Protein Synthesis and Structure (L5 Slides F24) PDF

Protein Synthesis and Structure Learning Objectives: Understand the structure and diversity of amino acids and how they are assembled into a polypeptide chain Understand protein synthesis at the ribosome Understand the levels of protein structure...

Protein Synthesis and Structure Learning Objectives: Understand the structure and diversity of amino acids and how they are assembled into a polypeptide chain Understand protein synthesis at the ribosome Understand the levels of protein structure This animation shows the process of mRNA translation by the ribosome The “Central Dogma” of Molecular Biology nucleus DNA sequence mRNA sequence cytosol Protein sequence “compartmentalization” TODAY’S TOPICS: 1.Protein composition 2.Protein synthesis 3.Protein structure  Amino acids are the monomers of proteins at pH ~7 in cells, amino and carboxyl groups are charged Panel 2-6 Essential Cell Biology  20 different amino acids are found in proteins YDROPHOBIC (“water-fearing”) NONPOLAR SIDE CHAINS HYDROPHILIC (“water-loving”) NCHARGED POLAR SIDE CHAINS ACIDIC SIDE CHAINSBASIC SIDE CHAINS Panel 2-6 ECB6 (you don’t have to memorize individual AA for the ex mino acids are linked together by peptide bond (condensation reaction) Peptide Bond Panel 2-6 Essential Cell Biology protein is made of amino acids linked togethe into a polypeptide chain A protein (AA) sequence is always read from N- to C-terminus : Met-Asp-Leu-Tyr (in 3-letter code) or MDLY (in 1-letter code) TODAY’S TOPICS: 1.Protein composition 2.Protein synthesis 3.Protein structure The “Central Dogma” of Molecular Biology DNA sequence mRNA sequence cytosol Protein sequence  The nucleotide sequence of mRNA is translated into the amino acid sequence of a protein via the genetic code a set of 3 nucleotides defines a codon codoncodoncodoncodoncodoncodon Figure 7-27 Essential Cell Biology (don’t memorize the codons The genetic code contains codons for START and STOP START STOP Start codon is always There are three stop codons, whi AUG, are bound by proteins (not tRNA) and defines the reading called “release factors” and do n frame. code for any amino acids (AUG can also encode methionine within a protein) Figure 7-27 Essential Cell Biology In eukaryotic cells, translation begins at the first AUG and ends at the first “in-frame” stop codon Consider this messenger RNA (mRNA) Open Reading Frame (ORF) 5’ 3’ GAUCCACGACCAUGACUGACUCACUGACUUGGCCGUACGCAUCGAUGCGAUUGACCUGAGAAUGC MetThrAspSerLeuThrTrpProTyrAlaSerMetArgLeuAsn 5’ 3’ untranslated untranslated region region N-terminus C-terminus (3’UTR) (5’UTR) mRNA is translated in the 5’ to 3’ direction. Polypeptides are synthesized in the NH2- to -COOH direction NAs (‘transfer RNAs’) link codons and amino ac amino acid 3D structure of tRNA O Phe tRNA 5’ 3’ 3’-AAG-5’ Anticodon sequence 5’-UUC-3’ Sequence in mRNA mRNA is read in 5’ to 3’ direction for translation!  mRNA is decoded on ribosomes This process is known as ‘translation’ Peptidyl-Aminoacyl- Exit tRNA tRNA Catalyzes peptide bond formation (rRNA does this! Binds mRNA and matches tRNAs to mRNA codons complete ribosome: 4 rRNA molecules + ~82 proteins (MW = 4,200,000 Da) Figure 7-38 Essential Cell Biology Translation begins when the methionine- initiator tRNA binds to the start codon Met-initiator tRNA is a unique and is the only (Met-)tRNA that initiates translation. A complex of Met-initiator tRNA, translation initiation factors and small ribosomal subunit binds to the 5’ end marked by the 5’ cap of the mRNA. The complex scans the mRNA until it binds to the firs Translation begins when the methionine- initiator tRNA binds to the start codon The translation initiation factors dissociate to allow large ribosomal subunit to bind. The Met-initiator tRNA is in the P-side of the assemb ribosome (large + small subunit). Protein translation begins when the next charged tRNA binds to the second codon within the A- side of the ribosome. The large ribosomal subunit catalyzes the formation of first peptide bond. Protein translation is catalyzed by the ribosom Peptide bond formation translation rate: ~15 amino acids/sec (1 error every 1,000-10,000 codons) ation ends when Release Factor binds to stop Because no tRNA binds to a Stop Codon, the ribosome and translation stop. Stop Codons in the A-site are bound by proteins called Release Factors. Binding of Release Factors causes the ribosome add a water molecule to the peptide, which relea the peptide from the ribosome. The ribosome, mRNA, and release factor then dissociate.  