Lecture Set 8: Translation PDF

# Translation ## Central Dogma Analogy - Genome (DNA) is depicted as an open book. - Transcript (mRNA) is depicted as a yellow sticky note with a pin. - Translated protein is depicted as a pile of chocolate chip cookies. An arrow points from the book to the sticky note and another arrow points fr...

# Translation ## Central Dogma Analogy - Genome (DNA) is depicted as an open book. - Transcript (mRNA) is depicted as a yellow sticky note with a pin. - Translated protein is depicted as a pile of chocolate chip cookies. An arrow points from the book to the sticky note and another arrow points from the note to the cookies. Another arrow points up from the cookies. "We are now going to focus on this step." ## mRNA is translated into proteins In general, proteins fall into two classes: - **Structural proteins** - Provide support to the cell (i.e., cytoskeleton, membranes, protein scaffolds) - **Enzymes** - Biological catalysts — perform reactions ## mRNA is translated into proteins - Proteins are composed of amino acids - 20 different amino acids are found in proteins - Each amino acid has different properties (size, charge, etc.) - Amino acids are linked by peptides bonds - The product is called a polypeptide ## General structure of an amino acid - **Amino group**: +H₃N - **Hydrogen**: H - **Carboxyl group**: COO- - **Radical group (side chain)**: R ## Amino Acid Structures A table with two columns, *nonpolar* and *polar* is presented. The table is divided horizontally into three sections *nonpolar*, *polar* and *electrically charged*. Each section contains a list of different amino acids with their corresponding structure. **Nonpolar** - Glycine (Gly) - Alanine (Ala) - Valine (Val) - Leucine (Leu) - Isoleucine (Ile) - Methionine (Met) - Tryptophan (Trp) - Phenylalanine (Phe) - Proline (Pro) **Polar** - Serine (Ser) - Threonine (Thr) - Cysteine (Cys) - Tyrosine (Tyr) - Asparagine (Asn) - Glutamine (Gln) **Electrically Charged** - **Acidic**: Aspartic Acid (Asp) Glutamic Acid (Glu) - **Basic**: Lysine (Lys) Arginine (Arg) Histidine (His) ## A peptide bond - Formed via dehydration reaction - R₁+H₃N-CH-C = O- + H-N-CH-COO^-<sub> - H₂O - R₁+H₃N-CH-C-N-CH-COO^-<sub> - O- Peptide bond ## Proteins have four levels of structure - **Primary** - Linear polypeptide (=amino acids) that are linked by peptide bonds - **Secondary** - Due to hydrogen bonding between amino acid 'backbones' (not their R-groups/side chains) - Forms alpha helices and beta-pleated sheets - **Tertiary** - Due to interaction among side chains - e.g. Disulphide bonds, charge interactions - **Quaternary** - Multiple protein interaction (e.g., RNA polymerase, hemoglobin) ## Secondary Structure: Alpha Helix In the secondary structure of an alpha helix (a helix), - hydrogen bonds form between the oxygen of the groups and the hydrogen of groups of the amide bonds in the next turn of the a helix. - the formation of many hydrogen bonds along the polypeptide chain gives the helical shape of a spiral staircase. ## Secondary Structure: Beta-Pleated Sheet In the secondary structure of a beta-pleated sheet (B-pleated sheet), hydrogen bonds form between the carbonyl oxygen atoms and hydrogen atoms in the amide groups bending the polypeptide chain into a sheet. ## Secondary Structure: Triple Helix In the secondary structure of a triple helix, - three polypeptide chains are woven together. - hydrogen bonds hold the chains together giving the polypeptide the added strength typical of collagen, connective tissue, skin, tendons, and cartilage. Collagen fibers are triple helices of polypeptide chains held together by hydrogen bonds. ## Tertiary Structure (2 of 3) Interactions between amino acid R groups fold a protein into a specific three-dimensional shape called its tertiary structure. ## Tertiary Structure (3 of 3) Sections of a protein interact to create the tertiary structure of a protein due to - hydrophobic interactions between two nonpolar amino acids - hydrophilic interactions between the external aqueous environment and the R groups of polar amino acids - salt bridges, ionic bonds between ionized R groups of basic and acidic amino acids - hydrogen bonds between H of a polar R group and the O or N of another amino acid - disulfide bonds cysteine amino acids