EPOM 2024: ABCs of DNA and Gene Expression PDF

EPOM 2024: ABCs of DNA and Gene Expression; DNA Replication, DNA Damage and Repair, Transcription and Translation Nayef A. Mazloum [email protected] Office: C012 As faculty of Weill Cornell Medicine- Qatar we are committed to providi...

EPOM 2024: ABCs of DNA and Gene Expression; DNA Replication, DNA Damage and Repair, Transcription and Translation Nayef A. Mazloum [email protected] Office: C012 As faculty of Weill Cornell Medicine- Qatar we are committed to providing transparency for any and all external relationships prior to giving an academic presentation. I DO NOT have a financial interest in commercial products or services related to the subject of this lecture.  DNA Replication, DNA Damage and Repair Learning Objectives: Genome DNA structure DNA replication: – Mechanics – Molecular events and key players during DNA replication – End replication problem at the telomere – Regulation of DNA Replication within the Cell Cycle Sources and types of DNA damage DNA damage tolerance and DNA repair pathways Genetic consequences of mutation in repair genes Reading Assignments: Human Heredity Principles and Issues, Cummings. 9th edition, Chapter 8 pp. 176-192 ,pp. 198- 213 Molecular Biology of the Cell, Alberts, et al. 5th edition, pp 263-302 Lippincott Biochemistry 5th edition, p395-416  What is a Genome The sum of genetic components of an organism About 2% of the human genome encodes protein and gene related sequences – Exons (expressed or protein coding sequence) – Introns (intervening sequences) – Untranslated region (5’ and 3’ UTR) – Pseudogene The remaining 98% includes: – MicroRNA (MiR’s) – Long non-coding RNA (lncRNA) – Small nuclear RNA (snRNA) – Long or short interspersed repeat elements (LINE & SINE) – Retrotransposon Elements  DNA Carries the Genetic Information Classical work: Fredrick Griffith Avery and colleagues Hershey and Chase  Nucleic Acids Two types – DNA – RNA Composed of nucleotides Nucleotides are composed of – Pentose sugar (deoxyribose or ribose) – Phosphate group – Base (either a purine or pyrimidine)  DNA overview DNA deoxyribonucleic acid 4 bases Pyrimidine (C4N2H4) Purine (C5N4H4) A = Adenine T = Thymine C = Cytosine G = Guanine Nucleoside Nucleotide base + sugar (deoxyribose) base + sugar + phosphate O- O- PO -- OH P4 O 5’ CH2 O O 4’ 1’ H H H H sugar 3’ 2’ Numbering of carbons? OH H Base pairing 3’ 5’ A T 3’ Base pairing (Watson-Crick): 3’ C A/T (2 hydrogen bonds) G/C (3 hydrogen bonds) G 3’ Always pairing a purine and a pyrimidine yields a constant width 3’ A T 3’ DNA base composition: A + G = T + C (Chargaff’s rule) 3’ T A 3’ 3’ C G 5’ 3’  James Watson and Francis Crick-DNA Structure (1953) Watson and Crick developed the molecular model of DNA. Their model was based on: X-ray crystallography – gives information on physical structure Chemical information about nucleotide composition Important Properties of the Model Genetic information is stored in the sequence of bases in the DNA The model offers a molecular explanation for mutation Complementary strands of DNA can be used to explain how DNA copies itself  DNA structure DNA is in the form of an anti-parallel right-handed double helix Strands are held together by specific base pairing, i.e., A-T and G-C Figure 4-3 Molecular Biology of the Cell (© Garland Science 2008) Structure implies each strand serves as a template for duplicating the opposite strand Figure 1-3 Molecular Biology of the Cell, Fifth Edition (© Garland Science 2008) Parent DNA Second generation DNA First generation DNA Possible DNA duplication modes semi-conservative conservative dispersive  Initiation of DNA replication at origins In prokaryotes: a single replication origin (oriC): 245-bp DNA segment present at the start site for replication of chromosomal DNA. In eukaryotes: multiple origins not fully defined. Yeast: Autonomous replication sequence. In humans 100-1000 origins per chromosome Figure 5-25 (part 1 of 2) Molecular Biology of the Cell (© Garland Science 2008)  Two replication forks moving in opposite directions Figure 5-25 (part 2 of 2) Molecular Biology of the Cell (© Garland Science 2008) What are the implications of simultaneous bi- directional replication? 