Prokaryotic and Eukaryotic ribosomes are a bit different! Since protein synthesis is an essential cellular process, compounds that inhibit prokaryotic ribosomes and NOT eukaryotic ribosomes can be used to kill bacteria. Some antibiotics target prokaryotic ribosomes! Examples: Chloramphenicol Tetracycline Streptomycin Erythromycin Protein Folding  The amino acid sequence of a protein determines its 3D structure The “Anfinsen” Experiment Nobel prize 1972 Figure 4-7 Essential Cell Biology e nature of the amino acid side chains (residue determines protein folding YDROPHOBIC (“water-fearing”) NONPOLAR SIDE CHAINS HYDROPHILIC (“water-loving”) NCHARGED POLAR SIDE CHAINS ACIDIC SIDE CHAINSBASIC SIDE CHAINS Panel 2-6 ECB6 (you don’t have to memorize individual AA for the e Four types of noncovalent interactions help proteins to adopt their 3D structures (1) (2) (3) electrostatic “van der hydrogen interactions Waals” bonds interactions  (4) Hydrophobic interactions drive proteins to fold into compact conformations (newly synthesized protein) (protein has adopted its final 3D structure) Figure 4-5 Essential Cell Biology  (4) Hydrophobic interactions drive proteins to fold into compact conformations hydrophobic side chains hydrophilic side chains (CC BY-NC; Henry Jakubowski via LibreTexts) hat makes something hydrophilic or hydrophob hydrogen bonds Hydrophilic polar Hydrophobic nonpolar molecule molecule Panel 2-2 Essential Cell Biology  Hydrophobic interactions Panel 2-3 Essential Cell Biology e nature of the amino acid side chains (residue determines protein folding YDROPHOBIC (“water-fearing”) NONPOLAR SIDE CHAINS HYDROPHILIC (“water-loving”) NCHARGED POLAR SIDE CHAINS ACIDIC SIDE CHAINSBASIC SIDE CHAINS Panel 2-6 ECB6 (you don’t have to memorize individual AA for the e  (4) Hydrophobic interactions: drive proteins to fold into compact conformations A “folded” protein has a specific structure determined by its minimum energy state, (newly in which all protein) synthesized of 4 types of(protein interactions are optimized has adopted its final 3D structure) Figure 4-5 Essential Cell Biology  Folding of many proteins in cells is assisted by chaperone proteins Chaperone proteins often use ATP hydrolysis as an energy source to help fold other proteins. Can cause disease (Alzheimer’s, prion disease, and oth Fig. 4-8 Essential Cell Biology Protein Structure  Protein structure can be described in 4 levels of organization Primary Secondary Tertiary Quaternary structure amino structure a- structure 3D structure 3D acid sequence helices & b- structure of a structure of sheets polypeptide multiple amino acids chain polypeptide chains N- to C-terminus  Secondary Structure: the a-helix Backbone Detailed side view side view A right-handed helix completes a turn every 3.6 amino acids. A hydrogen bond is formed between every 4th top amino acid, linking the view C=O of one peptide bond to the N-H of another. Every backbone C=0 and N-H within the helix forms Side chains extend a hydrogen bond.  Secondary Structure: the b-sheet N C b-sheet C N (cartoon) N C b-sheet in more detail: Interactions are between adjacent strands carbon nitrogen The backbone C=0 oxygen R-group and N-H groups within hydroge the sheet form n hydrogen bonds (dashed lines). Side chains point alternately above and  b-sheets can be parallel or antiparallel antiparall el C N C N May contain two or more C N “strands” Strands can be parallel or parallel antiparallel to adjacent strand C C Strands may be far apart C in the primary sequence N N N Figure 4-17 ECB5 Tertiary structure of a protein Protein domain “A segment of a polypeptide chain that can fold independently into a compact, stable structure” roteins are composed of separate functional d gulatory domain (binds cAMP) Protein domain “A segment of a polypeptide chain that can fold independently into a compact, stable structure” N C Each domain generally has a specific function Functionally related domains often have very similar protein sequences. DNA Binding Genome sequences can help us domain identify functionally related domains in different proteins! atabolite Activator Protein (CAP) Figure 4-16 Essential Cell Biology  Quaternary Structure of Proteins: Proteins can consist of many individual polypeptide chains (“subunits”) Neuraminidase: Hemoglobin: Four identical polypeptide Two copies of a-globin and chains two copies of b-globin (The red is heme that can bind O2) Figure 4-19B, 20 Essential Cell Biology  The 3D structure of proteins is not static and can adopt different conformations ou will explore these concepts in your sections this week yoursel n degradation – Ubiquitin Proteasome System Substrate protein carrying a polyubiquitin chains proteolytic chamber regulatory particle proteasome teins are marked by chains of ubiquitin (“ubiquitination”) for degradati The Proteasome binds to ubiquitinated proteins actively unfolds bound proteins (uses energy of ATP) transfers the unfolded peptide chain into the proteolytic cham