groups of ## Quaternary Structure The quaternary structure: - is the combination of two or more protein units. - consists of four polypeptide chains as subunits in hemoglobin. - is stabilized by the same interactions found in tertiary structures. In the ribbon structure of hemoglobin, the quaternary structure is made up of four polypeptide subunits: two (red) are chains and two (blue) are chains. The heme groups (green) in the four subunits bind oxygen. ## Hemoglobin Hemoglogin (shown here) is a protein found in our red blood cells that binds Oxygen molecules and delivers them to respiring tissues. In humans, this oxygen is acquired from the lungs. Hemoglobin's quaternary structure is a product of four side chains that are encoded by multiple genes. The structure play a key role in hemoglobin's efficiency of oxygen capture and delivery in the body. Note for students: hemoglobin, you should understand what it illustrates about relationships between protein structure and function (e.g. that a protein can be built from polypeptides encoded by multiple genes, and the quaternary structure determines the protein's function) ## Why does protein structure matter? - The structures of proteins determine their functions. Small structural changes can make big differences - Misfolded or mutated proteins can malfunction and cause cellular damage - Some malformed proteins (prions) are also pathogenic. They cause chain reactions that reshape other proteins of their kind, and further damage cells. ## What performs translation? - **Ribosomes** - Composed of protein and rRNA - Two subunits - Small subunit and large subunit - Both subunits interact with and read mRNA, using the information (i.e. read the codons) to make a protein - **tRNAs** - Composed of RNA (tRNA) - Carry a specific amino acid to the ribosome ## How does the ribosome know which amino acids to use? - mRNA tells the ribosome which amino acids to string together to make a protein. - mRNA does this with universal genetic code - Code consists of three nucleotide segments - These triplets are called codons - Each codon specifies a particular amino acid - The genetic code contains 64 codons - But encodes only 20 amino acids? - Code is degenerate – multiple codons often encode one amino acid ## So what does a codon look like? - Take for example the following mRNA sequence: 5' AUGUGGCGACGAUAGCGAUAGCGA 3' - When broken up into codons, the sequence is: 5' AUG UGG CGA CGA UAG CGA UAG CGA 3' - a sequence of nucleotide triplets - each codon always specifies a particular amino acid - most amino acids are specified by >1 codon. ## The universal code A table with three columns labeled *First base*, *Second base* and *Third base* is presented, with 4 rows each. Each cell of the table contains a codon (three letters) and the corresponding amino acid it defines. ## Some special codons to notice: - AUG - encodes start (as in begin translation) and also the amino acid called methionine - **UAG, UAA, UGA** - All encode STOP (as in stop translating) *Note: any question requiring translation on an exam in this class will be offered alongside a copy of the universal genetic code (previous slide). You do not need to memorize which codons code for start/stop or a given amino acid.* ## Reading frame - Each mRNA can have three different reading frames, only one is correct, and thus is decoded in the ribosome. - Each reading frame would: - Change the codons read by the ribosome - Change the polypeptide being made - The correct reading frame is dictated by the start codon. ## Reading Frame - 5' AUGUGGCGACGAUAGCGAUAGCGA 3' - **Reading Frame 1**: 5' AUG UGG CGA CGA UAG CGA UAG CGA 3' - **Reading Frame 2**: 5' A UGU GGC GAC GAU AGC GAU AGC GA 3' - **Reading Frame 3**: 5' AU GUG GCG ACG AUA GCG AUA GCG A3' ## Steps of Translation - Ribosomes attach to 5' end mRNA and move to the 3' end. Along the way, they read an mRNA sequences in codons (triplets), beginning with the first start codon encountered. - From the start codon onwards, each codon will recruit (I.e. bring) a specific tRNA molecule to the ribosome. The tRNA carries the encoded amino acid on its acceptor site – and in this way, a give codon always brings the “correct” amino acid to the ribosome (as specified by the mRNA sequence) - The amino acid is then