Introduction to Genetics

Welcome to Genetics

• Genetics is a broad subject, encompassing various aspects of life
• Several real-world applications are discussed, such as transgenic organisms, designer babies, and end-of-life decisions

Topics Covered

• The study of genetics includes key aspects like inheritance, cell division, protein synthesis, and DNA structure
• These topics are presented in a hierarchical order, from the fundamental building blocks of life to broader concepts

Assessment Overview

• Assessment of genetics will include miniquizzes (3, each worth 2%), a genetics topic test (20%), and an end-of-semester exam (30%)
• Miniquizzes focus on DNA structure, transcription + translation, and cell division + inheritance
• The importance of understanding the relationship between these foundational elements and more complex topics is highlighted.

What is DNA?

• DNA stands for deoxyribonucleic acid
• It functions as coded instructions for producing proteins
• The physical characteristics of an organism are determined by these proteins
• The double helix structure was described by Watson and Crick in 1953

Structure of DNA

• DNA is composed of smaller units called nucleotides
• Each nucleotide consists of a phosphate group, a deoxyribose sugar, and one of four nitrogenous bases (A, T, G, C)
• The bases are the fundamental units that dictate the sequence and characteristics of DNA structures

The Four Bases

• The four bases in DNA are Adenine (A), Thymine (T), Guanine (G), and Cytosine (C)
• These bases pair specifically with each other (A with T, G with C)
• The precise pairing of bases is essential for complementary DNA structure

Structure of DNA (Continued)

• Nucleotides link together alternating phosphate and sugar groups
• The bases are always attached to the sugar
• The arrangement of bases follows a pattern dictated by the specific pairing of A with T and G with C

DNA is a Double Helix

• DNA is comprised of two intertwined strands resembling a ladder
• The side rails of the ladder are formed by alternating deoxyribose sugars and phosphate groups
• The steps of the ladder are formed by complementary base pairs, joined by hydrogen bonds

Complementary Base Pairing

• Adenine (A) pairs with Thymine (T)
• Guanine (G) pairs with Cytosine (C)
• This pairing is crucial for accurate DNA replication

Complementary Base Pairing (Example)

• For a given DNA sequence ATTCAGGTCCAC, the complementary strand would be TAAGTCCAGGTG

Do Now

• Students should review pages 4 and 5 of the booklet

DNA Modelling

• Students will use modelling kits to construct DNA structures

Watson and Crick

• Information about Watson and Crick is included.
• The names of the scientists are provided, along with the date of their discovery.

Recap

• Key questions about DNA, complementary base pairing, genes, chromosomes, chromosome number, and sex determination were included for review.
• The questions facilitate students' understanding of fundamental concepts.

Think

• This section includes the following question: if 30% of the bases in a DNA molecule are guanine, then what is the percentage of the bases that are thymine?
• This stimulates problem-solving skills using the knowledge of base pairing rules.

Genes

• Sections of DNA that code for a specific protein.
• These genes determine certain traits.
• The sequence and length of bases define the gene's uniqueness.

Genes (Example Traits)

• Eye color (ATGGCGTAA)
• Hair color (GGCCTAAAGCTAATCGATCG)
• Many examples of trait variations can be shown through the provided sequences.

We Have a Lot of DNA

• The DNA in each cell, if straightened, would be remarkably long.
• The length is several times the distance from Earth to the sun.
• The amazing compaction mechanism is discussed.

Chromosomes

• Chromosomes pack DNA to fit inside cells (a large amount of DNA within a small area)
• DNA is wound around proteins called histones.

All DNA is in the Nucleus

• All the DNA in a living cell is located within the nucleus of the cell.

Karyotyping

• The process of organizing chromosomes to study an individual's genetic makeup.
• Chromosomes are sorted into ordered pairs based on size and banding patterns

Karyotypes (Male and Female)

• Human cells have 23 pairs of chromosomes.
• Chromosomes 1-22 are autosomes
• The 23rd pair are sex chromosomes (XY in males; XX in females)
• These chromosomes are differentiated based on size and banding patterns

Homologous Chromosomes

• Chromosomes are sorted based on their size and banding pattern
• Each "band" represents a gene
• The same gene might be present on both chromosomes

Sex Chromosomes

• Sex chromosomes (X and Y) carry distinct genes that influence sexual characteristics.
• The Y chromosome is typically shorter than the X chromosome, signifying variations in gene distribution across sex chromosomes.

Chromosome Number

• Human body cells have 46 chromosomes (23 pairs).
• Reproductive cells (egg and sperm) have 23 chromosomes.
• These chromosomes join during fertilization to form a zygote, resulting in the 46 chromosome number in the resultant offspring.

Summary

• Genes are DNA sections encoding specific proteins.
• Genes differ in their base sequences and lengths.
• DNA is condensed into chromosomes for storage.
• These chromosomes reside within the cell nucleus.

Booklet Page 7-9

• Scissors, glue, and rulers will be useful for the exercises in pages 7-9 of the booklet.