronchioles, lungs (including alveoli). Purpose of the respiratory system: To facilita...

Respiration (Breathing) Organs of the respiratory system in mammals: Upper respiratory system: Nose, nasal cavity, sinuses, pharynx, larynx. Lower respiratory system: Trachea, bronchi, bronchioles, lungs (including alveoli). Purpose of the respiratory system: To facilitate gas exchange (oxygen in, carbon dioxide out) essential for cellular respiration. Gases involved in gas exchange & location: Oxygen (O₂) and Carbon Dioxide (CO₂). Gas exchange occurs in the alveoli of the lungs. How the ribs and diaphragm help us breathe: Inhalation: The diaphragm contracts and flattens, while the ribcage expands, creating negative pressure that draws air into the lungs. Exhalation: The diaphragm relaxes, and the ribcage contracts, pushing air out of the lungs. Diagram the path of airflow through the respiratory system: Path: Nose/Mouth → Pharynx → Larynx → Trachea → Bronchi → Bronchioles → Alveoli. Respiratory & cardiovascular systems working together: 1. Oxygen delivery: The respiratory system brings oxygen into the lungs, where it diffuses into the blood. The cardiovascular system transports it to tissues for cellular respiration. 2. CO₂ removal: The cardiovascular system carries CO₂ from tissues back to the lungs for exhalation. Breathing mechanisms in different organisms: Mammals: Use lungs, diaphragm, and ribcage.  Birds: Use a unique system of air sacs and unidirectional airflow. Fish: Use gills for oxygen uptake from water, employing countercurrent exchange. Insects: Use a tracheal system of spiracles and air tubes directly to tissues. 8. Countercurrent exchange: Found in fish gills; blood flows opposite to water, maximizing oxygen uptake and CO₂ removal Respiration (Breathing) Organs of the respiratory system in mammals Upper respiratory system: Nose, nasal cavity, sinuses, pharynx, larynx Lower respiratory system: Trachea, bronchi, bronchioles, lungs (including alveoli) Purpose of the respiratory system To facilitate gas exchange by bringing oxygen into the body and removing carbon dioxide Gasses involved in gas exchange and location Oxygen and carbon dioxide; gas exchange occurs in the alveoli of the lungs How the ribs and diaphragm help us breathe Inhalation: The diaphragm contracts and flattens, while the ribcage expands, creating negative pressure that draws air into the lungs Exhalation: The diaphragm relaxes, and the ribcage contracts, pushing air out of the lungs Diagram the path of airflow through the respiratory system Nose or mouth to pharynx to larynx to trachea to bronchi to bronchioles to alveoli How the respiratory and cardiovascular systems work together Oxygen is brought into the lungs through inhalation and diffuses into the blood in the alveoli; the cardiovascular system transports oxygen-rich blood to body cells and brings back carbon dioxide-rich blood to the lungs for exhalation Breathing mechanisms in birds, fish, insects, and mammals Birds have air sacs and unidirectional airflow, allowing constant oxygen exchange even during exhalation Fish use gills and countercurrent exchange to extract oxygen from water Insects rely on a tracheal system that delivers air directly to tissues Mammals use a diaphragm and lungs for bidirectional airflow What is countercurrent exchange and why is it important Countercurrent exchange is a mechanism where fluids flow in opposite directions, maximizing oxygen and carbon dioxide exchange efficiency in fish gills or maintaining thermal regulation in other animals Why it is important to breathe oxygen Oxygen is essential for cellular respiration, which produces ATP, the energy currency of the cell Circulation Purpose of the circulatory system To transport oxygen, nutrients, hormones, and waste products throughout the body Organs and tissues involved Heart, blood, blood vessels (arteries, veins, capillaries), and lymphatic vessels Chambers and valves of the heart Four chambers: Right atrium, right ventricle, left atrium, left ventricle Four valves: Tricuspid valve, pulmonary valve, mitral valve, aortic valve Order of heart chamber contractions Atria contract first, followed by the ventricles Order that blood travels through the body in humans Right atrium to tricuspid valve to right ventricle to pulmonary valve to pulmonary arteries to lungs to pulmonary veins to left atrium to mitral valve to left ventricle to aortic valve to aorta to body tissues and back via veins What causes the heartbeat sounds The "lub-dub" sound is caused by the closing of heart valves; the "lub" is the atrioventricular valves (tricuspid and mitral) closing, and the "dub" is the semilunar valves (pulmonary and aortic) closing Three types of blood vessels and their order Arteries carry blood away from the heart, capillaries perform exchange at tissues, veins return blood to the heart Which blood vessels perform gas exchange and where Capillaries; found in the lungs (oxygen in and carbon dioxide out) and body tissues (oxygen out and carbon dioxide in) Which blood vessels have a pulse Arteries Why gas exchange matters Cells need oxygen for cellular respiration and to expel carbon dioxide, which is a waste product Chambers with oxygenated and deoxygenated