RCSI Mendelian Genetics 2 X-Linked, Mitochondrial, Triplet Repeat PDF

RCSI Royal College of Surgeons in Ireland Coláiste Ríoga na Máinleá in Éirinn MENDELIAN GENETICS 2 X-LINKED, MITOCHONDRIAL, BAHRAIN TRIPLET REPEAT Mod...

RCSI Royal College of Surgeons in Ireland Coláiste Ríoga na Máinleá in Éirinn MENDELIAN GENETICS 2 X-LINKED, MITOCHONDRIAL, BAHRAIN TRIPLET REPEAT Module : Foundations For Practice 1 FFP1 Class: MedYear1 semester 1 Lecturer : Paul O’Farrell Date : 18 October 2023 Learning objectives Explain X-chromosome inactivation in females Describe extra-nuclear inheritance (mitochondrial DNA disorders) Discuss triplet repeat disorders, parent of origin effects and anticipation (with examples: Huntington disease and Fragile X Syndrome) Sex determining chromosomes Sex is determined at fertilization Sex chromosomes Male XY Female XX Males are ‘hemizygous’ for the X chromosome Why do males and females produce ~equal amounts of proteins encoded by genes on the X chromosome, when females have twice as many chromosomes? Eg G6PD ; Factor VII X chromosome inactivation In female cells, one of the two X- chromosomes is inactivated Inactivation: – Occurs early in embryonic life – Is random : ie either the paternal or the maternal X can be inactivated – Is virtually complete – Is permanent and clonally propagated The inactive X chromosome appears as a dark-staining mass known as a Barr body X-chromosome inactivation Mosaicism (with piebalding) Thompson&Thompson 5.16 X-linked diseases Genes carried on the X chromosome are “X-Linked” X-linked diseases have a characteristic pattern of inheritance with a complete lack of male to male transmission May be dominant or recessive - Males are hemizygous for X and thus X-linked mutant traits are fully expressed in males Random X inactivation occurs in females – X-linked traits are variably expressed – Balanced X-inactivation – Skewed X-inactivation ‘Manifesting heterozygote’ – the normal X chromosome is preferentially inactivated Unbalanced inactivation -- the mutant X chromosome is preferentially inactivated: clinically unaffected X-linked disease and the heterozygous female X-linked disease may or may not be expressed in a heterozygous female Operational definition : Diseases that are rarely expressed clinically in females are said to be X-linked recessive (XLR) Diseases that are expressed clinically in many females are said to be X-linked dominant (XLD) Diseases are characterized as XLR vs. XLD depending on the relative proportions of males and females who are affected X-linked recessive XLR mating types all males normal all females carriers X X X X m ½ of males affected Xm XmX XmX X XX XXm ½ of females carriers Y XY XY Y XY X Y m XLR diseases Haemophilia A Deficiency of factor VIII, an essential blood clotting factor; characterised by soft-tissue bleeding Duchenne Muscular Dystrophy A form of muscular dystrophy; onset at ~5 years, progressive muscle weakness, death in early 20s; due to respiratory or cardiac complications X-linked dominant Example: vitamin-D resistant rickets (hypophosphatemic rickets) Low blood and high urinary phosphate Short stature and bony deformities Absence of male-to-male transmission Daughters of affected males may be affected Typically, expression of XLD symptoms are more severe and constant in males than in females XLD pedigree Absence of male to male transmission Males and females affected All daughters of an affected male are affected Affected female – 50% risk for all offspring (m or f) Thompson & Thompson 5.20 Extra-nuclear inheritance The mitochondrion contains a ~16kb circular DNA genome – mtDNA It is maternally inherited The sperm mitochondria are located near the tail and are not injected into the ovum Some human diseases are characterised by abnormal mtDNA Often involve skeletal/cardiac muscle impairment and neurological problems Eg Leber’s heriditary optic atrophy Mitochondrial inheritance Vertical transmission Affects both sexes but only transmitted by the mother Affects all children of an affected mother Homoplasmy – every mitochondrial genome has mutation Heteroplasmy – mixture of normal and mutant mitochondrial genome transmitted -- Variation in severity Thoimpson & Thompson 12.32 Triplet repeat disorders General Population – Sequences of three bp repeats throughout the genome – May be polymorphic : variable number of repeats between individuals Triplet repeat disorders: Due to unstable expansion in number of repeats ttaaaaattgttttttcactgaggtgtttaagaatagccaagaataaatgtcag tttgaattagtagtagtagtagtagtagtagtagtagtagtagtagtagc Acacacacacacatatatatgagagttaatatgaaaatataaaaaattattaca aatcagtaaaaaatctctataataagaaaatggtataaactgataattcataaa Triplet repeat expansion diseases At least 30 diseases are known to result from triplet repeat expansion Characteristics/differences – Inheritance : AD, AR, X-linked – Base sequence of repeat – eg CGG in Fragile-X; CAG Huntingtons – Number of repeats, presymptomatic vs. affected – eg 50-100 Fragile-X; 29-35 Huntingtons – Location of repeat – 5’UTR in Fragile X; coding region in Huntingtons – Instability during meiosis and mitosis – Parent of origin effects Fragile X syndrome Most common form of inherited mental retardation ~ 1/2000 - 1/4000 individuals – (females also affected) accounts for 4-8% of males with mental retardation Fragile X syndrome Named for a characteristic break observed on the X chromosome (cytogenetics) Molecular defect in FMR1 (Fragile X Mental Retardation 1) gene RNA binding protein involved in formation of synapses(see final slide) FMR1 has CGG ‘triplet repeat’ in the 5’ UTR During meiosis in the female, the repeat is unstable and can increase in length – expansion (= maternal parent of origin effect) Expansion beyond 200 copies prevents translation of FMR1 protein Fragile X syndrome 10 – 50 CGG repeats - normal 50 – 100 repeats - premutation 200 – 2000 repeats - full mutation Grandfather (I-1) has premutation -- is a ‘normal transmitting male’ Expansion of repeats during meiosis in Mother (II-2) results in full mutant gene being transmitted to son (III-1) - ‘modified’ X-linked inheritance Premutation : upper limit of normal, but capable of expanding to disease Anticipation, the Sherman paradox and parent of origin effects Anticipation & the Sherman paradox: Expansion of mutation from one generation to the next Sometimes seen clinically as: reduced age of onset and / or increased severity down the pedigree Parent of origin effect Premutation – expansion occurs: in fragile X, premutation only expands in female : risk only if inherited from mother  sometimes described as being “maternally transmitted “ Huntington’s disease CAG triplet repeat in protein coding region  polyQ region in protein Over 28 repeats leads to unstable expansion Expansion beyond ~ 36 -40 repeats leads to expression of a protein that causes neuronal damage Paternal parent of origin effect (Expansion of repeat number occurs in males) Autosomal dominant Anticipation: age of onset of HD vs. number of repeats Other resources Reading Thompson & Thompson ch 5,12 ABC of clinical genetics Ch 6