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ Two complementary strands have opposite chemical polarity Therefore, they must be synthesized in different ways.  Requirements for replicative DNA polymerases 5’ 3’ DNA polymerases are unidirectional (5’-3’) Require deoxynucleoside triphosphates precursors Require a primer for initiation Require single-stranded DNA as a template.  Properties of DNA polymerases impose restraints on the mode of replication Replication fork must be Local opening of the helix asymmetric How to open the helix? What creates the primer? Priming to start synthesis How to duplicate both strands in concert? Priming to start synthesis on opposite strand Helicases solve the problem of opening the duplex Helicases are machines fueled by ATP whose job is to unwind or melt the DNA duplex DnaB in prokaryotes and MCM in eukaryotes  Single-strand DNA binding protein -- RPA in eukaryotes-- Protect and stabilize single-stranded DNA Acts as a barrier and a signal to attract specific proteins  DNA synthesis is semi-discontinuous Priming problem solved by Primase, a specialized RNA polymerase. It initiates primer synthesis de novo laying down a track of RNA. Leading strand synthesis RNA tip Lagging strand synthesis Lagging strand synthesis proceeds by extension of the primer with DNA polymerase to form Okazaki fragments.  Priming DNA synthesis DnaG in prokaryotes and DNA polymerase alpha in eukaryotes Figure 5-11 Molecular Biology of the Cell (© Garland Science 2008)  The winding problem: ahead of the growing fork Helicase action creates a topological problem ahead of the replication fork…positive supercoils.  Topoisomerases act as swivels Topoisomerase with active site tyrosine One end of the duplex cannot rotate relative to the other Topoisomerase attaches covalently breaking the phosphodiester linkage The phosphodiester bond energy stored in the phosphotyrosine linkage making the reaction reversible The two DNA ends can rotate relative to each other The sliding clamp makes synthesis processive Beta clamp in prokaryotes or PCNA in eukaryote DNA polymerase (polymerase epsilon or delta in eukaryotes) and DNA polymerase III core in prokaryotes Processivity makes the polymerase fast -- 1000 nucleotides added per second!  The clamp loader opens the clamp Clamp loader: RFC (eukaryotes) or gamma complex (prokaryotes) ATP Clamp loader opens the ring ADP  Multiple cycles of clamp loading during lagging strand synthesis loader Polymerase RNA primer RNA primer Previous Okazaki fragment 5’ clamp Synthesis of new Okazaki fragment RNA primer Previous Okazaki fragment 5’ RNA primer Stalling of DNA polymerase triggers release from clamp 5’ 5’ New clamp assembled with recycled polymerase at next primer 5’  RNA primer is removed by a specialized nuclease In Prokaryotes DNA polymerase Fen1 I removes the RNA primer and Polymerase pauses fills the gap RNA primer Previous Okazaki fragment 5’ Fen1 Fen1 Fen1 A single phosphodiester linkage remains unsealed  DNA ligase seals the nick ATP Covalent AMP-intermediate formed with ligase PPi Covalent AMP-intermediate formed with 5’-P end of DNA Phosphodiester linkage sealed utilizing the high energy bond in the AMP-linkage  Telomere: The end-replication problem Chromosome end The final Okazaki fragment cannot be primed + Missing fragment Next generation Molecule has become shorter  Telomerase, a specialized reverse transcriptase, solves the end-replication problem Synthesizes DNA from an RNA template. Telomerase has an RNA oligonucleotide as an integral part of its structure. Adds repetitive TTAGGG units. The extended end serves as a template for priming lagging strand synthesis. TTAGGG 5’ aauccc TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG aauccc RNA priming, final Okazaki fragment synthesis TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG At the replication fork -- a dimeric polymerase DNA Replication and Cell Cycle DNA replication requires a complex interplay of DNA synthesizing factors coupled with a mechanism to harness these to the cell cycle. If replication is limited to once per cell cycle, how is this accomplished? How is accuracy conferred During DNA replication? Intrinsic accuracy of polymerase--10-5 Mutation rate -- 10-9  Accuracy by proofreading Proofreading--3’-5’ exonuclease associated with the polymerase P P E E  Accuracy by mismatch correction Old/new discriminator Me Mismatch recognition MutS New strand marked MutL Me exonuclease MutL MutS Me Exo Degradation past the mismatch Me Me Fill-in synthesis, new strand marked DNA needs continual repair In a typical cycling cell… 20000 single-strand breaks 10000 depurinations 5000 alkylations 2000 oxidations 600 deaminations 20 double-strand breaks  Sources of DNA Damage 1) Spontaneous (endogenous) lesions: 1) Hydrolytic depurination of DNA and deamination of cytosines 2) Base damage from hydroxyl free radicals 3) Insertion of incorrect nucleotides during DNA synthesis 4) Replication fork collapse to generate double-strand breaks 2) Induced (exogenous) lesions: 1) Ultraviolet (UV 200-300nm) radiation from the sun 2) Base damage caused by exposure to alkylating or oxidizing agents 3) Strand breaks caused by ionizing radiation  Spontaneous depurination and deamination: (endogenous) Figure 5-45 Molecular Biology of the Cell (© Garland Science 2008)  Deamination of A, G, and C: Figure 5-50a Molecular Biology of the Cell (© Garland Science 2008)  Thymine dimers (UV): (exogenous) Cyclobutane pyrimidine dimer or 4-6 pyrimidine photoproduct Figure 5-46 Molecular Biology of the Cell (© Garland Science 2008)  Chemical modification of nucleotides introduces mutation if not repaired: Figure 5-47 Molecular Biology of the Cell (© Garland Science 2008)  Damage recognition and repair pathways Damage recognition Tolerance Signal to cell cycle machinery Direct reversal Excision repair Recombination  Direct reversal repair Photolyase system (present only in bacteria) to repair thymidine dimers by using energy from light for electron transport. The methylation of guanine bases, is directly reversed by the enzyme methyl guanine methyl transferase (MGMT), the bacterial equivalent of which is called ogt  Excision repair (Base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR)) Basic scheme: Damage recognition Incision and removal of damage-containing strand Gap filling by polymerase and ligase  Function of BER Removes damage caused by endogenous events Oxidative damage Spontaneous deaminations Spontaneous depurination Why BER? Important to cleanse DNA of any damage Mutation induction Interference with transcription Base-pairs with A 8-oxoguanine (Hoogsteen base pair)  BER: Figure 5-48a Molecular Biology of the Cell (© Garland Science 2008)  Base excision repair Glycosidic bond broken Abasic site removed Small gap filled in Advantages Disadvantage Simple removal of damaged base Elaborate specificity mechanism Energetically inexpensive Specificity provided by base-specific DNA glycosylases Base flipping mechanism Aberrant bases recognized 8-oxoguanine uracil hydroxymethyl uracil 5-methyl cytosine hypoxanthine 3-methyl adenine 7-methyl adenine 5, 6 dihydroxy thymine formamidopyrimidines  BER Base specific glycosylase Abasic endonuclease Polish the end-removal of deoxyribose phosphate PolX family polymerase DNA ligase III Short patch repair  Nucleotide excision repair (NER) When more versatility is required Geared to repair damage from environmental causes Extremely flexible Keys on damage that distorts the DNA helix (bulky adducts) GGR (global genome repair) TCR (transcription coupled repair)  NER: Uvr excinuclease system in prokaryotes (UvrA, B, C, D). In eukaryotes NER is more complex and requires the concerted action of over 30 proteins to complete the repair Figure 5-48b Molecular Biology of the Cell (© Garland Science 2008) DNA reactive compounds processed by NER Psoralen: photosensitizing furanocoumarins  NER Distortion recognition Incisions Tract removed Pol delta, PCNA, RPA, ligase I fill in and seal the gap  NER deficiency XP--Xeroderma pigmentosum--extreme sensitivity to sunlight, skin cancer CS--Cockayne’s syndrome-mental, physical retardation, premature aging  Mismatch Repair is carried out by the Mut-HLS system in E. coli The Mut-HLS system recognizes single mismatched base pairs. In the Mut-HLS system, methylation is the signal that distinguish between the correct strand and the strand with the error.  