DNA damage and repair 2023-24.ppt

Mutations & Repair Dr. Ayşe ÖZER mutation a mutation is an alteration in the nucleic acid sequence of the genome of an organism, virus, or extrachromosomal DNA. polymorphism the occurance together in a population of two or more alternative genotypes, each at a frequency greater than that whic...

Mutations & Repair Dr. Ayşe ÖZER mutation a mutation is an alteration in the nucleic acid sequence of the genome of an organism, virus, or extrachromosomal DNA. polymorphism the occurance together in a population of two or more alternative genotypes, each at a frequency greater than that which could be maintained by recurrent mutation alone. a locus considered to be polymorphic if the rarer allele has a frequency of .01 What are Mutations ? • Mutations are results of changes to the normal DNA sequence for a gene Typical gene - a linear sequence of about 2000 base pairs AGCCGTGCTGTCGAAAACGTTCAGACTCATTGGCAATCCGAAGTCGGCA TCGGCACGACAGCTTTTGCAAGTCTGAGTAACCGTTAGGCTTCAGCCGT A mutant allele could result from change in only one of them - knocking out the function of that gene AGCCGTGCTGTCGAAAACTTTCAGACTCATTGGCAATCCGAAGTCGGCA TCGGCACGACAGCTTTTGAAAGTCTGAGTAACCGTTAGGCTTCAGCCGT MUTATIONS Wild-type strain Mutant strain DNA DNA Mutant Mutant DNA DNA RNA RNA Altered Altered RNA RNA Correct Correct PROTEIN PROTEIN Defective Defective PROTEIN PROTEIN (( functional functional enzyme) enzyme) Normal Normal PHENOTYPE PHENOTYPE (wild-type) (wild-type) (non-functional (non-functional enzyme) enzyme) Mutant Mutant PHENOTYPE PHENOTYPE RNA-splicing mutasyonları Fenilketonüride fenilalanin hidroksilaz (PAH) enzim mutasyonu Types of mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein)  A silent mutation - no effect on phenotype AUG UUA UUG ACU AAG met leu leu thr lys Types of mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein) • A missense mutation -- may cause defective protein AUG UUA UUU ACU AAG met leu phe thr lys Changes ‘sense’ of one amino-acid • A nonsense mutation -- will make shorter protein AUG UUA UGA ACU AAG met leu stop . . Frame-shift Mutation 1 4 7 10 13 16 19 ATG GGA GCT CTA TTA ACC TAA met gly ala leu leu thr stop  ATG GGG AGC TCT ATT AAC CTA met gly ser ser ile asn stop ATT TGA leu ile Point mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein) • A base substitution mutation AUG UUA UUU ACU AAG met leu phe thr lys • An insertion or a deletion (frameshift) AA G-AUG UUA UUA ACU AUAG stop met leu leu thr lys Point mutations AUG UUA UUA ACU AAC met leu leu thr asn Insertion of 1 base AUG UUU AUU AAC UAA C met phe ile asn stop ... All amino acids now scrambled from this point on Insertion of 2 bases AUG UUU UAU UAA CUA AC met phe tyr stop ... ... All amino acids now scrambled from this point on Insertion of 3 bases AUG UUA UUA UUA ACU AAC met leu leu leu thr asn Amino acids now OK again Spontaneous damage to DNA • There are two major forms of spontaneous DNA damage: (A) deamination of adenine, cytosine, and guanine, and Spontaneous damage to DNA (B) depurination (loss of purine bases) resulting from cleavage of the bond between the purine bases and deoxyribose, leaving an apurinic (AP) site in DNA. dGMP = deoxyguanosine monophosphate. Examples of DNA damage induced by radiation and chemicals (A) UV light induces the formation of pyrimidine dimers, in which two adjacent pyrimidines (e.g., thymines) are joined by a cyclobutane ring structure. Examples of DNA damage induced by radiation and chemicals (B) Alkylation is the addition of methyl or ethyl groups to various positions on the DNA bases. In this example, alkylation of the O6 position of guanine results in formation of O6methylguanine. Examples of DNA damage induced by radiation and chemicals (C) Many carcinogens (e.g., benzo-(a)pyrene) react with DNA bases, resulting in the addition of large bulky chemical groups to the DNA molecule. DNA Repair Direct repair of thymine dimers • UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring. Base-excision repair • uracil (U) has been formed by deamination of cytosine (C) and is therefore opposite a guanine (G) in the complementary strand of DNA. The bond between uracil and the deoxyribose is cleaved by a DNA glycosylase, leaving a sugar with no base attached in the DNA (an AP site). This site is recognized by AP endonuclease, which cleaves the DNA chain. The remaining deoxyribose is removed by deoxyribosephosphodiesterase. The resulting gap is then filled by DNA polymerase and sealed by ligase, leading to incorporation of the correct base (C) opposite the G. Nucleotide-excision repair of thymine dimers • Damaged DNA is recognized and then cleaved on both sides of a thymine dimer by 3 and 5 nucleases. Unwinding by a helicase results in excision of an oligonucleotide containing the damaged bases. • The resulting gap is then filled by DNA polymerase and sealed by ligase. Mismatch repair in E. coli • The mismatch repair system detects and excises mismatched bases in newly replicated DNA, which is distinguished from the parental strand because it has not yet been methylated. MutS binds to the mismatched base, followed by MutL. The binding of MutL activates MutH, which cleaves the unmodified strand opposite a site of methylation. MutS and MutL, together with a helicase and an exonuclease, then excise the portion of the unmodified strand that contains the mismatch. The gap is then filled by DNA polymerase and sealed by ligase. Mismatch repair in mammalian cells • Mismatch repair in mammalian cells is similar to E. coli, except that the newly replicated strand is distinguished from the parental strand because it contains strand breaks. MutS and MutL bind to the mismatched base and direct excision of the DNA between the strand break and the mismatch. Postreplication repair • The presence of a thymine dimer blocks replication, but DNA polymerase can bypass the lesion and reinitiate replication at a new site downstream of the dimer. The result is a gap opposite the dimer in the newly synthesized DNA strand. In recombinational repair, this gap is filled by recombination with the undamaged parental strand. Although this leaves a gap in the previously intact parental strand, the gap can be filled by the actions of polymerase and ligase, using the intact daughter strand as a template. Two intact DNA molecules are thus formed, and the remaining thymine dimer eventually can be removed by excision repair. Thank you……