detached from the tRNA and added (via peptide bonds) to the polypeptide undergoing translation. ## What does the ribosome look like? - Two subunits - Large subunit (50S) and the small subunit (30S) - The large subunit has three binding sites - Each site interacts with tRNA - P site (peptidyl) - A site (aminoacyl) - E site (exit) ## What does tRNA look like - Single stranded RNA that has a minimum of three stem loop structures (called arms) - One arm contains the anticodon - Important in matching the correct amino acid to the correct codon - The amino acid will be attached to the acceptor stem on the 3' end of tRNA ## How an anticodon "reads" mRNA - The anticodon is complementary (and antiparallel) to the codon on the mRNA. - The anticodon to the codon, thus bringing the correct amino acid to the ribosome. ## The wobble hypothesis explains why the genetic code is redundant: - The third base in an mRNA codon is called the wobble position. - The wobble pair hypothesis states that the 3rd (i.e. wobble) base can undergo non-Watson-Crick base pairing to a tRNA anticodon. - This means a single tRNA can pair with multiple codons. ## Translation occurs in three steps - **Initiation**: Ribosome assembles on the mRNA - **Elongation**: Ribosome creates the polypeptide chain - **Termination**: Ribosome disassociates from both the polypeptide and the mRNA ## Initiation of Translation ( prokaryotes) - Initially, the large (50S) and small (30S) subunits are disassociated (not together). - Proteins called initiation factors (IF) will help guide the assembly of the ribosome. - Initially, initiation factor 3 (IF-3) prevents the binding of the large and small subunits. - The small subunit will associate with the Shine Delgarno sequence (5’ UAAGGAGGU 3’). ## Initiation of Translation (prokaryotes) - Once the small subunit is bound to the Shine Delgarno sequence, additional initiation factors (IF -1 and IF-2) and a tRNA containing Met bind to small subunit - Note that IF-2 is bound to GTP which will acts a trigger for the system - tRNA will fit into the P site of the ribosome for the first (I.e. start) codon - Hydrolyzing GTP allows the large subunit to bind to the small subunit, IFs leave. - This completes ribosome assembly. ## Elongation in Prokaryotes - In addition to the ribosome, elongation also requires - tRNAs containing amino acids (i.e., "charged” tRNAs) - GTP - elongation factors (proteins, EFs) - an assembled ribosome complete with first amino acid (=Methionine) - During elongation, the polypeptide will be created and the ribosome reads the mRNA ## Major steps of elongation - **Step 1**: - A charged tRNA binds to EF-Tu and GTP. - This complex enters into the A (amino acyl) site. - The anticodon of the tRNA must match the codon of the mRNA - Once position correctly, GTP is hydrolyzed and EF-Tu + GDP is released. ## Major steps of elongation - **Step 2**: - A peptide bond will form between the amino acid on a tRNA's acceptor site in the P site and the amino acid in the A site. - When this occurs, the tRNA in the P site releases its amino acid. - This results in the growing polypeptide being attached to the tRNA in the A site. - Proteins are synthesized from 5' to 3' (or in protein talk N-terminus to C-terminus) ## Major steps of elongation - **Step 3**: - This step is called translocation (5' -> 3'). - Here, the ribosome will take a step forward on the mRNA to read another codon. - This process requires the binding of EF-G and the hydrolysis of GTP. - Once this translocation occurs, the tRNA that was in the P site moves to the E site (and leaves). - The tRNA that was in the A site, moves to the P site. - A new tRNA can now enter the A site. ## Order of movement in the ribosome - A site -> P site -> E site (except for the first tRNA, which only enters the P site, before ribosome is fully formed) ## Termination - Termination occurs when a stop codon is encountered. - Instead of a tRNA entering into the A site, a release factor (RF) enters - E. coli has three release factors (RF₁, RF₂ and RF₃). - When RF₁ or RF₂ enter the A site, the polypeptide is released from the tRNA in the P site. - Biding of RF₃-GTP (and subsequent hydrolysis of GTP) causes the ribosome to disassociate. ## Movie time http://vcell.ndsu.edu/animations/translation/movie-flash.htm