MMR: post replication repair Old/new discriminator Me Mismatch recognition MutS New strand marked MutL Me exonuclease MutL MutS Me Exo Degradation past the mismatch Me Me Fill-in synthesis, new strand marked MMR in eukaryotes is also conserved and mutations in these genes predispose to colorectal cancer Damage tolerance--translesion polymerases Replicating DNA polymerase stalls at lesion PCNA modified by Rad6-Rad18 Polymerase switch Translesion polymerases Inserters (e.g., Pol eta) Extenders (e.g., zeta) Lesion bypass Error free or error prone Polymerase switch  Lesion bypass by fork regression Leading strand block “Chicken foot” Fork regression Synthesis uncoupled Fork reversal Template switch  DSBR Pathways Resection of 5’ Synapsis of ends ends Homologous pairing Ligation Homologous recombination Non-homologous end joining (HR) (NHEJ)  DSB pathway choice governed by cell cycle G1 G2 Sister chromatids can Distal fragment of chromosome template HR repair disconnected from centromere HR predominant after DNA NHEJ predominant in G1 replication  The DNA damage response Phosphorylation signaling cascade Stops cells from cycling, activates numerous downstream effectors for repair Chk2 (Mre11, Rad50, Nbs1) ATM MRN complex--sensor Transducer Primary responder Chk2 ATM P P Cohesins, p53 Cell cycle Many downstream H2AX components targets  Non-homologous end joining (NHEJ) Advantages Disadvantages Energy efficient Efficient in joining any ends Efficient in joining ends Error prone DSB pathway choice Artemis Polishing the ends Pol  Ku MRN complex XLF Synapsis of ends DNA-PKcs XRCC4 Ligation DNA ligase IV  NHEJ mutants immunodeficiency, cancers SKY (spectral) karyotype Normal human female Mouse cancer, showing translocations  Double-strand-break repair by homologous recombination Advantages Disadvantages Very precise LOH Genetic diversity End processing + Homologous pairing and strand invasion Holliday junctions formed D-loop dissociates  Genetic consequences of mutation in repair genes Table 5-2 Molecular Biology of the Cell (© Garland Science 2008)  EPOM 2023: Gene Expression Transcription Nayef A. Mazloum [email protected] Office: C012  Learning Objectives: Transcription: Central dogma RNA structure RNA polymerases RNA types Molecular events of transcription RNA processing RNA splicing Ribosomal RNA structure and biogenesis Reading Assignments: - Human Heredity Principles and Issues, Cummings. 9th edition, Chapter 8 pp. 176-192 ,pp. 198- 213 - Molecular Biology of the Cell, Alberts, et al. 5th edition, Chapter 5 pp. 263-294, Chapter 6 pp. 329- 349 and pp. 366-388  Central Dogma RNA: The Link between DNA and Protein  From DNA to RNA Gene A is transcribed more efficiently than B From RNA to Protein Co-transcriptional translation  TRANSCRIPTION and TRANSLATION Transcription: Process whereby RNA is synthesized from the DNA template in the nucleus. –Messenger RNA (mRNA), carries the coded information and is transported to the cytoplasm to be decoded, or translated to peptide. Translation: Process of protein synthesis whereby mRNA is decoded into polypeptide in the cytoplasm. –Involves mRNA, tRNA and ribosomes.  RNA vs. DNA The chemical structure of RNA is similar to that of DNA, except: Nucleotide in RNA has a ribose sugar component instead of a deoxyribose. Uracil (U) replaces thymine as one of the pyrimidines of RNA. RNA in most organisms exists as a singe-stranded molecule, whereas DNA exists as a double helix.  RNA structure RNA can fold into secondary and tertiary structures by conventional base pairing or nonconventional interactions Figure 6-6 Molecular Biology of the Cell (© Garland Science 2008)  Requirements for RNA Synthesis DNA template NTPs, UTP instead of TTP DNA dependent RNA polymerase: In prokaryotes: only one RNA polymerase In eukaryotes: Three RNA polymerases Proceeds 5’-3’ No primer is needed Linked by phosphodiester bond Eukaryotic RNA Polymerases Molecular events of RNA Synthesis Three Stages: Initiation: loading of the polymerase at the promoter aided by transcription factors and other factors; involves template recognition, unwinding of DNA at the promoter, short RNA synthesis (might be aborted). Elongation: Processive RNA synthesis and chain elongation. Termination: RNA transcript and polymerase are released.  