Genetics I DNA 2024 (PDF)

 WELCOME TO GENETICS IT’S PROBABLY GOT SOMETHING TO DO WITH GENETICS IF YOU LOOK FOR IT…GENETICS IS EVERYWHERE Transgenic Designer babies End of life Healing disease Biodiversity organisms Superbugs and Vac...

 WELCOME TO GENETICS IT’S PROBABLY GOT SOMETHING TO DO WITH GENETICS IF YOU LOOK FOR IT…GENETICS IS EVERYWHERE Transgenic Designer babies End of life Healing disease Biodiversity organisms Superbugs and Vaccines – Cloning Jurassic Park Origins of Life antibiotics nanoparticles humans/animals Economic Cyber-organisms PETA – animals as consequences – who bio-factories owns the rights to the human genome? GENETICS: TOPICS COVERED END Inheritance Cell Division Protein Synthesis DNA START GENETICS: ASSESSMENT OVERVIEW ❑MINIQUIZ x 3 (2% each) 1. DNA STRUCTURE 2. TRANSCRIPTION + TRANSLATION 3. CELL DIVISION + INHERITANCE ❑GENETICS TOPIC TEST (20%) ❑End of Semester Exam (30%)  WHAT IS DNA? ▪DNA is short for deoxyribonucleic acid ▪It is a set of coded instructions that produce all our proteins – this in turn determines our physical characteristics ▪Its double-helix structure was first described by James Watson and Francis Crick in 1953 https://www.youtube.com/watch?v=V6bKn34nSbk  STRUCTURE OF DNA ▪The Watson-Crick model describes how DNA is the same overall structure for all organisms. ▪It is made up of smaller molecules called NUCLEOTIDES ▪Each nucleotide consists of: ❖A phosphate group ❖A deoxyribose sugar ❖One of 4 nitrogenous bases Source: https://ib.bioninja.c om.au/standard- level/topic-2- molecular- biology/26- structure-of-dna- and- rna/nucleotides.ht ml THE 4 BASES One of these 4 bases A T G C These are the names of the 4 bases We shorten them to the symbols A, T, G and C STRUCTURE OF DNA ▪A nucleotide is connected to other nucleotides to form a strand → the phosphate & sugar group are always alternating → the base is always attached to the sugar Source: https://www2.le.ac.uk/projects/vgec/highereducation/topics/dna-genes-chromosomes DNA IS A DOUBLE-HELIX ▪DNA is composed of two strands of nucleotides linked together in a ladder 1. The backbone is made of alternating deoxyribose sugar and phosphate groups 2. The steps are the nitrogenous bases 3. The bases are joined by hydrogen bonds Source: https://www2.le.ac.uk/projects/vgec/highereducation/topics/dna-genes-chromosomes  COMPLEMENTARY BASE PAIRING The “A" of one strand can only pair with a “T" on the other. (A=T) 2 hydrogen bonds between A and T The “C’’ of one strand can only pair with a “G" on the other. (C=G) 3 hydrogen bonds between C and G COMPLEMENTARY BASE PAIRING For example: If a strand of DNA has the following sequence, what is the sequence for the complementary strand? A T T C A G G T C C A C T A AG T C C A G G T G DO NOW: BOOKLET PAGE 4-5 DNA MODELLING Take out the kits!!! WATSON AND CRICK https://www.youtube.com/watch?v=V6bKn34nSbk RECAP STRUCTURE OF DNA HOW CAN FOUR BASES (A T G C) CODE FOR EVERYTHING? Just like Morse Code, it is the unique sequence of bases + the number of bases that allow DNA to contain the complex and detailed instructions for life.  GENES Genes are segments of DNA that code for a particular protein, that is responsible for a particular physical trait Genes are unique in two ways: The sequence of the bases (the unique code) The number of bases (length of the sequence) GENES For example, The gene that codes for EYE COLOUR would be ATGGCGTAA While the gene that codes for HAIR COLOUR might be GGCCTAAAGCTAATCGATCG WE HAVE A LOT OF DNA All your DNA stretched out would be able go to the sun and back 61 times ! The DNA in a single cell stretched out would be 2m long How does all that DNA fit into one cell?  CHROMOSOMES Chromosomes are packages of DNA They consist of a very large section of DNA that is wrapped around proteins called histones. Being tightly wrapped around histones allows such a large molecule to fit inside a cell Source : https://www.pinterest.com.au/pin/729794314589261990/  structure of DNA clip 1.19min All DNA is found in the nucleus of the cell KARYOTYPING Unarranged chromosomes inside a cell: This jumble of chromosomes are sorted out into matching pairs in order to study the chromosomes of an individual. This is called karyotyping http://www.myhealth.gov.my/en/karyotype-analysis/ KARYOTYPES Male Female https://nicegenescurriculumweb.weebly.com/mission-2-karyotype.html https://www.biology.iupui.edu/biocourses/N100/2k4csomaldisordersnotes.html Chromosomes are matched based on SIZE and BANDING PATTERN Humans have 23 pairs of chromosomes Pairs 1-22 are known as AUTOSOMES Pair number 23 are known as the SEX CHROMOSOMES HOMOLOGOUS CHROMOSOMES Chromosomes are sorted into matched pairs based on size and BANDING PATTERN Each ‘band’ represents a gene. A single chromosome can have 1000s of genes! Chromosomes with matching banding patterns are called homologous chromosomes – they have the same gene in the same location! SEX CHROMOSOMES XX – females chromosomes XY – males chromosome (Y chromosomes are shorter than X chromosomes) The sex chromosomes have the genes which are responsible for sexual characteristics. https://phys.org/news/2015-05-sex-chromosomeswhy-genes.html CHROMOSOME NUMBER In total, humans have 46 chromosomes in their body cells. However, egg and sperm cells only have 23 chromosomes. During fertilization, an egg cell (23) and a sperm cell (23) combine to form a zygote (you – total 46) SUMMARY 1. GENES are sections of DNA that code for a particular protein 2. GENES have different sequence of bases (code) + different number of bases (length) 3. DNA is condensed into chromosomes 4. Chromosomes fit inside the nucleus of a cell  Scissors, glue and BOOKLET PAGE 7-9 rulers available ☺ RECAP! What makes up DNA? What is complementary base pairing? What is a gene? What is a chromosome? How many chromosomes does a normal human cell have? If a person has sex chromosomes XY, are they male or female? THINK If 30% of the bases in a particular DNA molecule are guanine (G), what percentage of the bases would be thymine (T)?