Real-Time PCR Lecture Notes PDF

Real-Time PCR Quantitative PCR qPCR  Real time PCR versus conventional PCR End-Point conventional PCR: Low sensitivity Short dynamic range < 2 logs Non - Automated Size-based discrimination only Results are not expressed as numbers (not Quantitative) Ethidium bromi...

Real-Time PCR Quantitative PCR qPCR  Real time PCR versus conventional PCR End-Point conventional PCR: Low sensitivity Short dynamic range < 2 logs Non - Automated Size-based discrimination only Results are not expressed as numbers (not Quantitative) Ethidium bromide for staining is not very quantitative Low resolution, poor Precision Post PCR processing  RT-PCR versus serology test SARS-CoV-2 CMV Brucella Leishmania, Toxoplasma https://www.thermofisher.com/il/en/home/life-science/pcr/reverse-transcription/superscript-iv-vilo-master-mix.html Real time PCR DNA or cDNA RNA convert to cDNA  Reverse Transcriptase PCR (RT-PCR)-cDNA Synthesis It is a variation of the polymerase chain reaction that amplifies target RNA. Addition of reverse transcriptase (RT) enzyme prior to PCR makes it possible to amplify and detect RNA targets. WHY mRNA? cDNA synthesis  RT-qPCR The real-time reverse transcription polymerase chain reaction (RT-qPCR) addresses the evident requirement for quantitative data analysis: 1. In molecular medicine, biotechnology, microbiology and diagnostics. 2. The method of choice for the quantification of mRNA as Transcriptional Biomarkers in molecular diagnostics, normal biological processes, pathogenic processes or pharmacological reaction to a therapeutic intervention. RT-PCR will remain the gold standard for all viral infections The concept of RT-PCR Endpoint see on gel Fluorescence reporters 1 40  qPCR Assays PicoGreen (PG) SYBR Safe SYBR Gold Thiazole orange (TO) Oxazole yellow (YO) Safe-Green Chai Green  qPCR Assays-SYBR Green Ready mixes contains the SYBR Green dye Primers (forward and reverse) Real time PCR machine Why the fluorescent dye does not accumulate between RT-PCR cycles?  qPCR Assays-TaqMan assay Ready mixes contains Primers (forward and reverse) Fluorescence probe (DNA sequences specific) Real time PCR machine 5′ to 3′ exonuclease activity of Taq  The TaqMan® Probe The TaqMan® Probe is designed with a high-energy dye termed a Reporter at the 5’ end, and a low-energy molecule termed a Quencher at the 3’ end. When this probe is intact and excited by a light source, the Reporter dye’s emission is suppressed by the Quencher dye as a result of the close proximity of the dyes. When the probe is cleaved by the 5’ nuclease activity of the enzyme, the distance between the Reporter and the Quencher increases causing the transfer of energy to stop. The fluorescent emissions of the reporter increase and the quencher decrease. Dyes used for fluorogenic probes in real-time PCR  Palestinian Ministry of Health using qPCR in molecular diagnostic assay Supplier: Influenza B InfB-F AAATACGGTGGATTAAATAAAAGCAA Set1 InfB-R CCAGCAATAGCTCCGAAGAAA InfB-P HEX/CACCCATATTGGGCAATTTCCTATGGC/IABkFQ SARS-CoV-2 SC2-F ACAGGTACGTTAATAGTTAATAGCGT Set2 SC2-R ATATTGCAGCAGTACGCACACA SC2-P Cy5/ACACTAGCCATCCTTACTGCGCTTCG/IAbRQSp Cholera Set3 v. chol-O139-F1 AGAAGCCAGTCGCAGTAAAG v. chol-O139-R1 TCGCCATCTTCCAGCATAAA chol-O139-P FAM – 5'-TGGTGGTACAGCTTAGCCGCATTA - BHQ2 Palestinian Ministry of Health using qPCR in molecular diagnostic assay Herpes simplex 1/2 HSV-F:CGCATCAAGACCACCTCCTC HSV-R:GCTCGCACCACGCGA HSV-1-P:FAM-TGGCAACGCGGCCCAAC-BHQ-1 HSV-2-P:VIC-CGGCGATGCGCCCCAG-BHQ-2 What are the pros and cons of dye-based qPCR? Here are many reasons why dye-based qPCR is so popular among scientists: 1. Cost (just 2 primers) - a more budget-friendly option than probe-based qPCR. 2. Easier to design than probe-based qPCR. Again, you only need 2 primers for the former. The latter requires 2 primers and a very specifically placed probe. 3.Possible to detect mistakes in addition to the gene of interest, unlike with probe-based qPCR. So, it is possible to optimise the experiment and have better results next time. Unfortunately, like with every method, dye-based qPCR is not ideal for every experimental design. Here are some cons: 1.It’s not possible to do multiplexing. 