blood Oxygenated blood: Left atrium and left ventricle Deoxygenated blood: Right atrium and right ventricle What is blood pressure and where is it highest Blood pressure is the force of blood against vessel walls; highest in arteries Normal reading: 120/80 mmHg Blood pressure during systole or diastole Blood pressure is higher during systole (ventricular contraction) Difference between open and closed circulatory systems Closed: Blood is confined to vessels, more efficient (humans, birds) Open: Blood flows freely in body cavities (insects) Difference between 2-circuit and 1-circuit circulatory systems 2-circuit: Pulmonary circuit sends blood to the lungs, systemic circuit sends blood to the body (e.g., humans) 1-circuit: Blood flows in a single loop (fish) Gene Expression What is DNA? DNA (Deoxyribonucleic Acid) is the molecule that contains the genetic instructions for the development and function of all living organisms. It consists of two strands that coil into a double helix. How many strands make up a single DNA molecule? A DNA molecule consists of two strands. What is the monomer for DNA? How are the monomers different from each other? The monomer for DNA is a nucleotide, composed of a sugar (deoxyribose), a phosphate group, and a nitrogenous base. The four nitrogenous bases are adenine (A), thymine (T), cytosine (C), and guanine (G). What are the nitrogenous bases in DNA? Adenine (A), thymine (T), cytosine (C), and guanine (G). What are the complementary base pairs? A pairs with T, and C pairs with G. Explain what “DNA is antiparallel” means? DNA strands run in opposite directions, meaning one strand runs 5' to 3', while the other runs 3' to 5'. What do we actually do with our DNA? DNA contains the instructions for making proteins and controlling cell processes. We express our genes to produce proteins, which then perform various functions in the body. Gene Expression Process What is a gene? What are genes a blueprint for? A gene is a sequence of DNA that provides the instructions to make a specific protein, which in turn determines the function of the gene. How are genes, DNA, and chromosomes different from each other? DNA is the molecule that contains genetic information. A gene is a segment of DNA that codes for a specific trait or protein. Chromosomes are structures made of DNA and protein that carry genes. What is RNA? How is it different from DNA? RNA (Ribonucleic Acid) is similar to DNA but is single-stranded and uses ribose as its sugar instead of deoxyribose. RNA also uses uracil (U) instead of thymine (T). What are the 2 steps of Gene Expression? 1. Transcription: DNA is used as a template to make messenger RNA (mRNA). 2. Translation: mRNA is translated into a protein by ribosomes in the cytoplasm. Transcription Where does transcription occur in the cell? Transcription occurs in the nucleus. Describe the three steps of Transcription: 1. Initiation: RNA polymerase binds to the promoter region of the gene. 2. Elongation: RNA polymerase reads the template strand and builds the mRNA strand. 3. Termination: RNA polymerase reaches the termination sequence, and the mRNA is released. What does RNA polymerase do? RNA polymerase reads the DNA template strand in the 3' to 5' direction and synthesizes the mRNA in the 5' to 3' direction. What is a coding strand? A template strand? Which one is used for transcription? The coding strand has the same sequence as the mRNA (except for uracil in RNA instead of thymine). The template strand is used as the template for mRNA synthesis during transcription. What is a Promoter Region? What is a TATA box? The promoter region is a sequence of DNA where RNA polymerase binds to initiate transcription. The TATA box is a specific DNA sequence within the promoter that helps position RNA polymerase correctly. If a DNA sequence’s CODING STRAND is: 5’ ACG-GTT-ACT-TAC-TCA 3’, what sequence will the DNA template strand be? Template strand: 3’ TGC-CAA-TGA-ATG-AGT 5’ What sequence will the mRNA that is produced in Transcription be? mRNA sequence: 5’ ACG-GUU-ACU-UAC-UCA 3’ What is a termination sequence? A termination sequence is a specific DNA sequence that signals the end of transcription. RNA Processing What occurs during RNA processing? 1. Capping: A 5' cap is added to the mRNA. 2. Polyadenylation: A poly-A tail is added to the 3' end.  3. Splicing: Introns are removed, and exons are joined together to form mature mRNA. Why do these three things occur? These modifications help stabilize the mRNA, facilitate its export from the nucleus, and assist in translation. Translation Where does translation occur in the cell? Translation occurs in the cytoplasm, specifically on ribosomes. What is a codon? A codon is a sequence of three nucleotides in mRNA that codes for a specific amino acid. How many amino acids are added to the protein for each codon? Each codon corresponds to one amino acid. If an mRNA is 30 bases long, how many codons are there in that sequence? There would be 10 codons in a 30-base-long mRNA sequence. How many amino acids will the protein have? The protein will have 10 amino acids. How many bases long is the DNA sequence of a protein that has 25 amino acids? The DNA sequence will be 75 bases long (3 bases per