Initiation of Transcription of a Eukaryotic Gene by RNA Polymerase II General transcription factors are required and sequentially added at the promoter TBP-TFIID binds TATA box at the promoter and recruit TFIIB TFIID binding distorts DNA and acts as signal for recruitment of the general transcription factors and the polymerase. TFIIH pries open the DNA at the start site by using ATP C-terminal domain phosphorylation leads to conformational change releasing the transcription factor and starting the elongation phase. Figure 6-16 Molecular Biology of the Cell (© Garland Science 2008) Consensus sequences Table 6-3 Molecular Biology of the Cell (© Garland Science 2008)  TRANSCRIPTION (2) The primary RNA transcript is processed by addition of a chemical "cap" structure to the 5' end of the RNA and cleavage of the 3' end at a specific point downstream from the end of the coding information. This cleavage is followed by addition of a polyA tail to the 3' end of the RNA; the polyA tail appears to increase the stability of the resulting polyadenylated RNA. The fully processed RNA called mRNA is transported to the cytoplasm, where translation takes place.  Eukaryotic vs. Prokaryotic mRNA Eukaryotic mRNA: Monocistronic, capped and poly-adenylated 3’ 5’ eIF4E Poly A UTR AUG UGA UTR Open reading frame Methylation and capping of the 5’ UTR Start Stop Prokaryotic mRNA: polycistronic and contains Shine Delgarno sequences (ribosome-binding sites)  Eukaryotic mRNA: Cap and tail interaction Cap and tail interactions are needed for ribosomal recognition at the initiation of translation.  TRANSLATION Translation occurs on ribosomes. Ribosomes are themselves made up of many different structural proteins in association with a specialized type of RNA known as ribosomal RNA (rRNA). Translation involves yet a third type of RNA, transfer RNA (tRNA), which provides the molecular link between the coded base sequence of the mRNA and the amino acid sequence of the protein.  GENE (1) A gene can is a segment of a DNA molecule containing the code for the amino acid sequence of a polypeptide chain and the regulatory sequences necessary for expression. the majority of genes are interrupted by one or more noncoding regions-introns; which are initially transcribed into RNA in the nucleus but are not present in the mature mRNA in the cytoplasm. Introns alternate with coding sequences, or exons, that ultimately encode the amino acid sequence of the protein. Gene Structure in Eukaryotes “Upstream” “Downstream” Gene for Dystrophin is the Largest in the Human Genome  GENE (2) At the 5' end of the gene lies a promoter region, which includes sequences responsible for the proper initiation of transcription. At the 3' end of the gene lies an untranslated region of importance that contains a signal for addition of a sequence of adenosine residues (the so-called polyA tail) to the end of the mature mRNA.  RNA Polymerase II Requires Activators, Mediators and Chromatin Modifying Proteins Figure 6-19 Molecular Biology of the Cell (© Garland Science 2008)  RNA Processing 5’ CAP -7 methylguanosine polyA tail - run of adenosine residues at 3’end of transcript Splicing- Removal of sequences from internal portions of RNA. Eukaryotic mRNAs have a special Cap structure at their 5’-ends Backwards G is not transcribed from DNA!  Eukaryotic mRNAs Have a Poly-A Tail at their 3’-ends Poly-A tail is not transcribed from DNA! Splicing Eukaryotic RNA processing: nucleus How Does Splicing Works? How Does Splicing Work?  RNA Polymerase II-RNA factory Figure 6-23 Molecular Biology of the Cell (© Garland Science 2008)  Consensus nucleotide for Intron splicing Figure 6-28 Molecular Biology of the Cell (© Garland Science 2008) Pre-mRNA Splicing Mechanism  Exon Definition Hypothesis Figure 6-33 Molecular Biology of the Cell (© Garland Science 2008)  Mechanism of RNA Splicing Figure 6-34a Molecular Biology of the Cell (© Garland Science 2008)  Steps in Generating 3’ End of mRNA Figure 6-38 Molecular Biology of the Cell (© Garland Science 2008)  rRNA Both the synthesis and processing of pre-rRNA occurs in the nucleolus. Transcription by RNA polymerase I yields a 45S primary transcript (pre-rRNA), which is processed into the mature 28S, 18S, and 5.8S rRNAs. Unlike pre-rRNA genes, 5S-rRNA genes are transcribed by RNA pol III in the nucleoplasm outside of the nucleolus. Without further processing, 5S RNA diffuses to the nucleolus, where it assembles with the 28S and 5.8S rRNAs and proteins into large ribosomal subunits When assembly of ribosomal subunits in the nucleolus is complete, they are transported through nuclear pores complexes to the cytoplasm.  