2.It has low specificity. Real time PCR Applications  Absolute vs. Relative Quantification for qPCR Absolute Quantification for qPCR: Need serial standard concentrations of control DNA/plasmid/RNA Relative Quantification use reference gene (housekeeping genes) ΔCT (sample/treated) = CT target gene – CT reference gene ΔCT (calibrator/untreated) = CT target gene – CT reference gene Next, the ΔΔCT: ΔΔCT = ΔCT (sample) – ΔCT (calibrator) Normalized target gene expression level in sample = 2–ΔΔCT  Tomato plant genes affected by CMZ drugs : Carbamazepine.‫ مثل القلق واأللم العصبي‬،‫ضا‬ ً ‫ كما يمكنها عالج حاالت أخرى أي‬. ‫تساعد األدوية في عالج الصرع وأسباب عصبيه أخرى للنوبات‬ Why to study these drugs? No. Name Ct No. Name Ct No. Name Ct 1 wc3 actin 12.94 13 wc3 gr 20.58 41 wc3 gst 17.66 2 wc3 actin 12.8 14 wc3 gr 20.75 42 wc3 gst 17.69 3 wc3 actin 12.8 15 wc3 gr 20.77 43 wc3 gst 17.79 4 carb2-3actin 13.47 16 carb2-3 gr 20.81 44 carb2-3 gst 17.18 5 carb2-3actin 13.64 17 carb2-3 gr 20.98 45 carb2-3 gst 17.11 6 carb2-3actin 13.44 18 carb2-3 gr 21.39 46 carb2-3 gst 17.29 7 lam1-1 actin 12.85 19 lam1-1 gr 20.01 47 lam1-1 gst 16.33 The first-line antiepileptic drug and 8 lam1-1 actin 13.15 20 lam1-1 gr 20.15 48 lam1-1 gst 16.38 ANTICONVULSANT AGENTS: 9 lam1-1 actin 13.05 37 lam1-1 gr 20.35 49 lam1-1 gst 16.35 10 carb+lam3 actin 15.36 38 carb+lam3 gr 22.62 50 carb+lam3 gst 20.68 Carbamazepine (CMZ) , Lamotrigine 11 carb+lam3 actin 15.35 39 carb+lam3 gr 22.37 51 carb+lam3 gst 20.81 12 carb+lam3 actin 15.49 40 carb+lam3 gr 22.72 52 carb+lam3 gst 20.98 Glutathion-S-transferase (GST), Glutathione reductase (GR)  Absolute vs. Relative Quantification for qPCR Basis of differentiation Absolute Quantification Relative Quantification What it determines Expression levels in absolute numbers of copies Fold changes in expression between two samples The precise amount of the message or template used Although the template is known to contain the Known/Unknown for the curve is known. The absolute quantification message of interest in high abundance, its absolute template amounts standard curve provides the final answer. amount may or may not be known. Unknowns are quantified based on a known quantity. A Changes in gene expression in a given sample are What the process standard curve is first created. Then the unknowns are analyzed relative to another reference sample such involves compared to the standard curve and a value is as an untreated control sample. extrapolated. (Slope Equation) (Housekeeping gene) The calibration curve result for the target gene is How the answer is normalized to that of a housekeeping gene in the The standard curve provides the final answer. determined same sample. The normalized numbers are then compared between samples to obtain a fold change.  RT-PCR used to predict the virologic response of IFN therapy Reactivation of hepatitis B: >2,000 IU/mL. Persons at the highest risk between 1,000 and 2,000 IU/mL. Real time PCR on DNA HBV DNA levels as a marker of risk for clinical outcomes  Thyroid cancer and real time PCR miRNA Thyroid cancer: Thyroid cancer (TC) Multinodular goiter (MNG) Tox vs Non Tox RT-qPCR PCR-MIX cDNA MIX Two Steps RT-PCR cDNA-PCR-MIX One Step RT-PCR  High Resolution melt (HRM)-qPCR Determination of melting temperature for DNA (PCR product)-50%PCR product desaturate Quantitative Analysis of Copy Number Variants Based on RT-PCR This method has been used in the determination: 1. SMN1 and SMN2 copy number for spinal muscular atrophy (SMA) (Anhuf et al., 2003; Feldkötter et al., 2002), 2. The cystic fibrosis transmembrane conductance regulator (CFTR) transcripts in cystic fibrosis (CF) (Ramalho et al., 2011) 3. The determination of HER-2/neu ( Human Epidermal Growth Factor Receptor 2 ) amplification in human breast carcinoma (Kulka et al., 2006),  https://www.youtube.com/watch?v=Qqdmw3wvMFo Gene Copy Number Variation (CNV)- Droplet Digital –qPCR (DD-PCR) Turner syndrome Monosomy 1p36 trisomy 21 or Down syndrome High copies of ERBB2 is associated with aggressive forms of breast cancer and is a major target of treatment DiGeorge syndrome is 22q11. 2 deletion syndrome DD_PCR PCR ADVANTAGES: No Need For Std Curves/reference samples Accuracy and sensitivity (rare mutations) Inhibitors tolerance DIADVANTAGES: High costs How To Create Real-Time PCR Primers Using Primer-BLAST? https://www.youtube.com/watch?v=XHdRW9xxgO4