amino acid). What are Start and Stop codons? The start codon is usually AUG (methionine), signaling the beginning of translation. Stop codons (UAA, UAG, UGA) signal the end of translation. If you have an mRNA sequence that reads as follows: 5’ GGCUGAGGCCAUGCCAUUUAUACGAUGA 3’, where in that sequence will the RNA start being read to make the protein? The reading starts at the AUG codon (start codon). How many amino acids will the resulting protein have in it? This mRNA sequence would produce 6 amino acids, since translation stops at the stop codon (UGA). tRNA in Translation What is the role of tRNA in translation? tRNA brings amino acids to the ribosome and matches its anticodon with the mRNA codon during translation. Mutations and Genetic Engineering What is a mutation? A mutation is a change in the DNA sequence, which can alter gene function. Types of mutations we discussed? Point mutations (substitutions, insertions, deletions) Frameshift mutations (due to insertions or deletions) Do mutations always affect the resultant protein’s amino acid sequence? Not always; some mutations are silent and do not change the amino acid sequence. What is recombinant DNA? Recombinant DNA is DNA that has been artificially combined from different sources. What are GMOs? Genetically Modified Organisms (GMOs) are organisms whose DNA has been altered through genetic engineering. What is DNA methylation? What does it do? DNA methylation is the addition of a methyl group to DNA, which typically suppresses gene expression. What is genetic engineering? Genetic engineering involves manipulating an organism’s DNA to achieve desired traits. Cell Cycle and Mitosis Distinguish between DNA, chromosomes, chromatin, genome, genes, DNA, and base pairs. DNA: The molecule containing genetic information. Chromosomes: Condensed structures made of DNA and protein. Chromatin: The uncoiled, relaxed form of DNA.  Genome: The complete set of genes or genetic material in an organism. Genes: Segments of DNA that code for proteins. Base pairs: Pairs of nitrogenous bases (A-T, C-G) in DNA. How many chromosomes are there in a typical human cell? Humans have 46 chromosomes (23 pairs). What is a karyotype? A karyotype is a picture of an organism’s chromosomes arranged in pairs. What are the two possible sex chromosomes? X and Y. Males have XY, females have XX. What is a centromere? The centromere is the region where sister chromatids are joined together in a chromosome. What is trisomy? Trisomy is a condition where there are three copies of a chromosome instead of two. Cell Cycle What is the ultimate goal of the cell cycle? To produce two genetically identical daughter cells. What is the difference between a diploid and a haploid cell? Diploid cells have two sets of chromosomes (e.g., somatic cells). Haploid cells have one set of chromosomes (e.g., gametes). In Mitosis, is the DNA in daughter cells the same as the DNA in the original parent cell? Yes, the DNA is identical in the daughter cells to the parent cell. What happens in the S, G1, G2, and G0 phases? G1: Cell grows and performs normal functions. S: DNA is replicated. G2: Cell prepares for mitosis. G0: Cells exit the cell cycle and do not divide. What is apoptosis? Apoptosis is programmed cell death. Mitosis Process What does IPMAT stand for? Interphase Prophase Metaphase Anaphase Telophase What are the four steps of mitosis? 1. Prophase: Chromosomes condense, the nuclear membrane breaks down. 2. Metaphase: Chromosomes align at the cell's equator. 3. Anaphase: Sister chromatids are pulled apart to opposite sides. 4. Telophase: Nuclear membranes reform around chromosomes. What is cytokinesis? Cytokinesis is the division of the cytoplasm and other organelles into two daughter cells. What is a cleavage furrow? A cleavage furrow is the indentation that forms in the cell membrane during cytokinesis in animal cells. DNA Replication What is DNA replication? What is produced? DNA replication is the process of copying DNA to produce two identical strands. When does it occur in the cell cycle? During the S phase of the cell cycle. What does semiconservative mean? Each new DNA molecule consists of one old (parental) strand and one newly synthesized strand. What enzymes are involved in DNA replication and what do they do?  Helicase unwinds the DNA. Primase synthesizes RNA primers. DNA polymerase adds nucleotides to the growing strand. Ligase seals the gaps between fragments. What is a replication fork? The Y-shaped region where the DNA is being unwound and replicated. Which direction does DNA polymerase read strands of DNA? DNA polymerase reads the template strand in the 3' to 5' direction. What is the leading strand? The lagging strand? Leading strand: Continuously synthesized in the same direction as the replication fork. Lagging strand: Synthesized in fragments (Okazaki fragments) opposite the direction of the replication fork. What is the difference in shape between a doubled chromosome and a non-doubled chromosome? A doubled chromosome consists of two sister chromatids, whereas a non-doubled chromosome is a single chromatid. Which phases of the cell cycle have doubled chromosomes? During prophase, metaphase, anaphase, and telophase, chromosomes are doubled.