Ribosome biosynthesis in eukaryotes Ribosome biogenesis takes place in the nucleolus. Assembled from mostly rRNA and proteins. Precursor RNA is transcribed by RNA polymerase I and is processed into mature rRNA. Packaging of rRNA along with ribosomal proteins to the subunit. Transferred to the cytoplasm the site of protein synthesis.  EPOM 2023: Translation Nayef A. Mazloum [email protected] Office: C012  Learning Objectives: Structure and function of Key translation players Ribosome (biosynthesis, structure and function) tRNA (synthesis, structure and function) Codon-anticodon interaction Molecular events of protein synthesis Protein synthesis inhibitors and antibiotics Post-translational modification Molecular Biology of the Cell, Alberts, et al. 5th edition, Chapter 6 pp. 366-388 Lippincott Biochemistry 6th edition, Chapter 32 p447-64  TRANSLATION Translation: Process of protein synthesis whereby mRNA is decoded into polypeptide in the cytoplasm. –Involves mRNA, tRNA and ribosomes.  Translation: Key elements EF-Tu in prokaryote (the eukaryotic homolog is eEF1A) Ribosome mRNA tRNA Growing polypeptide chain Translation factors Figure 6-67 (part 1 of 7) Molecular Biology of the Cell (© Garland Science 2008)  Ribosome and RNA message decoding Protein synthesis is carried out in the ribosome, a complex machine of more than 50 protein and several rRNA molecules. A typical eukaryotic cell has millions of ribosome.  Prokaryotic vs. Eukaryotic Ribosome Made up of protein and ribosomal RNA (rRNA) Two subunits (large and small) S (Svedberg unit) refers to sedimentation velocity Figure 6-63 Molecular Biology of the Cell (© Garland Science 2008)  Ribosome structure and function Two subunits are assembled on mRNA when translation is initiated. Sites for tRNA and mRNA binding. Important role in maintaining the reading frame during protein synthesis Peptidyl transferase Peptidyl transferase resides on large subunit (RNA catalyzing enzyme-a ribozyme). The small subunit provides the framework for codon-anticodon matching. Figure 6-67 Molecular Biology of the Cell (© Garland Science 2008)  tRNA Adaptor molecules that match each a.a to its respective codon. Transcribed by RNA polymerase III as a linear Primary structure precursor tRNA, which is matured by protein factors. Folded into a clover leaf like secondary structure (base pairing and base stacking) Solvent exposed anticodon (3 codon-complementary nucleotides). Covalently attached a.a at the 3’-CCA (over 40 a.a- tRNA). Secondary structure Compact L shape tertiary structure Figure 6-52 Molecular Biology of the Cell (© Garland Science 2008)  tRNA bases are chemically modified Almost 1 in 10 bases in tRNA is chemically modified. Inosine at the third position with the anticodon allows degenerate base pairing (Wobble). Figure 6-55 Molecular Biology of the Cell (© Garland Science 2008)  Amino acyl-tRNA Synthetases Enzymes that catalyze the coupling of a.a to its cognate tRNA(s). 20 different tRNA synthetases (one for each a.a) ATP dependent reaction producing high energy ester bond. Figure 6-55 and 6-58 Molecular Biology of the Cell (© Garland Science 2008) aa-Incorporation into a Protein  Codon-anticodon Interactions Watson Crick base pairing for the first two bases. Wobble base pairing for the third base. Modified bases (inosine) within the anticodon affect codon-anticodon pairing and fidelity. Thermodynamic stability alone of correct base- pairing is not enough to account for observed fidelity of translation Figure 6-53 Molecular Biology of the Cell (© Garland Science 2008)  Genetic code The genetic code is deciphered 3 bases at a time from the mRNA (codons). 4x4x4=64 possible codons. 61 coding codons and 3 stop codons. 20 a.a are possible; redundant code. 40 types of aa-tRNA for 20 a.a Fidelity of translations depends on codon-anticodon pairing and through a kinetic induced fit mechanism within the ribosome aided by GTPases. Figure 6-50 Molecular Biology of the Cell (© Garland Science 2008) Molecular events of Protein Synthesis Four Stages: Initiation Elongation Termination Recycling  Initiation of Protein Synthesis Rate limiting step and requires involvement of factors: Small ribosome subunit-initiator tRNA (met- tRNAi)-eIF2 ternary complex binds mRNA at the 5’ end and scan the mRNA until AUG start codon. Recognizes capped and tail interaction brought about by eIF4E and eIF4G. Met-tRNAi commits to the P site. Large subunit is recruited (assisted by GTP hydrolysis and eIF2). In eukaryotes; about 30 initiation factors are required.  Elongation of Protein Synthesis tRNA selection and peptide bond formation: eEF1A-GTP-aatRNA (ternary complex) is recruited to the A site. GTP hydrolysis by eIF1A after codon matches cognate anticodon. peptide bond formation by the peptidyl transferase. tRNA at A and P site are held closely and tightly at the respective codons by the ribosome to ensure the reading frame is maintained.  Elongation of Protein Synthesis Large subunit and small subunit translocation: After peptide bond is formed the peptide chain is on the A site. Movement of large and then small subunit with respect to the mRNA to vacate the A site. Another aa-tRNA is selected to the A site and the deacylated tRNA is Ejected from the E site. Figure 6-66 Molecular Biology of the Cell (© Garland Science 2008)  Termination and Recycling of Protein Synthesis When a stop codon is reached at the A site, release factors (eRF 1 and 2) bind instead of tRNA (molecular mimicry). Hydrolysis of the polypeptide-tRNA bond chain by water and release of the newly synthesized peptide. The terminated complex is resolved by recycling factors actively-thought it is poorly understood-needed to prevent initiation on downstream start codons. Figure 6-74 Molecular Biology of the Cell (© Garland Science 2008)  Translation variation in some viruses Leaky scanning: Use of different start codons to generate multiple HIV and codon frameshifting peptides from the same mRNA. tRNA slippage and frameshifting: tRNA slips on the ribosome leading to a frameshif (HIV). Suppression of termination: read through stop coding to yield C- terminally extended product. Re-initiation of translation: translation of an upstream open reading frame reveals another down stream start codon resulting in the translation of a second open reading frame  proofreading at the level of ribosome-GTPase Elongation factors drive translation forward and improve the accuracy of this process: (EF-Tu and EF-G in prokaryotes; eEF1 and eEF2 in prokaryotes). Coupling GTP hydrolysis to transitions in the different ribosome states allows for fast protein synthesis. The rRNA fold around the codon- anticodon interaction site is influenced by correct base pairing which triggers GTP hydrolysis by the GTPase (induced fit mechanism).  polyribosome: for efficient protein synthesis Several ribosomes can bind to a single mRNA producing several copies of peptide chain 2-6 aa incorporation per second per ribosome in eukaryotes and 20 aa incorporation per second in prokaryotes. Figure 6-76 Molecular Biology of the Cell (© Garland Science 2008)  Prokaryotic ribosomes: druggable target Figure 6-79 Molecular Biology of the Cell (© Garland Science 2008) Table 6-4 Molecular Biology of the Cell (© Garland Science 2008)  Translation inhibitors as antibiotics Chloramphenicol Aminoglycosides: (streptomycin, gentamycin, neomycin, kanamycin etc.) inhibit prokaryotic translation bind the small ribosomal subunit and interferes in tRNA ribosomal selection Aminoglycosides Chloramphenicol: binds at the peptidyl transferase center within the large subunit and inhibits peptide bond formation (bacteriostatic) Figure 6-64 Molecular Biology of the Cell (© Garland Science 2008)  Translation inhibitors as antibiotics Macrolide Tetracycline: binds to the small subunit and blocks tRNA-mRNA interaction-bacteriostatic Macrolides: (erythromycin, azithromycin, clarithromycin) bind the large subunit at the peptidyl transferase center and Tetracycline blocks peptide bond formation Figure 6-64 Molecular Biology of the Cell (© Garland Science 2008)  Translation inhibitors as toxins Ribosome inactivating proteins (RIP) Shigella toxin, ricin (castor oil extract) blocks rRNA GTPase factor interaction.